1

N-acetyl-cysteine and celecoxib lessen cadmium cytotoxicity which is associated with

cyclooxygenase-2 up-regulation

Maria E. Figueiredo-Pereira*, Zongmin Li, Marlon Jansen and Patricia Rockwell

From the Department of Biological Sciences,

Hunter College of City University of New York, New York 10021

*To whom correspondence should be addressed:

Maria E. Figueiredo-Pereira, Dept. of Biological Sciences,

Hunter College of City University of New York, 695 Park Ave., New York, NY 10021.

Tel.: 212-650-3565; Fax: 212-772-5227; E-mail: pereira@genectr.hunter.cuny.edu

Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on May 7, 2002 as Manuscript M109145200 by guest on D

ecember 8, 2020

http://ww

w.jbc.org/

Dow

nloaded from

2

Running Title: cadmium, ubiquitin/proteasome pathway and cyclooxygenase-2

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

3

SUMMARY

In many neurodegenerative disorders, aggregates of ubiquitinated proteins are detected in

neuronal inclusions but their role in neurodegeneration remains to be defined. To identify

intracellular mechanisms associated with the appearance of ubiquitin-protein aggregates, mouse

neuronal HT4 cells were treated with cadmium. This heavy metal is a potent cell poison that

mediates oxidative stress and disrupts the ubiquitin/proteasome pathway. In the current studies,

the following intracellular events were found to be also induced by cadmium: (i) a specific rise in

cyclooxygenase-2 (COX-2) gene expression but not cyclooxygenase-1, (ii) an increase in the

extracellular levels of the pro-inflammatory prostaglandin PGE2, a product of COX-2 and (iii)

production of 4-hydroxy-2-nonenal-protein adducts, which result from lipid peroxidation. In

addition, cadmium treatment led to the accumulation of high molecular weight ubiquitin-COX-2

conjugates and perturbed COX-2 glycosylation. The thiol reducing anti-oxidant N-acetyl-

cysteine, and, to a lesser extent, the COX-2 inhibitor Celecoxib attenuated the loss of cell

viability induced by cadmium demonstrating that oxidative stress and COX-2 activation

contribute to cadmium cytotoxicity. These findings establish that disruption of the

ubiquitin/proteasome pathway is not the only event triggered by cadmium. This oxidative

stressor also activates COX-2 function. Both events could be triggered by formation of 4-

hydroxy-2-nonenal as a result of cadmium-induced lipid peroxidation. Pro-inflammatory

responses stimulated by oxidative stressors that mimic the cadmium effects may, therefore, be

important initiators of the neurodegenerative process and exacerbate its progress.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

4

INTRODUCTION

The ubiquitin/proteasome pathway plays a major role in the intracellular quality control

process by degrading mutated or abnormally folded proteins to prevent their accumulation as

aggregates [reviewed in (1)]. In many neurodegenerative disorders, however, aggregates of

ubiquitinated proteins are detected in neuronal inclusions [reviewed in (2)]. A correlation

between neuronal inclusions and cell death remains to be established (3;4). Nevertheless, recent

findings demonstrated that protein aggregates directly impair the function of the

ubiquitin/proteasome pathway, the latter known to be essential for cell survival (5).

It has become increasingly evident that functional changes in the ubiquitin/proteasome

pathway are critical to the neurodegenerative process. For example, a mutant form of ubiquitin,

known as Ub+1, was detected only in brains of Alzheimer’s disease (AD) patients and not in age

matched controls (6). Ub+1-capped polyubiquitin chains were shown to be refractory to

disassembly by de-ubiquitinating enzymes and to potently inhibit proteasome degradation of a

polyubiquitinated substrate (7). Moreover, particular areas of AD brains were found to exhibit

compromised proteasome activities when compared to age matched controls (8). In addition, a

decline in ubiquitination activity was shown to decrease cell viability in a cellular model of

Huntington's disease (9). In this model, transfected rat striatal neurons co-expressing a non-

functional ubiquitin-conjugating enzyme and a mutant huntingtin containing polyglutamine

expansions showed a greater loss of cell viability than transfectants expressing the huntingtin

mutant alone (9). Together, these results strongly support the view that disruption of the

ubiquitin/proteasome pathway plays an important role in neurodegeneration.

Oxidative stress is another mechanism found to be involved in neurodegeneration.

Increasing evidence supports its role in neuronal death in disorders such as AD and Parkinson’s

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

5

disease (PD). Studies with autopsied brains of AD patients show a co-localization of high levels

of oxidative stress products with neurofibrillary tangles (NFT) and senile plaques (10).

Furthermore, signs of oxidative stress, such as lipid peroxidation and a decline in reduced

glutathione (GSH), were detected in the substantia nigra in brains of PD patients (11). The

production of free radicals by oxidative stress promotes partial unfolding of cellular proteins,

resulting in exposure of previously buried hydrophobic domains to proteolytic enzymes (12-14)

and to ubiquitin-conjugating enzymes (15). This sudden increase in protein substrates may

compromise the capacity of the ubiquitin/proteasome pathway to clear the abnormal proteins and

cause their aggregation and accumulation within the cell. However, the link between oxidative

stress and the accumulation of ubiquitinated proteins in neurodegeneration remains to be

established.

To address the relationship between oxidative stress and disruption of the

ubiquitin/proteasome pathway in the neurodegenerative process, we chose to treat mouse

neuronal HT4 cells with cadmium (Cd2+). This heavy metal increases lipid peroxidation in

organs such as the brain, which is particularly sensitive to Cd2+-toxicity (16). Although Cd2+ is

not a Fenton metal and thus, by itself, is unable to generate reactive oxygen species (ROS), free

radical scavengers and anti-oxidants lessen Cd2+-toxicity, suggesting that the heavy metal elicits

an increase in free radical production [reviewed in (17)]. Earlier studies (18) suggested a close

link between Cd2+ cytotoxicity and the ubiquitin/proteasome pathway as yeast mutants deficient

in a specific ubiquitin-conjugating enzyme (UBC7) or a proteasome subunit (PRE1) were shown

to be hypersensitive to the heavy metal. Moreover, our previous studies with neuronal cells

(19;20) demonstrated that Cd2+ disrupts intracellular sulfhydryl homeostasis, leads to an

accumulation of ubiquitinated proteins and to a loss in cell viability. The ubiquitinated proteins

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

6

that accumulate in cells upon Cd2+-treatment and the mechanisms mediating its toxicity in

neuronal cells remain poorly defined.

Herein we report that, in mouse neuronal HT4 cells, Cd2+ initiated a pro-inflammatory

response by inducing up-regulation of COX-2 at the mRNA and protein levels without affecting

COX-1. As a result of this response, there was an increase in the extracellular concentrations of

the pro-inflammatory prostaglandin PGE2, which is a COX-2 product. Moreover, treatments

with the heavy metal resulted in the stabilization of glycosylated and unglycosylated forms of

COX-2 as well as an accumulation of ubiquitin-COX-2 conjugates. Cd2+ also induced the

formation of HNE-protein adducts in the neuronal cells indicating that its cytotoxicity may be

mediated by HNE, a highly cytotoxic aldehyde product of lipid peroxidation. Based on the

observations that Cd2+-induced oxidative stress is closely associated with COX-2 up-regulation

and neuronal cell death, we evaluated the protective effect of two anti-oxidants [N-acetyl-

cysteine (NAC) and ascorbic acid] and a COX-2 specific inhibitor (Celecoxib) on Cd2+-

cytotoxicity. Of the three drugs tested, NAC, a thiol reducing anti-oxidant, was the most

effective in preventing the loss of cell viability caused by the heavy metal. Ascorbic acid, a free

radical scavenger, failed to prevent and even potentiated Cd2+-cytotoxicity in some instances.

Celecoxib, the COX-2 specific inhibitor, attenuated the loss of cell viability caused by the heavy

metal under certain conditions. These studies provide evidence that both the disruption of the

ubiquitin/proteasome pathway and the induction of a pro-inflammatory response are induced by

oxidative stressors such as cadmium. These two mechanisms may be associated in the

neurodegenerative process.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

7

EXPERIMENTAL PROCEDURES

Materials - Cadmium sulfate, NAC, ascorbic acid, actinomycin D, puromycin and MTT

were from SIGMA (St. Louis, MO). Tunicamycin was from Calbiochem (La Jolla, CA).

Celecoxib was a generous gift from Pharmacia Corp. (Peapack, NJ). The goat polyclonal

antibodies anti-COX-2 (1:1,000) and anti-COX-1 (1:1,000) were obtained from Santa Cruz

Biotechnology (Santa Cruz, CA). Ubiquitin protein conjugates were detected with a rabbit

polyclonal antibody (1:1,500) from Dako Corp. (Carpinteria, CA). 4-hydroxy-2-nonenal (HNE)

protein adducts were identified with a rabbit polyclonal antibody (1:1,000) from Calbiochem

(San Diego, CA). The Super Signal West Pico detection system and the bicinchoninic acid

protein assay kit were from PIERCE (Rockford, IL). Other reagents were of the highest purity

available.

Cell Cultures—HT4 cells were derived from a mouse neuroblastoma cell line infected with

a retrovirus encoding the temperature-sensitive mutant of SV40 large T antigen. When grown at

39oC (non-permissive temperature), HT4 cells differentiate with neuronal morphology, express

neuronal antigens, synthesize and secrete nerve growth factor, and express receptors for nerve

growth factor (21). The cells were maintained at 33oC in Dulbecco's modified Eagle's medium

containing 5% fetal bovine serum, as previously described (19).

Cell Treatments—Cultures of HT4 cells were treated at 37oC with aqueous solutions of

cadmium sulfate added to serum-containing medium. When specified, anti-oxidants (1mM NAC

or 1mM ascorbic acid) or the COX-2 inhibitor Celecoxib (20µM) or inhibitors of transcription

(15µg/ml actinomycin D) or translation (25µg/ml puromycin) or an inhibitor of N-linked

glycosylation (10µg/ml tunicamycin), were added to the culture media 1h prior to Cd2+-

treatment. NAC, ascorbic acid and puromycin were dissolved in water and the remaining listed

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

8

drugs were dissolved in DMSO. At the end of the indicated incubation times, the cultures were

washed twice with PBS and the cells were harvested as previously described (22). Cell washes

removed unattached cells, hence, subsequent assays, were performed on adherent cells only.

Preparation of Cell Extracts for Western Blotting— Cell extracts were prepared and

subjected to SDS-PAGE as previously described (19). Identification of COX-1, COX-2,

ubiquitinated proteins and HNE-protein adducts was by Western blotting on 8% polyacrylamide

gels. For detection of HNE-protein adducts the samples were run under non-reducing conditions

in the absence of β-mercaptoethanol. The antigens were visualized by a horseradish peroxidase

method utilizing the Super Signal West Pico detection system. Quantitative analysis of the

immunostaining was by image analysis with the ImagePC program from NIH as described

previously (23).

RT-PCR analysis - Total RNA was isolated with the RNAeasy Kit from QIAGEN

(Valencia, CA). To perform each RT-PCR 1µg of RNA/sample was reverse-transcribed in a 25µl

reaction (Omniscript RT Kit from Qiagen, Valencia, CA) and 2µl of the resultant cDNA was

amplified with gene specific primers using the Taq PCR core Kit from QIAGEN (Valencia, CA).

The mouse specific PCR primers were for cox-2 (forward: CAGCACTTCACCCATCAGTT;

reverse: CTGGTCAATGGAGGCCTTTG) and for ubA (forward:

CAACATCCAGAAAGAGTCCA; reverse: CCTCATCTTGTCACAGTTGT). Primers were

designed from cDNA sequences obtained from GenBank under the following Accession

numbers: M88242 for mouse cox-2 and M11690 for mouse ubA. PCR was performed as follows:

5 minutes at 94oC, then 35 cycles for ubA and 30 cycles for cox-2 of 1 minute at 94oC, 1 minute

at 60oC and 1.5 minutes at 72oC with a final extension at 72oC for 10-min.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

9

PGE2 Concentrations – Levels of PGE2 released into the media of treated cells were

measured by an enzyme-linked immunoassay according to manufacturer's instructions (Cayman

Chemicals, Ann Arbor, MI). For all experiments, cells were seeded at a density of 1.5 X 105

cells/ml. Amounts of PGE2 are expressed as ng of PGE2 produced/ml of media.

Immunoprecipitation – Immunoprecipitation of COX-2 from total cell extracts, normalized

to protein concentration, was performed as previously described (24). The immunocomplexes

were resolved on 8% SDS gels, followed by Western blot analysis probed with the anti-COX-2

antibody, proceeded by stripping and reprobing with the anti-ubiquitin conjugates antibody.

Cell Viability Assay—Cell viability was assessed with a modification of the method

described in Mosmann (25) by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium

bromide (MTT) assay as previously described (19).

Glutathione Assay — Total GSH was quantified as described previously (26) by a

modification of the standard recycling assay based on the reduction of 5,5-dithiobis(2-

nitrobenzoic acid) with glutathione reductase and NADPH. This assay measures both GSH and

GSSG; normally GSSG measures less than 5% of the total GSH in control cell cultures.

Protein Determination—Protein levels were determined with a bicinchoninic acid assay kit.

Statistical Analysis—Statistical comparisons between two groups (Fig. 6) or among three or

more groups (Fig. 8) were performed with the unpaired “t” test or with the Tukey-Kramer

multiple comparison test (Instat 2.0, Graphpad Software, San Diego, CA), respectively.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

10

RESULTS

Cadmium Induces a Time- and Dose-dependent Increase in COX-2 Protein Levels - To

determine the time and concentration dependence of the effect of Cd2+ on the intracellular levels

of COX-2, we treated confluent HT4 cells with a range of concentrations between 1.5 and 45 µM

of CdSO4. After incubations of 10-48 h, intracellular levels of COX-2 in total lysates prepared

from adherent cells were visualized by Western blot analysis as described under "Experimental

Procedures". Fig 1 shows the dose-dependent course of the changes in COX-2 levels after

treatment for 10h (A), 16h (B), 24h (C) and 48h (D) with CdSO4. Anti-COX-2 immunoreactivity

detected a light 72kDa band in control cells or cells treated with 1.5µM CdSO4. This band

corresponds to COX-2 that is N-glycosylated at three sites (27). In cells treated with higher Cd2+

concentrations, such as 3, 15, 30 and, in some cases, 45µM, two additional bands were identified

as corresponding to COX-2 forms that are N-glycosylated at four sites (74kDa) and non-

glycosylated (65kDa), respectively (27). The three COX-2 bands, corresponding to 74, 72 as

well as 65kDa, are clearly visible in Fig. 5 (below). COX-2 levels rose above control as early as

10h after treatment with 15µM CdSO4, which is the Cd2+ concentration that most effectively

increases COX-2 levels to a range between 3 and 38-fold above control (Fig. 1E). In addition, a

form of COX-2 (Ub-COX-2) that migrated at a high molecular weight, was clearly identified at

the top of blots corresponding to cells treated for 24 and 48h with 15µM Cd2+ (Fig.1C and D). At

higher Cd2+ concentrations (45µM) the levels of all COX-2 forms decrease. This effect is most

likely due to a dramatic loss in cell viability caused by high Cd2+ concentrations (see below).

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

11

Cadmium Up-regulates COX-2 Gene Expression - The increase in COX-2 protein levels

observed in HT4 cells upon treatment with the heavy metal could result from either a reduction

in COX-2 degradation or to an increase in its expression. To establish if cadmium affects cox-2

gene expression we carried out RT-PCR analyses with gene-specific primers. These studies

revealed that CdSO4 concentrations ranging between 3 and 30µM caused a considerable

induction of cox-2 mRNA (Fig. 2A). The ubA mRNA levels did not change significantly with

these treatments. The levels of cox-2 and ubA mRNA were both decreased by 45µM CdSO4,

most likely due to the high level of cell death elicited by this concentration of the heavy metal.

Pre-treatment of HT4 cells with inhibitors of transcription (actinomycin D) or translation

(puromycin) prevented the Cd2+-induced rise in COX-2 protein levels [compare Fig. 2B (top

panel) with Fig. 2C]. Only the preexisting 72kDa form of COX-2 was identified in cells pre-

treated with actinomycin D or puromycin. This finding demonstrates that the other COX-2 forms

detected in cells treated solely with Cd2+, namely the 74 and 65kDa as well as Ub-COX-2, are

dependent on de novo protein synthesis.

The increase in cyclooxygenase levels induced by Cd2+ is specific for COX-2. Protein

levels of COX-1, which is constitutive in HT4 cells, was not raised by treatment with increasing

concentrations of the heavy metal (Fig. 2B, lower panel).

Cadmium Increases PGE2 levels - To evaluate the functional changes in COX-2 levels shown in

Fig. 1, culture media from HT4 cells incubated with different Cd2+-concentrations over time

were analyzed for production of the proinflammatory prostaglandin PGE2, a COX-2 product

(Fig. 3). In the absence of cadmium, HT4 cells maintained a basal level of approximately 0.25ng

of PGE2/ml media. After 24h incubations with increasing concentrations of cadmium, PGE2

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

12

levels were elevated to a maximum of 90ng of PGE2/ml media, a 360-fold increase over basal

levels. After 48h of treatment, PGE2 production in cells treated with 30 and 45µM Cd2+ was at

least 3-fold lower than in those treated with 15µM of the heavy metal. This decline in PGE2

production most likely reflects the poor cell survival caused by higher Cd2+ concentrations.

Cadmium Induces Accumulation of High Molecular Mass Ubiquitin-COX-2 conjugates and

Perturbs COX-2 Glycosylation - The COX-2 immunoreactive high molecular mass forms

detected by Western blot analysis of total cell lysates probed with anti-COX-2 were further

characterized for the presence of ubiquitin. Total lysates prepared from control and Cd2+ -treated

HT4 cells were subjected to imunoprecipitation with the anti-COX-2 antibody. Western blots of

the immunoprecipitated proteins probed with the anti-COX-2 antibody (Fig. 4B) revealed three

COX-2 forms (74/72 kDa doublet and 65kDa) as well as high molecular mass COX-2 (Ub-COX-

2), a pattern of reactivity similar to the one observed in Fig.1. Only the high molecular mass

COX-2 forms were detected when these blots were stripped and reprobed with the antibody that

recognizes ubiquitin-conjugates (Fig. 4A). These findings suggest that Cd2+ promotes

stabilization of COX-2 as high molecular mass ubiquitin conjugates.

Treatment with endo H reduced the apparent molecular mass of most of the 72/74 kDa

doublet to the 65 kDa band (data not shown). The latter was also the major band identified in

Cd2+-treated cells preincubated for one hour with 10µg/ml of tunicamycin, a glycosylation

inhibitor (Fig. 5B). The 65 kDa band corresponds, therefore, to unglycosylated COX-2. These

results indicate that the shift in COX-2 apparent molecular masses seen in Cd2+-treated cells is

due to changes in the extent of its glycosylation and not to its proteolytic degradation.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

13

Evaluation of the Effect of Anti-Oxidants and a COX-2 Inhibitor on Cadmium Cytotoxicity - To

investigate which mechanisms mediate Cd2+-cytotoxicity we evaluated the effects of two anti-

oxidants, NAC and ascorbic acid, and a COX-2 inhibitor, Celecoxib, on HT4 cell viability. The

results obtained after treatments with 15, 30 and 45µM of the heavy metal for 7h or 24h are

shown in Fig. 6A and 6B, respectively. The lowest survival rate was observed as an approximate

90% decrease in cell viability after a 24h treatment with 45µM Cd2+. A 7h treatment with the

same Cd2+ concentration caused a 45% reduction in cell viability.

The thiol reducing agent NAC significantly (p<0.05) attenuated the loss in cell viability

caused by 7h [Fig.6A(a)] or 24h [Fig.6B(a)] treatments with the three Cd2+ concentrations tested.

Moreover, Celecoxib, a COX-2 specific inhibitor, significantly (p<0.05) lessened the cytotoxic

effect of 7h incubations with the same three Cd2+ concentrations [Fig.6A(b)]. The COX-2

inhibitor was less effective after 24h incubations with the heavy metal by only significantly

(p<0.05) preventing the loss of viability of cells treated with 15µM Cd2+ [Fig.6B(b)]. These

findings suggest that the induction of a pro-inflammatory response is one of the early

mechanisms activated by Cd2+ and plays an important role in its cytotoxicity. However, in longer

exposures to the heavy metal, other cytotoxic mechanisms may be sufficiently activated to

override the effect of the pro-inflammatory response alone. COX-2 activity may then contribute

to the acceleration of the cytotoxic process.

Remarkably, ascorbic acid failed to prevent the loss of cell viability caused by Cd2+-

treatment. In some instances, this free radical scavenger even intensified Cd2+-cytotoxicity [Fig.

6B(c)]. As discussed below, this effect could be due to a synergism between the anti-oxidant and

cadmium in causing lipid peroxidation (see Discussion).

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

14

Inhibitors of transcription (actinomycin D) or translation (puromycin) did not

significantly alter the loss of cell viability caused by 24h treatments with Cd2+ [Fig. 6B(d) and

(e), respectively]. These results suggest that, under these conditions, de novo protein synthesis of

COX-2 is not the sole contributor to the cytotoxic process.

It should be noted that some of the drugs tested in these experiments, namely Celecoxib,

actinomycin D and puromycin, were slightly cytotoxic. Their effect on Cd2+-mediated loss in cell

viability, therefore, reflects a comparison to cells treated with the drugs alone.

Cadmium Induces the Production of HNE-protein Adducts in HT4 neuronal cells – One

of the effects of Cd2+-induced oxidative stress is lipid peroxidation. Since HNE is a product of

lipid peroxidation, we investigated if the heavy metal causes the formation of this highly

cytotoxic aldehyde. Fig. 7 shows that 15, 30 and 45µM Cd2+ induce the formation of HNE-

protein adducts. These protein conjugates, with molecular masses above 132 kDa, are indicated

at the top of the Western blot shown in Fig.7. Since HNE is known to be an extremely reactive

electrophile, it is possible that the cytotoxic effect of Cd2+ is potentiated by this aldehyde.

The Cd2+-induced HNE-protein adducts were not detected in HT4 cells pre-treated with

NAC (Fig. 7, right lanes). The latter is a sulfur-containing anti-oxidant, which reacts directly

with free radicals and may, therefore, prevent lipid peroxidation.

NAC, but not Ascorbic Acid, Prevents the Cadmium-induced Rise in COX-2 levels as well as the

Decline in GSH levels and Attenuates PGE2-production - To further test the hypothesis that

oxidation of protein thiols and ROS production are events that mediate Cd2+ toxicity we

attempted to block some of the heavy metal effects with the thiol reducing agent NAC. As seen

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

15

in Fig. 8, 1mM NAC prevented the Cd2+-induced increase in COX-2 protein levels (Fig. 8A,

middle panel) and decline in glutathione (Fig. 8B), the latter measured after a 24h treatment with

45µM Cd2+. In addition, NAC attenuated the Cd2+-induced rise in PGE2 levels detected in HT4

cells incubated with the heavy metal for 7h (Fig. 8C). Ascorbic acid (1mM) did not block the

Cd2+-induced rise in COX-2 levels (Fig. 8A, right panel). More importantly, the decrease in GSH

and the increase in PGE2 levels caused by the heavy metal were potentiated by ascorbic acid by

a factor of 5-fold and 10 to 38-fold, respectively (Fig. 8B and D).

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

16

DISCUSSION

The aim of this study was to identify mechanisms activated by disruption of the

intracellular oxidation-reduction homeostasis and accumulation of ubiquitinated proteins, which

could contribute to neuronal cell death. For this purpose, we treated mouse HT4 neuronal cells

with cadmium, since the heavy metal is an oxidative stressor that depletes GSH, increases the

levels of protein-mixed disulfides and leads to the accumulation of ubiquitinated proteins and

neuronal cell death (19).

The present investigations reveal that Cd2+ specifically enhances COX-2 gene expression,

at the mRNA and protein levels, without affecting COX-1 expression in the HT4 neuronal cells.

In addition, the heavy metal induces a rise in the production of PGE2, a pro-inflammatory

prostaglandin that is a product of COX-2. This result demonstrates that the de novo synthesized

COX-2, resulting from Cd2+ induction, is enzymatically active. Moreover, the increases in COX-

2 expression were detected as early as a 10h treatment with 15µM Cd2+ suggesting that the

induction of a pro-inflammatory response is an early event in the cellular reaction to the heavy

metal.

Whether the accumulation of ubiquitinated proteins and/or COX-2 up-regulation are a

cause or a consequence of Cd2+ cytotoxicity in our system remains unclear. Nevertheless, the

cellular events brought about by the heavy metal in HT4 neuronal cells (19 and herein) mimic

those we reported for proteasome inhibitors (22). Like oxidative stress induced by cadmium,

proteasome inhibition leads to the accumulation of ubiquitinated proteins, to the induction of a

pro-inflammatory response and to a loss in cell viability. Therefore, the data presented herein

together with our previous findings from studies with cadmium or proteasome inhibitors (19;22)

suggest that disruption of the ubiquitin/proteasome pathway cooperates with COX-2 function in

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

17

a neurodegenerative pathway. The fact that COX-2 plays a role in neurodegeneration is

supported by several studies. For example, up-regulation of COX-2 precedes the appearance of

NFT-containing neurons and neurodegeneration in patients with Fukuyama-type congenital

muscular dystrophy, a neurodegenerative disorder transmitted through autosomal recessive

inheritance (28). Similarly, both NFT-containing and damaged neurons in Down's syndrome and

AD were found to exhibit high expression of COX-2 (29). ROS produced by COX-2 could be

responsible for its role in the neurodegenerative process. It is well established that ROS are by-

products of prostaglandin biosynthesis by cyclooxygenases and these ROS are regarded as

important contributors to tissue damage resulting from, for example, brain injury and ischemia

(28;30).

Interestingly, ROS are currently being considered to act not only as toxic metabolites but

also as signaling molecules that may regulate cellular processes such as apoptosis (31;32). ROS

derived from Cd2+treatment may cause lipid peroxidation (33). One of the products of lipid

peroxidation, HNE, is a highly reactive aldehyde recognized as one of the most important

mediators of the cytopathological effects of oxidative stress (34). Our observation that Cd2+

caused formation of HNE-protein adducts, indicates that HNE may, in fact, be one of the

molecules triggering some of the intracellular responses to Cd2+. In support of this hypothesis, a

study involving a screen of 15 different oxidized fatty acid metabolite products of lipid

peroxidation, revealed that HNE was the only specific inducer of COX-2 in rat liver epithelial

RL34 cells (35). Moreover, HNE-modified proteins were shown to become ubiquitinated (36)

and act as non-competitive inhibitors of the proteasome (37). Other studies demonstrated that

HNE can directly modify the proteasome and inhibit its trypsin-like and caspase-like activities

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

18

(36). Consequently, under the conditions tested in our studies, HNE may be one of the molecules

contributing to COX-2 up-regulation as well as to the accumulation of ubiquitinated proteins.

To confirm that ROS production mediates some of the Cd2+effects we treated HT4 cells

with two anti-oxidants, namely NAC and ascorbic acid. NAC is a thiol-reducing agent known to

increase GSH pools and to react with ROS in cells (38;39). The present studies demonstrate that

NAC attenuates the Cd2+ effects on cytotoxicity, formation of HNE-protein adducts, COX-2

induction and PGE2 production as well as the decline in GSH, confirming that oxidative stress is

an important mechanism mediating cadmium toxicity. The demonstration that NAC decreases

the HT4 neuronal cell loss in viability induced by 45µM Cd2+ underscores the capability of the

thiol reducing agent to protect cells from oxidative stress. Due to their anti-oxidant properties,

thiol reducing agents such as NAC are emerging as potential therapeutic drugs to manage

neurodegenerative disorders such as PD (38;39).

Ascorbic acid is an anti-oxidant and free radical scavenger effective against peroxyl- and

hydroxyl-radicals, superoxide, singlet oxygen and peroxynitrite [reviewed in (40)]. In our

studies, however, ascorbic acid failed to prevent Cd2+ cytotoxicity. It acted instead as a pro-

oxidant in the presence of the heavy metal potentiating its decrease in GSH. This free radical

scavenger also increased the levels of cytotoxicity and PGE2 production induced by Cd2+. A

recent report demonstrated that ascorbic acid in the presence of transition metals stimulates the

decomposition of products of lipid peroxidation to fatty acid metabolites such as HNE (41). Cd2+

is a transition metal and a synergism between ascorbic acid and the heavy metal may, therefore,

be responsible for enhancing its cytotoxicity.

We also investigated if COX-2 inhibition would prevent the loss of cell viability induced

by Cd2+. Our studies revealed that Celecoxib, a COX-2 specific inhibitor, increased the survival

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

19

rate of HT4 cells treated with 15, 30 and 45 µM Cd2+ for 7h and 15µM Cd2+ for 24h. This effect

may be due to Celecoxib blocking a cyclooxygenase-mediated toxic pathway that is independent

of eicosanoid biosynthesis. In this pathway lipid hydroperoxides, which are the precursors of

fatty acid metabolites such as HNE, are produced enzymatically by cyclooxygenases (41). COX-

2 was found to be more efficient in producing this enzymatic reaction than COX-1 (41). Our

studies demonstrated that Celecoxib, however, failed to significantly promote cell survival of

HT4 cells treated for 24h with 30 and 45µM Cd2+. The Celecoxib effect on Cd2+ cytotoxicity,

therefore, becomes concentration-dependent after longer treatments with the heavy metal. These

results suggest that COX-2 activation plays an important role in the early phase of the cytotoxic

process initiated by Cd2+. COX-2 inhibition, therefore, could be an important target for

therapeutic intervention in the initial stages of neurodegeneration associated with oxidative

stress. Accordingly, other studies demonstrated that treatment of AD patients with non-steroidal

anti-inflammatory drugs (NSAIDs), which inhibit cyclooxygenases, slows the progression of the

disease proportionally to the duration of the treatment (42).

Our studies indicate that Cd2+ may prevent COX-2 turnover, since treatment with the

heavy metal promotes the accumulation of ubiquitin-COX-2 conjugates. These findings are

consistent with our previous demonstration that ubiquitin-COX-2 conjugates appear in HT4 cells

treated with proteasome inhibitors (22), suggesting that COX-2 may be turned over by the

ubiquitin/proteasome pathway. In addition, Cd2+ most likely perturbs COX-2 glycosylation.

Accordingly, an unglycosylated 65 kDa form of COX-2 was consistently detected in Cd2+ -

treated but not in control cells. The heavy metal also increases the protein levels of the 72 and 74

kDa COX-2 forms, which are N-glycosylated at three and four sites, respectively (27). N-

Glycosylation of cyclooxygensases at three sites is required for them to achieve a native

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

20

conformation and for activity, but the role of N-glycosylation at the fourth site remains unknown

(27).

In summary, these studies demonstrate that disruption of the intracellular sulfhydryl

homeostasis and formation of HNE-protein adducts mediate Cd2+ cytotoxicity. The heavy metal

induces the accumulation of ubiquitinated proteins, cell death (19) and a pro-inflammatory

response manifested by up-regulation of COX-2 (shown in this report). It is possible that

neurodegenerative factors, such as genetic make-up, age or environmental toxins that mimic the

cadmium effects, contribute to the development of initial cellular lesions containing

ubiquitinated proteins. These neuronal inclusions, which are hallmarks of neurodegeneration,

may, themselves, lead to neuronal cell death. The neurodegenerative process, however, could be

exacerbated by stimulation of a pro-inflammatory response that would contribute to a more rapid

decline in neuronal survival. Inhibition of COX-2 activation in the initial phases of the

neurodegenerative process may, therefore, be an important target for preventive therapy.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

21

REFERENCES

1. Chung, K. K., Zhang, Y., Lim, K. L., Tanaka, Y., Huang, H., Gao, J., Ross, C. A., Dawson, V. L., and Dawson, T. M. (2001) Nat.Med. 7, 1144-1150

2. Figueiredo-Pereira ME and Rockwell, P. (2001) The ubiquitin/proteasome pathway in neurological disorders. In Banik, N. L., Lajtha, A., and Smith, M., editors. Proteolysis in the pathophysiology of neurodegenerative disease, Kluwer Academic/Plenum Publishers, New York, N.Y. pp. 137-153.

3. Sisodia, S. S. (1998) Cell 95, 1-4

4. Andersen, J. K. (2000) Mech.Ageing Dev. 118, 15-22

5. Bence, N. F., Sampat, R. M., and Kopito, R. R. (2001) Science 292, 1552-1555

6. van Leeuwen, F. W., de Kleijn, D. P., van den Hurk, H. H., Neubauer, A., Sonnemans, M. A., Sluijs, J. A., Koycu, S., Ramdjielal, R. D. J., Salehi, A., Martens, G. J. M., Grosveld, F. G., Peter, J., Burbach, H., and Hol, E. M. (1998) Science 279, 242-247

7. Lam, Y. A., Pickart, C. M., Alban, A., Landon, M., Jamieson, C., Ramage, R., Mayer, R. J., and Layfield, R. (2000) Proc.Natl.Acad.Sci.U.S.A 97, 9902-9906

8. Keller, J. N., Hanni, K. B., and Markesbery, W. R. (2000) J Neurochem 75, 436-439

9. Saudou, F., Finkbeiner, S., Devys, D., and Greenberg, M. E. (1998) Cell 95, 55-66

10. Markesbery, W. R. and Carney, J. M. (1999) Brain Pathol 9, 133-146

11. Fahn, S. and Cohen, G. (1992) Ann Neurol 32, 804-812

12. Grune, T., Reinheckel, T., and Davies, K. J. (1997) FASEB J 11, 526-534

13. Berlett, B. S. and Stadtman, E. R. (1997) J.Biol.Chem. 272, 20313-20316

14. Chao, C. C., Ma, Y. S., and Stadtman, E. R. (1997) Proc Natl Acad Sci U S A 94, 2969-2974

15. Sadis, S., Atienza, C. J., and Finley, D. (1995) Mol Cell Biol 15, 4086-4094

16. Acan, N. L. and Tezcan, E. F. (1995) Biochem Mol Med 54, 33-37

17. Stohs, S. J. and Bagchi, D. (1995) Free Radic Biol Med 18, 321-336

18. Jungmann, J., Reins, H. A., Schobert, C., and Jentsch, S. (1993) Nature 361, 369-371

19. Figueiredo-Pereira, M. E., Yakushin, S., and Cohen, G. (1998) J Biol Chem 273, 12703-12709

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

22

20. Figueiredo-Pereira, M. E. and Cohen, G. (1999) Mol Biol Rep 26, 65-69

21. Whittemore, S. R., Holets, V. R., Keane, R. W., Levy, D. J., and McKay, R. D. (1991) J Neurosci Res 28, 156-170

22. Rockwell, P., Yuan, H., Magnusson, R., and Figueiredo-Pereira, M. E. (2000) Arch Biochem Biophys 374, 325-333

23. Pereira, M. E., Yu, B., and Wilk, S. (1992) Arch Biochem Biophys 294, 1-8

24. Figueiredo-Pereira, M. E., Efthimiopoulos, S., Tezapsidis, N., Buku, A., Ghiso, J., Mehta, P., and Robakis, N. K. (1999) J Neurochem 72, 1417-1422

25. Mosmann, T. (1983) J Immunol Methods 65, 55-63

26. Mytilineou, C., Han, S. K., and Cohen, G. (1993) J Neurochem 61, 1470-1478

27. Otto, J. C., DeWitt, D. L., and Smith, W. L. (1993) J Biol Chem 268, 18234-18242

28. Oka, A., Itoh, M., and Takashima, S. (1999) Neuropediatrics 30, 34-37

29. Oka, A. and Takashima, S. (1997) Neuroreport 8, 1161-1164

30. Sairanen, T., Ristimaki, A., Karjalainen-Lindsberg, M. L., Paetau, A., Kaste, M., and Lindsberg, P. J. (1998) Ann Neurol 43, 738-747

31. Sen, C. K. (2000) Curr.Top.Cell Regul. 36, 1-30

32. Carmody, R. J. and Cotter, T. G. (2001) Redox.Rep. 6, 77-90

33. Stohs, S. J., Bagchi, D., Hassoun, E., and Bagchi, M. (2001) J.Environ.Pathol.Toxicol.Oncol. 20, 77-88

34. Minekura, H., Kumagai, T., Kawamoto, Y., Nara, F., and Uchida, K. (2001) Biochem.Biophys.Res.Commun. 282, 557-561

35. Kumagai, T., Kawamoto, Y., Nakamura, Y., Hatayama, I., Satoh, K., Osawa, T., and Uchida, K. (2000) Biochem.Biophys.Res.Commun. 273, 437-441

36. Okada, K., Wangpoengtrakul, C., Osawa, T., Toyokuni, S., Tanaka, K., and Uchida, K. (1999) J Biol Chem 274, 23787-23793

37. Friguet, B. and Szweda, L. I. (1997) FEBS Lett 405, 21-25

38. Martinez, M., Martinez, N., Hernandez, A. I., and Ferrandiz, M. L. (1999) Life Sci. 64, 1253-1257

39. Martinez, M., Hernandez, A. I., and Martinez, N. (2000) Brain Res. 855, 100-106

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

23

40. Rice, M. E. (2000) Trends Neurosci 23, 209-216

41. Lee, S. H., Oe, T., and Blair, I. A. (2001) Science 292, 2083-2086

42. Stewart, W. F., Kawas, C., Corrada, M., and Metter, E. J. (1997) Neurology 48, 626-632

FOOTNOTES

Abbreviations: AD, Alzheimer's disease; Cd2+, cadmium; COX-1 and COX-2, cyclooxygenase-

1 and 2, respectively; DMSO, dymethyl sulfoxide; GSH, glutathione; HNE, 4-hydroxy-2-

nonenal; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; NAC, N-acetyl-

L-cysteine; NFT, neurofibrillary tangles; PD, Parkinson's disease; PBS, phosphate buffered

saline; PGs, prostaglandins; ROS, reactive oxygen species.

Acknowledgments: We would like to dedicate this article to the memory of Dr. Gerald Cohen,

from the Department of Neurology, Mount Sinai School of Medicine, New York, NY. We are

grateful to Ms. Natasa Kesler and Ms. Faith Harrow for technical assistance and to Pharmacia

Corporation (Peapack, N.J.) for providing Celecoxib. This work was supported by grants from

the National Institutes of Health (NIH) (NS34018 to M.E.F.-P. and SO660654 a MBRS SCORE

to Hunter College of CUNY) and a core facility grant from the Research Centers in Minority

Institutions-NIH.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

24

FIGURE LEGENDS

Figure 1 - Cadmium increases intracellular COX-2 protein levels – The immunoblots show

COX-2 in HT4 cell lysates (20 µg protein/lane) prepared as described under "Experimental

Procedures". Cells were incubated at 37oC for 10h (A), 16h (B), 24h (C) and 48h (D) with

aqueous solutions of CdSO4 at the concentrations shown above panel A. (E) represents the semi-

quantitative analysis of the immunoblots shown in A-D and indicates the changes in COX-2

levels after 10h (!), 16h ("), 24h (#) and 48h ($) of treatment. The combined quantification

of the 65, 72 and 74kDa COX-2 immunostained forms was by image analysis as described under

"Experimental Procedures". The values (y axis) are displayed as pixels, the units obtained from

the densitometry scans. The blots shown are representative of one of at least three identical

experiments for each condition tested. Molecular mass markers in kDa are shown on the left. Ub-

COX-2, ubiquitinated COX-2.

Figure 2 - Cadmium increases COX-2 gene expression (A) – Semi-quantitative RT-PCR

detection of cox-2 (top panel) and ubA (bottom panel) gene expression as described under

"Experimental Procedures". HT4 cells were incubated at 37oC for 24h with the Cd2+

concentrations shown in the figure. The results presented are representative of at least two

independent experiments. The plot on the bottom of (A) represents the semi-quantification of the

respective bands by densitometry [(!) for cox-2 and ($) for ubA]. (B) and (C) - Immunoblots

of HT4 cell lysates (20 µg protein/lane) showing COX-2 [B (upper panel) and C] and COX-1 [B

(lower panel)] . Cells were incubated at 37oC for 24h without or with the Cd2+ concentrations

listed above the Western blot panels. In (C) cells were treated with 15µg/ml of the

transcriptional inhibitor actinomycin D (Act.) or with 25µg/ml of the translational inhibitor

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

25

puromycin (Pur.) for one hour prior to the addition of Cd2+. The blots shown are representative

of one of at least three identical experiments for each condition tested. Molecular mass markers

in kDa are shown on the left. Ub-COX-2, ubiquitinated COX-2.

Figure 3 - Cadmium enhances production of the proinflammatory prostaglandin PGE2.

The levels of PGE2 produced by HT4 cells were assessed by ELISA as described under

"Experimental Procedures". Untreated HT4 cells produce approximately 0.25ng of PGE2/ml

media. Each curve represents changes in PGE2 levels following incubations with increasing

Cd2+-concentrations for 10h ($), 16h (!), 24h (") and 48h (#). Data represent mean ng of

PGE2 produced per ml of media from two determinations within a representative experiment.

Figure 4 - Cadmium causes the accumulation of ubiquitin-COX-2 conjugates -

Electrophoretic mobilities of COX-2 forms immunoprecipitated with the anti-COX-2 antibody

from HT4 cells incubated at 37oC for 24h with the Cd2+ concentrations listed in the figure.

Immunoblots of the precipitated proteins were probed with anti-COX-2 antibody (B) and then

stripped and reprobed with the anti-ubiquitin protein conjugates antibody (A). Electrophoretic

mobilities of the goat anti-COX IgG heavy (HC) and light (LC) chains are identified in (C) by

open arrows on the right. Molecular mass markers in kDa are also shown on the right. The blots

shown are representative of one of at least two identical experiments for each condition tested.

IgG, goat anti-COX IgG; Ub-COX-2, ubiquitinated COX-2.

Figure 5 - Cadmium perturbs COX-2 glycosylation - Electrophoretic mobilities of native (A)

and unglycosylated (B) COX-2 forms from HT4 cell lysates (20 µg protein/lane) incubated at

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

26

37oC for 24h with the Cd2+ concentrations listed in the figure. Unglycosylated COX-2 was

obtained by treating the cells with tunicamycin (10 µg/ml) 1h prior to the addition of cadmium.

The blots shown are representative of one of at least two identical experiments for each condition

tested. Molecular mass markers in kDa are shown on the left. Tun., tunicamycin.

Figure 6 - Identification of drugs that attenuate cadmium cytotoxicity. HT4 cells were

treated with the drugs listed below for 1h prior to a 7h (A) or 24h (B) incubation with increasing

concentrations of CdSO4. ! - Vehicle; (a) 1mM NAC; (b) 20µM Celecoxib; (c) 1mM Ascorbic

Acid; (d) 15µg/ml actinomycin D and (e) 25µg/ml Puromycin. Cell viability was assessed by the

MTT assay as described under "Experimental Procedures". Data represent the mean and S.E.

from at least three determinations and are shown as percentage of cell viability measured for

each drug treatment without Cd2+ (control, 100%). The (*) identifies the values that are

significantly different (at least p<0.05) from the respective treatments with cadmium only ( ! ).

Figure 7 - Cadmium causes the formation of HNE-protein adducts - Immunoblot showing

HNE-protein adducts in HT4 cell lysates (20 µg protein/lane) prepared as described under

"Experimental Procedures". Cells were incubated at 37oC for 24h with aqueous solution of

CdSO4 at the concentrations listed on the figure. Where indicated (6 lanes on the right), cells

were treated with 1mM N-acetyl-cysteine (NAC) for one hour prior to the addition of cadmium.

The immunoblot shown is representative of one of two identical experiments for each condition

tested. Molecular mass markers in kDa are shown on the right. HNE, 4-hydroxy-2-nonenal.

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

27

Figure 8 - NAC and ascorbic acid effects on HT4 cells treated with cadmium- The effect of

NAC or ascorbic acid (Asc.) was assessed on the levels of COX-2 (A), glutathione (B) and PGE2

(C and D) in HT4 cells treated with increasing concentrations of Cd2+. Cells were incubated with

1mM NAC or 1mM Asc. 1h prior to a 24h treatment with Cd2+ when assayed for COX-2 (A) and

GSH levels (B) or 7h treatment with Cd2+ for PGE2 levels (C and D). After the indicated

treatments, the cells were harvested and prepared for COX-2 immunoblotting (A) or

measurements of glutathione (B). PGE2 levels in the media (C and D) were carried out as

indicated under "Experimental Procedures". The plot on the bottom of (A) represents the semi-

quantification, by densitometry, of the changes in COX-2 levels in HT4 cells treated with Cd2+

only (!), or Cd2+ in combination with NAC (") or Asc. ($). The values (y axis) are displayed

as fold-increases in COX-2 levels compared to no cadmium treatment, which was given an

arbitrary value of one. The blots shown are representative of one of at least two identical

experiments for each condition tested. (B), (C) and (D) represent the mean and S.E. of at least

three determinations. " - cadmium only; ! - NAC and Cd2+; ▤- ascorbic acid and Cd2+. The

(*) in B identifies the values that are significantly different (at least p<0.05) from the respective

controls treated without cadmium ( " ).

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

28

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

29

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

30

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

31

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

32

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

33

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

34

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

35

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from

Maria E. Figueiredo-Pereira, Zongmin Li, Marlon Jansen and Patricia Rockwellcyclooxygenase-2 up-regulation

N-acetyl-cysteine and celecoxib lessen cadmium cytotoxicity which is associated with

published online May 7, 2002J. Biol. Chem. 

  10.1074/jbc.M109145200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on Decem

ber 8, 2020http://w

ww

.jbc.org/D

ownloaded from