N-120: Spatial Characterization of the Prokaryotic Community
Structure in the Passalid Beetle Gut using a High-Density 16S rRNA
PhyloChip using a High-Density 16S rRNA PhyloChip G. L. Andersen E.
L. Brodie 1,2, N. Nguyen 3, T. Z. DeSantis 1,2, S. Gross 4, S.-O.
Suh 4, J. B. Nardi 5, T. D. Bruns 3, M. M. Blackwell 4, G. L.
Andersen 1,2 1 Lawrence Berkeley National Lab, Berkeley, CA, 2
Virtual Institute of Microbial Stress and Survival, Berkeley, CA, 3
University of California, Berkeley, CA, 4 Louisiana State
University, Baton Rouge, LA, 5 University of Illinois, Urbana, IL.
INTRODUCTION RESULTS CONCLUSIONS ACKNOWLEDGMENTS Understanding the
microbial processes by which wood ingesting insects derive energy
may aid large- scale conversion of lignocellulosic biomass into
biofuel. We examined the prokaryotic biome of the wood-injesting
passalid beetle, Odontotaenius disjunctus with a 500,000-probe
PhyloChip targeting multiple unique regions of the 16S rRNA gene.
The passalid beetle has developed a symbiotic relationship with
microbes to survive on a low-nitrogen diet that requires microbial
community-derived enzymes to digest the complex polysaccharides and
lignins of plant cell walls. The adult gut of this approximately 3
cm beetle is over 10 cm in length and consists of four
morphologically distinct sections: Foregut (FG), midgut (MG),
anterior hindgut (AHG), posterior hindgut (PHG). The fungal
composition of these gut regions has been extensively studied (e.g.
1-3), and microcopy has demonstrated a morphologically-diverse
bacterial population in the hindgut (4). Relatively little,
however, is known about the prokaryotic diversity, which likely
contributes key enzymes for lignocellulose processing in addition
to fixing atmospheric nitrogen for host nutrition. To perform an
in-depth census of the prokaryotic composition of each gut region
we used a high-density (500,000 probe) 16S rRNA microarray
(PhyloChip) to screen for the presence and relative abundance of
most known prokaryotes in a massively-parallel assay. FG MG AHG PHG
Living passalid adults were fed fresh hardwood chips for over one
month before aseptic dissection of the gut and separation into the
four sections. This was carried out for four individuals. Sections
were preserved in RNAlater followed by overnight storage at 4C. DNA
and RNA were co-extracted using the All-Prep DNA/RNA purification
kit (Qiagen, CA). The 16S rRNA gene was amplified from gDNA
extracts using modified (degeneracies removed) universal primers
27F (5 AGAGTTTGATCCTGGCTCAG) and 1492R (5 GGTTACCTTGTTACGACTT) for
Bacteria and 4Fa (5 TCCGGTTGATCCTGCCRG 3) combined with 1492R for
Archaea. 500 ng of bacterial and 100 ng of archaeal 16S rRNA gene
amplicons were fragmented, labeled and hybridized to a custom
Affymetrix GeneChip (PhyloChip) as described previously (5).
METHODS Figure 1. Odontotaenius disjunctus. Figure 2. Spatial
arrangement of passalid beetle gut, showing morphologically
distinct sections. Figure 4. Numbers of bacterial (left bars) and
archaeal (right bars) taxa detected in distinct gut sections across
4 passalid beetle individuals. Bacterial richness declines through
the passalid gut Archaea were detected only in anterior hindgut
(AHG) RESULTS AHG MG PHG FG Foregut and anterior hindgut have
distinct microbial populations Midgut and posterior hindgut have
less distinct populations Methanogens (hydrogenotrophic and
acetoclastic) are located in the AHG Presence of ANME-1 archaea
suggests anaerobic methane oxidation may be occurring in AHG also
Cellulose-degrading actinomycetes are present in all gut regions
Fermentative Clostridia and Bacteroidetes are present in all
regions but are enriched in the AHG. Some strains are known
homoacetogens. Nutrient cycling implications of PhyloChip community
data Carbon Nitrogen Nitrogen fixation may be mediated by different
organisms depending on gut region (Rhizobiales in FG, Spirochetes
in AHG) Both aerobic (Nitrosomonas) and anaerobic (Annamox
planctomycetes) ammonia oxidation may be occurring in the same gut
regions PhyloChip intensity (arbitrary units) 1. Nguyen, N. H.,
S.-O. Suh, C. J. Marshall, and M. Blackwell. Morphological and
ecological similarities: wood-boring beetles associated with novel
xylose-fermenting yeasts, Spathaspora passalidarum gen. nov., sp.
nov. and Candida jeffriesii sp. nov. Mycological Research.
110:1232-1241. 2. Blackwell, M., S.-O. Suh, and J. B Nardi. 2007.
Fungi in the Hidden Environment: The gut of beetles. In: British
Mycological Symposia: Fungi in the Environment. Eds. G. M. Gadd, S.
C. Watkinson & P. S. Dyer. Cambridge University Press, UK, p.
357- 370. 3. Suh, S.-O., J. V. McHugh, D. Pollock, and M.
Blackwell. 2005. The beetle gut: a hyperdiverse source of novel
yeasts. Mycological Research 109:261-265. 4. Nardi, J. B., C. M.
Bee, L. A. Miller, N. H. Nguyen, S.-O. Suh, and M. Blackwell. 2006.
Communities of microbes that inhabit the changing hind gut
landscape of a subsocial beetle. Arthropod Structure and
Development 35:57-68. 5. Brodie, E.L., DeSantis, T.Z., Joyner,
D.C., Baek, S., Larsen, J.T., Andersen, G.L., Hazen, T.C., Herman,
D.J., Tokunaga, T.K., Wan, J.M. and Firestone, M.K. 2006.
Application of a high-density oligonucleotide microarray approach
to study bacterial population dynamics during uranium reduction and
reoxidation. Appl. Environ. Microbiol. 72:6288-6298. This study
represents the first comprehensive view of the passalid beetle gut
prokaryotic population. It has revealed a diverse community that is
compartmentalized in terms of composition and likely function. The
co-occurrence of anaerobic and aerobic processes within gut regions
suggests existence of oxygen and/or hydrogen gradients along which
microbial species partition themselves. BIBLIOGRAPHY This work was
partially supported by the National Science Foundation,
Biodiversity Surveys and Inventories Program (DEB-0072741 and
DEB-0417180) and REU supplements (to MB) and use of the LSU DNA
sequencing facility was supported by a NSF Multi-user Equipment
Grant (DBI-0400797). Part of this work was performed under the
auspices of the US Department of Energy by the University of
California, Lawrence Berkeley National Laboratory under Contract
No. DE-AC02-05CH11231. Figure 3. Schematic of PhyloChip process
Figure 5. Hierarchical cluster analysis of similarity of
prokaryotic species detected in passalid gut regions. Inset shows a
second dendrogram and heatplot based on array intensity (relative
abundance of taxa). Figure 6. Relative intensity (abundance) of
select organisms related to carbon flow through passalid gut.
Figure 7. Relative intensity (abundance) of select organisms
related to nitrogen flow through passalid gut. Email:
[email protected]
