Mutation of Hof1 PEST motif phosphorylation sites leads to retention of Hof1 at the bud neck and a decrease in the rate of myosin contraction

Cell Biology International ISSN 1065-6995doi: 10.1002/cbin.10042

RESEARCH ARTICLE

Mutation of Hof1 PESTmotif phosphorylation sites leads to retentionof Hof1 at the bud neck and a decrease in the rate of myosincontractionKatherine E. Stockstill*, Jungeun Park, Rachel Wille, Grace Bay, Avery Joseph and Katie B. Shannon

Department of Biological Sciences, Missouri University of Science and Technology, 105 Schrenk Hall, 400 W. 11th St., Rolla, Missouri 65401, USA

Abstract

Regulation of actomyosin ring contraction is important for the coordination of cytokinesis with mitosis. Hof1, a member of thePombe Cdc15 homology (PCH) family of proteins, is required for efficient cytokinesis in budding yeast. Phosphorylation ofHof1 depends on the mitotic exit network (MEN), and its degradation at the end of mitosis depends on its PEST motif andinteraction with the E3 ligase Grr1. To test the hypothesis that targeted destruction of Hof1 temporally couples mitotic exit withcontraction of the actomyosin ring, we mutated the Hof1 PESTmotif to prevent phosphorylation and subsequent degradation.These mutations increased the amount of Hof1 at the bud neck during cytokinesis, resulted in smaller bud neck diameter, andslowed the rate of myosin contraction. However, Hof1 PEST motif phosphorylation site mutants did not have cytokinesisdefects, indicating that regulation of Hof1 levels does not control the onset of actomyosin ring contraction as predicted.

Keywords: budding yeast; contractile actin ring; cytokinesis; myosin; septation

Introduction

Cytokinesis is the division of one cell into two daughtercells, accomplished by contraction of an actomyosin ring.Cytokinesis must occur at the correct time and location toensure accurate chromosome segregation. Cytokinesis failureresults in tetraploidy, which may be an early event in tumori-genesis (Fujiwara et al., 2005; Olaharski et al., 2006; Ganemet al., 2007; Storchova and Kuffer, 2008).

Budding yeast Saccharomyces cerevisiae is a useful modelsystem for the study of cytokinesis. The actomyosin ring,which contains filamentous actin (F-actin) and type IImyosin, is conserved from yeasts to humans (Field et al.,1999; Balasubramanian et al., 2004). Unlike animal cells,yeast cells must coordinate cytokinesis with septation,the process of constructing a new cell wall between thedaughter cells. Budding yeast that lack Myo1, the sole type IImyosin, are viable in some strain backgrounds, accomplish-ing division by construction of an aberrant septum (Biet al., 1998; Tolliday et al., 2003). Therefore, budding yeast areable to divide by both myosin-dependent and independentpathways.

Hof1 is a budding yeast protein that is localised to the budneck and required for efficient cell division (Kamei et al.,1998; Lippincott and Li, 1998a; Vallen et al., 2000). Hof1 is amember of the Pombe Cdc15 homology (PCH) family ofproteins that are found in many eukaryotic organisms. PCHproteins are involved in actin-based processes, includingcytokinesis. PCH proteins share a similar structure; theytypically contain an amino terminal FER-CIP4 homology(FCH) domain, a coiled-coil region, a Src homology domain3 (SH3) at the carboxyl terminus, and a PEST motif inbetween the coiled-coil and the SH3 region (Figure 1A)(Lippincott and Li, 2000). PEST motifs, which are proline,glutamic acid, serine and threonine rich, are typically foundin proteins with a short half-life, and are thought to act assignal sequences for degradation.

Hof1 has been implicated in both cytokinesis andseptation. Deletion of HOF1 leads to a temperature sensitivegrowth defect and abnormal myosin ring contraction(Lippincott and Li, 1998a). Hof1 physically interacts withproteins that are involved in regulating actin assemblydynamics, such as verprolin and the formin Bnr1, but howthese interactions affect actomyosin ring function are

*Corresponding author: e-mail: [email protected]: PCH, pombe Cdc15 homology; CDK, cyclin dependant kinase; MEN, mitotic exit network

314 Cell Biol Int 37 (2013) 314–325 � 2013 International Federation for Cell Biology

unknown (Kamei et al., 1998; Ren et al., 2005). Genetically,HOF1 is synthetically lethal with genes involved in themyosin-dependent cytokinesis pathway, such as BNI1 and MYO1,leading to the model that HOF1 is required for the myosin-independent pathway (Vallen et al., 2000). Supporting thismodel, Hof1 binds to Cyk3 and Inn1, proteins that areimportant for primary septum formation (Jendretzkiet al., 2009; Nishihama et al., 2009; Meitinger et al., 2010).

Whether Hof1 functions in cytokinesis, septation, or bothprocesses is difficult to determine since failure of cytokinesisleads to abnormal septa, and vice versa (Bi, 2001).

Evidence suggests that Hof1 negatively regulates cyto-kinesis. Overexpression of Hof1 causes lethality, a chainphenotype typical of cytokinesis defects, and abnormal septinlocalisation (Lippincott and Li, 1998a). Deletion of HOF1 wasshown to increase the bud neck diameter and rate of Myo1contraction (Lippincott and Li, 1998a). Deletion of the Hof1PESTmotif, which increases Hof1 stability in lateM/early G1,delayed the onset and lengthened the duration of Myo1-GFPcontraction and disassembly of the Myo1 ring (Blondelet al., 2005). Therefore, excess Hof1 impedes cytokinesis,while lack of Hof1 stimulates myosin contraction.

Although the exact function of Hof1 in cell division isunknown, its phosphorylation, protein levels and dynamicsare regulated during mitosis and cytokinesis. Hof1 local-isation patterns change during the cell cycle. The initialrecruitment of Hof1 to the bud neck has been reported tooccur either in G1 prior to bud emergence or in mitotic cellswith partially elongated spindles (Lippincott and Li, 1998a;Vallen et al., 2000). In early mitosis, Hof1 localises to a doublering that is coincident with the septins (Lippincott andLi, 1998a; Vallen et al., 2000). Hof1 transitions to a single ringcolocalising with actin immediately before actomyosin ringcontraction, and the Hof1 single ring undergoes a partialcontraction (Lippincott and Li, 1998a; Vallen et al., 2000).Unlike the Myo1 ring, the Hof1 ring does not contract to asingle dot and disappear. As the septum is formed, the Hof1single ring splits again, with some remaining in the daughtercell and some in the mother cell (Lippincott and Li, 1998a;Vallen et al., 2000). Phosphorylation of Hof1 occurs duringmitosis, and this modification depends on the function of themitotic exit network (MEN) (Vallen et al., 2000). The authorshypothesised that the phosphorylation of Hof1 regulates thetransition from double to single ring (Vallen et al., 2000).Hof1 is degraded at the M/G1 transition, which requires theinteraction of the Hof1 PEST motif with SCFGrr1 (Blondelet al., 2005). Grr1 is an F-box protein component of theSCF-type E3 ligase, and localisation of Grr1 to the bud necklate in mitosis depends on the MEN (Blondel et al., 2005)These findings led to a model that phosphorylation of Hof1regulates its binding to Grr1, and that its subsequentdegradation triggers completion of cytokinesis (Blondelet al., 2005). In a genome-wide analysis of S. cerevisiaephosphopeptides, phosphorylation was observed at the firstserine of the Hof1 PESTmotif and ambiguous phosphoryla-tion was reported for the second serine (Bodenmilleret al., 2008).

Therefore, previous data support the model that MENdependent phosphorylation leads to the Hof1 transition fromdouble to single ring and/or degradation, which then triggersactomyosin ring contraction. To test this hypothesis, we

Figure 1 Hof1 PEST motif mutant alleles complement hof1Dtemperature sensitivity and cell division defects. (A) Diagram of

Hof1 protein domains, showing amino acid sequence of wild type PEST

motif and 5A and 10A mutants. Hof1 domains are FCH (FER-CIP4

Homology domain), C-C (coiled-coil region), PEST (proline-glutamic acid-

serine-threonine rich region) and SH3 (Src homology domain 3)

(Lippincott and Li, 2000). Hof1 PEST motif is amino acids 418–438

(Blondel et al., 2005). (B) PEST motif mutant genes compliment hof1D

temperature-sensitive growth in the S288C background. Serial dilutions

of hof1D (KSY 35), Hof1-GFP wild type (KSY 158), Hof1(5A)-GFP (KSY

172) or Hof1(10A)-GFP (KSY 168) strains were grown on YPD for 2 days at

room temperature (258C, left panel) or 378C (right panel). (C) Cell

morphology of hof1D, Hof1-GFP wild type, Hof1(10A)-GFP and Hof1

(5A)-GFP cells. Cells (KSY 35, KSY 158, KSY 168 and KSY 172,

respectively) were grown at 378C for 5–6 h before fixation. For each

experiment, 200 cells were counted with and without prior zymolyase

treatment, and scored as a chain if consisting of three or more attached

cell bodies. The experiment was repeated four times and averages are

shown with error bars showing standard deviation.

K. E. Stockstill et al. Analysis of Hof1 PEST phosphorylation sites

Cell Biol Int 37 (2013) 314–325 � 2013 International Federation for Cell Biology 315

created two non-phosphorylatablemutants of the Hof1 PESTmotif, Hof1(5A) and Hof1(10A) (Figure 1A). Both mutantsrescued the defects of the HOF1 deletion strain. We used time-lapsemicroscopy to look at dynamics of the GFP-tagged Hof1PEST motif mutants, and we also analysed Myo1-GFP todetermine if preventing Hof1 PEST phosphorylation affectscontraction. Our results show that phosphorylation of theHof1 PEST motif is required for the interaction with Grr1and to remove Hof1 from the bud neck after cytokinesis.Although lack of PESTmotif phosphorylation decreases thesize of the bud neck and slows the rate of Myo1 contraction,neither the removal nor the degradation of Hof1 is requiredfor completion of cytokinesis.

Materials and methods

Strains, growth conditions and genetic methods

Standard media and genetic techniques were used (Shermanet al., 1981). Yeast cells were grown in YPD (1% yeastextract, 2% Bacto peptone, 2% glucose), YPR (1% yeastextract, 2% Bacto peptone, 2% raffinose), or YPGR (1% yeastextract, 2% Bacto peptone, 2% galactose, 2% raffinose) solidand/or liquid medium, or on HIS, LEU, TRP, or URAdrop-out solid and/or liquid medium at 308C unlessotherwise noted.

Site-directed mutagenesis

To make the Hof1 PESTmutants, pLP1 or pLP2 was mutatedusing the Stratagene QuikChange II XL Site-DirectedMutagenesis Kit as per the manufacturer's instructionswith a few modifications. We used 100 ng template and200 ng of each primer. The Pfu was added after a 5 min hotstart to the following PCR program: 958C for 6 min, 1 cycle,988C for 1 min, 558C for 1 min, 658C for 20 min, 18 cycles,728C for 7 min, 1 cycle.

To make the 5A allele primers HOF1-P1 F&R were used tocreate mutant plasmids pRW1 or pJP1. To make the 10Amutant, first pRW1 or pJP1 was further mutated with theHOF1-P2 F&R primers to make pKES1 or pJP2. Then pKES1or pJP2 was mutated with the P3 F&R primers to makepKES2 and pJP3. Sequencing was done by the Missouri S&TcDNA Resource Center to confirm that the mutagenesisworked properly using primers HOF1 Seq2 and HOF1 Seq4.Primer sequences are shown in Table 1, and plasmids arelisted in Table 2.

Yeast transformation

Yeast transformations were performed by a modified lithiumacetate method (Gietz et al., 1992). After 30 min of incu-bation at 308C, 50 mL of DMSO was added and mixed. Cells

Table 1 Primers

Name Sequence

HOF1-P1-F GGTGCATAAAAGAAATCAAGCTCTCGCCGCACCAGCAGAATCAAG

HOF1-P1-R CTTGATTCTGCTGGTGCGGCGAGAGCTTGATTTCTTTTATGCACC

HOF1-P2-F CACCAGCAGAAGCAGCTGCTGCTAATCCAACGGATTTTAGCC

HOF1-P2-R GGCTAAAATCCGTTGGATTAGCAGCAGCTGCTTCTGCTGGTG

HOF1-P3-F GCTAATCCAGCGGATTTTGCCCACATCAAAAAGAGAC

HOF1-P3-R GTCTCTTTTTGATGTGGGCAAAATCCGCTGGATTAGC

HOF1SEQ2 GATACACGAAGTGGGCGCAATTATCC

HOF1SEQ4 CATTHCCATCTCCAGAAGTC

Table 2 Plasmids

Name Description Source

pLP1 HOF1-myc LEU2 CEN Lippincott and Li (1998a)

pLP2 HOF1-GFP LEU2 CEN Lippincott and Li (1998a)

pKT36 MYO1-GFP TRP1 Lippincott et al. (2001)

pJP1 hof1(5A)-GFP LEU2 CEN pLP2 mutagenised using primers HOF1-P1-F and -R

pJP2 hof1(P2)-GFP LEU2 CEN pJP1 mutagenised using primers HOF1-P2-F and -R

pJP3 hof1(10A)-GFP LEU2 CEN pJP2 mutagenised using primers HOF1-P3-F and -R

pRW1 hof1(5A)-myc LEU2 CEN pLP1 mutagenised using primers HOF1-P1-F and -R

pKES1 hof1(P2)-myc LEU2 CEN pRW1 mutagenised using primers HOF1-P2-F and -R

pKES2 hof1(10A)-myc LEU2 CEN pKES1 mutagenised using primers HOF1-P3-F and -R

pBM200 GAL1-GRR1-GFP URA3 CEN Blondel et al. (2005)

pGB1 Hof1(10A)-myc URA Hof1(10A)-GFP cut from pJP3 with SalI/XbaI and ligated into pRS406

Analysis of Hof1 PEST phosphorylation sites K. E. Stockstill et al.


were plated on appropriate media and incubated at 308C for2–3 days.

Strain construction

Yeast strains are listed in Table 3. KSY 158, KSY 168, KSY 172,KSY 240, KSY 241 and KSY 328weremade by transformationof KSY 35/RLY 292 with pLP2, pJP3, pJP1, pLP1, pRW1 andpKES2, respectively (Lippincott and Li, 1998a).

KSY 242, KSY 297 and KSY 331 were made by trans-forming KSY 166/RLY 416 with pRW1, pLP1 and pKES2,respectively, followed by sporulation and tetrad analysis.KSY267 was made by sporulation and tetrad analysis of KSY190/YEF 1986 (Vallen et al., 2000).

KSY 258 was created by transformation of KSY 35/RLY 292with pLP1 and pBM200 (Lippincott and Li, 1998a; Blondelet al., 2005). KSY 259 and KSY 330 were made by trans-formation of KSY 241 and KSY 328 with pBM200 (Blondelet al., 2005).

To create Myo1-GFP expressing strains, pKT36 (MYO1under its endogenous promoter tagged with GFP on a TRP1plasmid) (Lippincott et al., 2001) was digested with AgeIenzyme and transformed into KSY 242, KSY 297, KSY 331,KSY 188 and KSY 431 strains tomakeKSY 268, KSY 319, KSY335, KSY 449 and KSY 451, respectively.

To integrate the hof1(10A) allele into the chromosome at theHOF1 locus, two-step gene replacement was used (Scherer andDavis, 1979). Plasmid pGB1 was linearised with AflII, thentransformed into KSY188/YEF2016 (Vallen et al., 2000).URAþ transformants were plated on 5-FOA, and resultingURA� strains were tested for hof1(10A) by sequencing. Theresulting strain is KSY 431.

Analysis of cell morphology

Cells were cultured overnight in 5 mL YPD at roomtemperature (22–258C). The cells were then centrifugedand resuspended in 5 mL of YPD prewarmed to 378C and

Table 3 Yeast strains used in this study

Strain Genotype Background Source

KSY 35/RLY292 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 S288c Lippincott and

Li (1998a)

KSY 158 MATa ura3-52 his3-D200 leu2-3,112 lys2-801Dhof1::HIS3 pHOF1-GFP, LEU2 (pLP2) S288c This work

KSY 166/RLY416 MATa/a his3-11,15/his3-11,15 leu2-3,112/leu2-3,112 ura3-1/ura3-1 trp1-1/trp1-1 ade2-1/ade2-1 can1-100/can1-100 HOF1/Dhof1::HIS3

W303 Lippincott and

Li (1998a)

KSY 168 MATa ura3-52 his3-D200 leu2-3,112 lys2-801Dhof1::HIS3 phof1(10A)-GFP, LEU2 (pJP3) S288c This work

KSY 172 MATa ura3-52 his3-D200 leu2-3,112 lys2-801Dhof1::HIS3 phof1(5A)-GFP, LEU2 (pJP1) S288c This work

KSY188/YEF2016 MATa his3 leu2 lys2 trp1 ura3 HOF1:HA::HIS3 Vallen et al. (2000)

KSY190/YEF1986 MATa/a his3/his3 leu2/leu2 lys2/lys2 trp1/trp1 ura3/ura3 HOF1:GFP::Kan/HOF1:GFP::Kan Vallen et al. (2000)

KSY 240 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 pHOF1-myc, LEU2 (pLP1) S288c This work

KSY 241 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(5A)-myc, LEU2 (pRW1) S288c This work

KSY 242 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(5A)-myc, LEU2 (pRW1) W303 This work

KSY 258 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 pHOF1-myc, LEU2 (pLP1)GAL1-GRR1-GFP, URA 3 (pBM200)

S288c This work

KSY 259 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(5A)-myc, LEU2 (pRW1)

GAL1-GRR1-GFP, URA 3 (pBM200)

S288c This work

KSY 267 MATa his3 leu2 lys2 trp1 ura3 HOF1:GFP::Kan This work

KSY 268 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(5A)-myc, LEU2 (pRW1)MYO1-GFP::TRP1 (pKT36)

W303 This work

KSY 297 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 pHOF1-myc, LEU2 (pLP1) W303 This work

KSY 319 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 pHOF1-myc, LEU2 (pLP1)MYO1-GFP::TRP1 (pKT36)

W303 This work

KSY 328 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(10A)-myc, LEU2(pKES2)

S288c This work

KSY 330 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(10A)-myc, LEU2

(pKES2) pGAL1-GRR1-GFP, URA3 (pBM200)

S288c This work

KSY 331 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(10A)-myc, LEU2(pKES2)

W303 This work

KSY 335 MATa ura3-52 his3-D200 leu2-3,112 lys2-801 Dhof1::HIS3 phof1(10A)-myc, LEU2(pKES2) MYO1-GFP::TRP1 (pKT36)

W303 This work

KSY 431 MATa his3 leu2 lys2 trp1 ura3 hof1(10A)-HA::HIS3 This work

KSY 449 MATa his3 leu2 lys2 trp1 ura3 HOF1:HA::HIS3 MYO1-GFP::TRP1 (pKT36) This work

KSY 451 MATa his3 leu2 lys2 trp1 ura3 hof1(10A)-HA::HIS3 MYO1-GFP::TRP1 (pKT36) This work



were allowed to continuing growing at 378C for 5–6 h. Cellswere fixed using 5% formaldehyde, and zymolyase treatmentwas performed as described (Lippincott and Li, 1998b). Foreach strain and treatment, 200 cells were counted and scoredas chains if they contained three or more connected cellbodies. Morphology was observed and cells were countedusing an Olympus CH2 with objective EA40 NA0.65.

Time course analysis of Hof1 expression

Cells were synchronised with alpha factor and 5 mL removedprior to release from arrest (T ¼ 0) and every 12 minfollowing release (Vallen et al., 2000). G1 arrest, release fromarrest, and approximate time of mitosis were checked bymonitoring shmoo formation, bud emergence, and bud sizemicroscopically. Total protein preps were prepared in Ubuffer (50 mM Hepes pH 7.5, 100 mM KCl, 3 mM MgCl2and 1 mMEGTA) with protease inhibitors by glass bead lysis.

Yeast protein extracts

A 50 mL YPGR culture was grown overnight. The cells werecentrifuged and washed with 10 mL cold NP-40 buffer. Thepellet was resuspended with about twice the volume of icecold buffer containing protease inhibitors (0.5 mg/mLpepstatin, leupeptin, chymostatin, antipain, and aprotinin),1 mM DTT, and 1 mM PMSF. Five hundred microlitres ofglass beads were added to the cells and chilled on ice for10 min. The cells were vortexed with the beads (30 s on thevortexer and 1 min on ice, repeated ten times). The lysed cellswere centrifuged at 48C at 14 K RPM for 30 min. The extractwas removed from the beads and flash frozen in 100 mlaliquots using liquid nitrogen.

Co-immunoprecipitation

Two microlitres of antibody, either mouse monoclonal anti-myc 9E10 (Covance) or mouse monoclonal anti-GFP (B-2)(Santa Cruz Biotechnology), was added to 100 mL yeastextract. The extract was then incubated at 48C for 1 h on arotator. Twenty-five microlitres of protein A/G Plus agarose(Santa Cruz Biotechnology) pre-equilibrated in extract bufferwas added to the extract and incubated an additional hour at48C on a rotator. The extracts were then centrifuged at 48C,and then the supernatant was removed from the beads. Thebeads were washed three times in 100 ml ice cold NP-40buffer. Forty microlitres of 1� Laemmli sample buffer wasadded to the beads and samples were boiled for 5 min.

Western blotting

Protein samples were separated on 7.5% SDS–PAGE gels.Primary antibodies, either mouse monoclonal anti-HA

16B12 (Covance), mouse monoclonal anti-myc 9E10(Covance), or mouse monoclonal anti-GFP (B-2) (SantaCruz Biotechnology), were used at 1:1,000. Donkey anti-mouse secondary antibody conjugated to HRP (JacksonImmunoResearch Laboratories, Inc.) was used at 1:5,000.The blot was then developed by using the Pierce chemilumi-nescence detection kit (Thermo Scientific). A digital image ofthe blot was taken using Kodak Image Station andCarestreamMolecular Imaging Software.

Live cell imaging

Cells were grown overnight and placed on agarose pads madeby melting 0.2 g of agarose in 1 mL TRP media (Waddleet al., 1996). The cells were then viewed using the OlympusInverted Epifluorescence Microscope with a 100X Plan ApoNA 1.4 DIC Objective. FITC filter (EX 482/35 506DM EM536/40) was used (Brightline). Images were captured with aHamamatsu ORCA285 CCD camera. Shutters, filters andcamera were controlled using SlideBook software (IntelligentImaging Innovations, Denver, CO).

Fluorescence intensity measurements

Data analysis was performed using the Slidebook software(Intelligent Imaging Innovations) based on the methoddescribed (Tully et al., 2009). A region was drawn around thebud neck fluorescence, and then this region was duplicated.The duplicated region was set in an area outside the cells asthe background. The software was used to measure theaverage fluorescence intensity for each region and subtractthe background, throughout the time-lapse series. The timeframe which showed the first indication of contraction,defined as a decrease in the diameter of the Hof1 ring, waschosen as T ¼ 0, the beginning of cytokinesis. The intensityvalues were normalised by dividing the intensity value foreach time point by that at T ¼ 0. For each time point,normalised intensity values were averaged, and standarderror calculated. Calculations and graphs were producedusing Microsoft Excel.

Analysis of myosin contraction

To determine the onset of myosin contraction, the time-lapseseries of Myo1-GFP expressing cells were analysed. Time zerowas defined as the timepoint before cytokinesis, determinedas the time point after which the ring decreased in diameter.The ruler tool in Slidebook was used to measure the ring atT ¼ 0 and the following frame to confirm that a change indiameter had occurred. A second blind analysis to determinetime zero was performed in order to eliminate observer bias.Total time of contraction was the time elapsed between timezero and when the Myo1-GFP signal was no longer visible at



the bud neck. To determine the rate of contraction, the widthof the bud neck was measured using the ruler tool inSlidebook and divided by the total time of contraction.Fluorescence intensity profiles were used to examine sym-metry of ring contraction. Excel was used to calculatestandard deviation and P values using the two-tailed t-test.

Results

Mutations that prevent Hof1 PEST motifphosphorylation rescue hof1D defects

Previous research demonstrated that a hof1PESTD strain isnot able to undergo efficient cytokinesis, and led to thehypothesis that the interaction of this domain with Grr1 wasregulated by phosphorylation (Blondel et al., 2005). In orderto determine the function of PEST motif phosphorylation,the Hof1 PEST motif was mutated using site-directedmutagenesis. Two mutant alleles were made, Hof1(5A) andHof1(10A), in which the first five serines were mutated toalanine or all nine serines and one thereoine in the PESTmotif were mutated to alanine, respectively (Figure 1A).

hof1D strains are temperature sensitive and fail to grow at378C (Lippincott and Li, 1998a). To determine if hof1(5A)and/or hof1(10A) could complement the temperature sensi-tivity of hof1D, plasmids encoding HOF1 wild type, 5A, and10Awere introduced into the hof1D strain and cell growth atroom temperature and 378C were compared by plating 10-fold serial dilutions of cells. The 5A and 10A cells grew as wellas the wild type at 258C and completely complemented thegrowth defect of hof1D at 378C (Figure 1B).

hof1D cells have been shown to have a cytokinesis defectat 378C (Lippincott and Li, 1998a; Vallen et al., 2000).To determine if preventing phosphorylation of the PESTmotif has an effect on cytokinesis or septation, cellmorphology analysis was performed on hof1D cells aloneor with a plasmid containing HOF1 wild type, (5A), or (10A).Cells were grown at 258C, then shifted to 378C for 5–6 hand fixed. Cells were counted with and without priorzymolyase treatment. The zymolyase treatment is performedto remove the cell wall, in order to distinguish between acytokinesis defect and a septation defect. In agreement withprevious data, at 378C nearly 50% of the hof1D cells had achain phenotype (Figure 1C) (Vallen et al., 2000). Chains aredefined as three or more connected cell bodies, indicative of afailure of the bud to separate from themother cell followed byadditional budding of the mother and/or daughter cell.Unlike previous studies, after zymolyase treatment the chainphenotype was decreased by about half for hof1D. Thisfinding suggests that hof1D cells may have a mix of bothcytokinesis and septation defects. For hof1(5A) and hof1(10A)cells, the analysis showed that both with and withoutzymolyase treatment the PEST phosphorylation mutants did

not differ significantly fromwild type (Figure 1C). There wasa significant difference (P � 0.05) between the hof1D andwild type, hof1(5A), and hof1(10A) strains both with andwithout zymolyase. The relatively high background ofchained cells in the wild type strain is likely due to themyc epitope-tagged, plasmid-borne wild type HOF1 genehaving slightly reduced function compared to the unalteredchromosomal HOF1 gene (see Figure 5).

Phosphorylation of the Hof1 PEST motif is required forthe interaction with Grr1

Previously, Hof1 was shown to interact with Grr1 at the budneck by bimolecular fluorescence complementation (BiFC),and the authors hypothesised that phosphorylation of Hof1regulates its binding to Grr1 (Blondel et al., 2005). We testedthis using co-immunoprecipitation. Wild type Hof1-mycinteracted with Grr1-GFP, as Hof1 was found in anti-GFPimmunoprecipitations, and Grr1 was present in anti mycimmunoprecipitates (Figures 2A and 2B). The hof1(10A)mutant protein did not interact with Grr1, as hof1(10A)-mycand Grr1-GFP did not co-immunoprecipitate (Figures 2Cand 2D). This result suggests that the interaction of Hof1 andGrr1 requires phosphorylation of the PEST motif.

During the course of our experiments, we noticed that cellscontaining the GAL1-Grr1-GFP construct grew poorly whenGrr1 was overexpressed. This observation was confirmed bycomparing the growth of 10-fold serial dilutions of cells onplates where Grr1 expression was suppressed (–URA) toplates that induce Grr1 expression (–URA galactose;Figure 2E). Introduction of hof1(5A) and hof1(10A)mutationssuppressed the growth defect of Grr1 overexpression(Figure 2E). This finding supports our co-immunoprecipita-tion data, and suggests that the growth defect caused by highlevels of Grr1 is due at least in part to increased degradationof Hof1.

Hof1 PEST motif phosphorylation is required to removeHof1 from the bud neck after contraction

Vallen et al. (2000) hypothesised that phosphorylation isrequired for Hof1 to become a single ring or to leave the budneck. In order to study the effects of the Hof1 PEST motifphosphorylation site mutations on Hof1 dynamics, time-lapse imaging of GFP-tagged Hof1 wild type, hof1(5A) andhof1(10A) was performed (Figure 3). As shown in Figure 3B,hof1(10A)-GFP was able to form a single ring, decreasein size, and split back into double rings similar to wildtype Hof1 dynamics. The only noticeable difference was thatthe Hof1-GFP signal remained brighter and more persistentin the PEST phosphorylation mutant than in the wildtype cells (compare the last three time points of Figures 3Aand 3B).



In order to do a quantitative analysis of Hof1-GFPdynamics, Slidebook software was used to obtain averagefluorescence intensity measurements as described in Materi-als and Methods Section. Because different cells expressdifferent levels of Hof1-GFP, the intensity value at thebeginning of contraction (T ¼ 0) was set as one, and allsubsequent values normalised, allowing comparison ofrelative changes in fluorescence between cells. The averagefluorescence intensity data for the wild type (N ¼ 7) showsthat Hof1-GFP is steadily removed from the bud neck duringand after cytokinesis, falling to 46% of the initial intensity30 min after the onset of contraction (Figure 3C). Incontrast, hof1(5A) and (10A)-GFP fluorescence intensitydata shows that the mutant hof1-GFP levels remain muchhigher at the bud neck (5A N ¼ 6, 10A N ¼ 7; Figure 3C).Hof1(5A) and (10A)-GFP behave similarly. Both exhibit asmall initial decrease in intensity, corresponding to the timewhen the actomyosin ring contracts, but after the initialdecrease levels of hof1(5A) and (10A)-GFP stabilise and donot decrease further. At the end of the time course, hof1(5A)and (10A) intensity levels are still above 70% of the initialvalue (Figure 3C). Septation, as judged by observation of theHof1 ring split and visible septa in the DIC channel, occurredabout 20 min after the onset of ring contraction, and did notdiffer significantly between Hof1 wild type and 10A.

Lack of Hof1 PEST motif phosphorylation affects budneck size and the rate of Myo1 contraction

The contraction of the Myo1 ring has shown to be affected byHof1 (Lippincott and Li, 1998b; Blondel et al., 2005). Todetermine if the persistence of Hof1 at the bud neck in the

PEST phosphorylation site mutants perturbed Myo1 ringcontraction, Myo1-GFP was examined by time lapsemicroscopy in HOF1 wild type, hof1(5A) and hof1(10A) cells(Figure 4). The average size of the bud neck, total time ofcontraction, and rate of contraction were determined(Table 4). As shown in Table 4, the size of the bud neck issmaller in hof1(5A) and (10A) than wild type. The change inthe size of the bud neck seems to be due to the cells beingsmaller overall, and this effect of the Hof1 PEST phosphory-lation site mutations was observed in both S288C (Figure 3,compare the DIC image in A and B) and W303 strainbackgrounds (Figure 4). As the overall time of Myo1-GFPring contraction was similar in the three strains, but the sizeof the bud neck was different, the rate of contraction wasslower in the Hof1 PEST phosphorylation site mutants(Figure 4 and Table 4). The Myo1-GFP ring contraction ratein control cells was 0.23 mm/min, while hof1(5A) and hof1(10A) cells had Myo1-GFP ring contraction rates of 0.16 and0.15 mm/min. The difference between wild type and hof1(10A) bud neck size and rate of contraction was significant(P < 0.05). Therefore, our data suggest that preventingphosphorylation of the Hof1 PEST motif slows the rate ofMyo1 contraction. This effect may be due to a direct effect onmyosin activity, or an indirect effect due to the reduced size ofthe bud neck.

Cell cycle regulation of Hof1 protein levels

Hof1 protein levels are cell cycle-regulated, and Hof1 hasbeen shown to be a phosphoprotein by a shift in size by SDS–PAGE (Vallen et al., 2000). We wanted to know how our hof1(5A) and hof1(10A)mutants affected this observed gel shift and

Figure 2 Hof1(10A) no longer co-immunoprecipitates with Grr1. (A) and(B) Yeast cell extracts prepared from cells

with wild type versions of Hof1-myc and

Grr1-GFP (KSY 258). (C) and (D) Yeast cell

extracts prepared from cells with Hof1(10A)-

myc and Grr1-GFP (KSY 330). Ext-extract

lane, representing 10% of input. Myc sup—

supernatant from anti-myc protein A beads.

Myc IP—immunoprecipitation using anti-

myc antibody. GFP IP—immunoprecipita-

tion using anti-GFP antibody. No Ab—no

antibody control. (A) and (C) Western blot

performed with anti-myc antibody. (B) and

(D) Western blot performed with anti-GFP

antibody. (E) Serial dilutions of GAL1-GRR1-GFP cells grown on –ura plates (left) or –ura

galactose plates (right) for 3 days at 308C.Cells in the top row expressed wild type

Hof1-myc (KSY 258), middle row hof1(5A)-

myc (KSY 259) and bottom row hof1(10A)-

myc (KSY 330).



stability of the protein during the cell cycle. However, wildtype Hof1-myc expressed from the plasmid used to create ourmutant alleles did not show a mobility shift during mitosis,and the levels of Hof1-myc expressed from the plasmiddid not vary during the cell cycle (Figure 5A). Under thesame conditions, we were able to recreate the published gelshift of Hof1 tagged at the chromosomal locus with HA,and observe the increase in Hof1 levels during mitosis(Figure 5B) (Vallen et al., 2000). Therefore, to observethe effect of the PESTmotif phosphorylation site mutationson Hof1 protein levels, we integrated our hof1(10A) alleleinto the chromosome using the two-step gene replace-ment method (Scherer and Davis, 1979). The resulting hof1(10A)-HA showed an increase in protein levels duringmitosis, but was not degraded during G1, as expected due toinability to interact with Grr1 (Figure 5C). The integrated

hof1(10A) led to a significantly smaller bud neck whencompare to Hof1 tagged at the chromosomal locus with HA(Supplementary Table S1), demonstrating that the pheno-types seen using our plasmid-borne hof1(10A)were due to thePEST motif mutations and not to differences in promoterregulation.

To determine if the difference in cell cycle regulation ofplasmid-borne wild type Hof1 protein levels seen inFigure 5A affected its localisation dynamics, we comparedHof1 tagged with GFP expressed from either a plasmid orfrom the chromosomal locus during cytokinesis. Usingquantitative analysis of Hof1 fluorescence, we found thatHof1 tagged with GFP either on a plasmid or at thechromosomal locus had the same extent and rate of loss fromthe bud neck during cytokinesis (Figure 5D). A differencebecame noticeable about 20 min after contraction, which

Figure 3 Hof1 PEST phosphorylation sitemutant protein dynamics. (A) Live cell imaging of Hof1-GFP and (B) Hof1(10A)-GFP. Scale bar 5 mm. The

time point before Hof1 ring contraction occurred is time 00:00 and is labelled before contraction. Panels showing Hof1 during contraction and

reappearance of the double ring after cytokinesis are labelled. Time is shown in min:s elapsed. Images were taken every 2 min. (C) Hof1 PEST

phosphorylation site mutant proteins persist at the bud neck. Average fluorescence intensity was calculated and normalised as described in Materials and

Methods Section. Standard error is shown.



corresponds to the completion of septation, with Hof1-GFPexpressed from the chromosome continuing to decline at asimilar rate, while the loss of Hof1-GFP expressed from theplasmid slowed (Figure 5D). This difference is likely due tothe drop in protein levels as cells exit mitosis in the cells withHOF1 tagged at the chromosomal locus.

Discussion

Phosphorylation of the Hof1 PEST motif does notregulate cytokinesis onset

We undertook these experiments to test the prediction thatMEN-dependent phosphorylation of Hof1 at the end ofmitosis regulated the relocalisation of Hof1 to the actomyosinring and/or the onset of contraction (Vallen et al., 2000;Blondel et al., 2005). We focused on phosphorylation of thePEST motif since deletion of the PEST motif had dramaticeffects on Myo1 contraction (Blondel et al., 2005). A recentstudy of Hof1 phosphorylation using mass spectrometryanalysis and in vitro kinase assays identified three phosphor-ylation sites modified by three different kinases within theHof1 PEST motif (Meitinger et al., 2011). These three sitesare: S421, phosphorylated by Dbf2, S424, modified by Cdc28

(budding yeast CDK), and S437, a Cdc5 site (Meitingeret al., 2011). Our analysis of Hof1 PESTmotif phosphoryla-tion began before publication of the exact sites, and thereforewe mutated all possible phosphorylation sites in the PESTmotif. Our hof1(5A) allele contains S421A and S424A and hof1(10A) includes alanine substitutions at all three sites(Figure 1A). The hof1(5A) allele had intermediate effects onHof1 dynamics and Myo1 contraction (Figure 3C andTable 4), but only hof1(10A) differed significantly from wild

Figure 5 Hof1 protein levels during the cell cycle. Cells were

arrested in G1 with alpha factor, and samples were collected and

prepared before release from arrest (T ¼ 0) or at 12 min intervals after

release from arrest. (A) Anti-myc blot of Hof1-myc expressed from plasmid

pLP1 (KSY 240). (B) Anti-HA blot of Hof1-HA tagged at the chromosomal

locus as in Vallen et al. (2000) (KSY 188). (C) Anti-HA blot of hof1(10A)-

HA integrated into the HOF1 locus (KSY 431). (D) Analysis of Hof1-GFP

fluorescence intensity comparing plasmid and chromosome Hof1-GFP

expression.

Table 4 Bud neck diameter and rate ofMyo1-GFP contraction is affected in cells expressing Hof1 PEST phosphorylation site mutant proteins

Strain

Average diameter of bud

neck in mm � std dev

Average time of Myo1 ring

contraction in min � std dev

Average rate of Myo1

contraction mm/min � std dev

Hof1 wild type (KSY 319) 1.71 � 0.3 7.8 � 1.5 0.23 � 0.06

Hof1(5A) (KSY 268) 1.32 � 0.3 8.0 � 1.2 0.16 � 0.06

Hof1(10A) (KSY 335) 1.06* � 0.1 7.7 � 2.0 0.15* � 0.05

*P � 0.05 compared to wild type.

Figure 4 Myo1-GFP contraction occurs with the same duration,but with a different rate in Hof1 and Hof1 PEST motif phosphory-lation site mutants. (A) Myo1-GFP in Hof1-myc cells (KSY 319). (B)

Myo1-GFP in Hof1(5A)-myc cells (KSY 268). (C) Myo1-GFP in Hof1(10A)-

myc cells (KSY 335). Each panel represents a 1 min interval. T ¼ 0 is the

time before Myo1 ring contraction begins. Bar ¼ 1 mm.



type. This suggests either that the Cdc5 phosphorylation hasthe greatest effect on Hof1 and Myo1 dynamics, or that thecombination of all three sites is important for regulation ofHof1.

Meitinger et al. (2011) found that phosphomimeticmutation at all Dbf2 phosphorylation sites in Hof1promoted relocalisation of Hof1 from the septin ring tothe actomyosin ring (Meitinger et al., 2011). Our datasuggest that S421 is not important for this change in Hof1localisation, as preventing its phosphorylation did not affectthe transition of Hof1 from double to single ring. Our resultsshow that preventing phosphorylation of the Hof1 PESTmotif has subtle effects. Mutation of the first five serines orall nine serines and a threonine in the PEST motif led toretention of Hof1 at the bud neck during and aftercytokinesis. However, regulation of Hof1 degradation viaPEST motif phosphorylation is not critical for either theonset or the completion of cytokinesis. Deletion of theHof1 PESTmotif or mutation of PEST phosphorylation sitesboth prevent the interaction of Hof1 with Grr1, yet thedeletion of the Hof1 PESTmotif has a much more dramaticeffect on cytokinesis (Blondel et al., 2005). This suggests thatthe Hof1 PEST motif may have functions in addition toregulating Hof1 stability in budding yeast. Because our hof1(10A) allele, whether plasmid-borne or integrated, had lesssevere phenoytpes than deletion of the PEST motif seen byBlondel el al., we think it is unlikely that mutation of tenamino acids resulted in a gross structural change of the Hof1PEST motif. In contrast to the results seen in S. cerevisiae,deletion of the Hof1 PEST motif in the filamentous fungusAshbya gossypii did not affect cytokinesis (Kaufmann andPhilippsen, 2009).

Increased Hof1 at the bud neck after cytokinesis affectsbud neck size and the rate of myosin contraction

Analysis of Myo1-GFP in hof1(5A) and hof1(10A) cells showedthat although the overall time to complete contraction wasthe same, the rate of myosin contraction was slowercompared to wild type cells due to the different size of thebud necks. This could be due to a direct effect of Hof1 onMyo1, as deletion of HOF1 has been shown to lead toasymmetric contraction of the actomyosin ring (Lippincottand Li, 1998a). Our Hof1 PESTmotif mutants did not exhibitasymmetric Myo1 contraction. Therefore, the effect could bea result of the smaller bud neck. Recent studies inCaenorhabditis elegans and Neurospora crassa have shown thatlarger rings contract faster than smaller rings (Carvalho et al.,2009; Calvert et al., 2011). This has led to a model of cell size-dependent scalability, where the rate of myosin contractionvaries with cell size so that the overall duration of cytokinesisis the same. This is similar to what we have observed in hof1(5A) and hof1(10A) cells. A recent study comparing polyploid

yeast cells provided evidence that budding yeast also has aconstant time of contraction and that the rate of contractionvaries with the size of the bud neck (Pinto et al., 2012).

Hof1 presence or absence at the bud neck duringcytokinesis and septation affects the size of the subsequentbud neck. It was previously shown that bud necks are larger inHOF1 deletion mutants (Lippincott and Li, 1998a). In ourstudy, we found that mutation of the Hof1 PESTmotif, whichled to increased retention of Hof1 at the old bud neck,resulted in smaller bud necks. Themechanism bywhichHof1affects emerging bud neck size is unknown, but Hof1 hasbeen reported to interact with Bud4, a protein involved inbud-site selection, by two-hybrid analysis (Tonikianet al., 2009). It will be interesting to determine if the Hof1effect is only seen in haploids, which bud axially (adjacent tothe old bud neck) or if the phenomenon also occurs indiploids, when distal budding occurs.

Cell cycle regulation of Hof1 protein levels

It has previously been suggested that levels of Hof1 proteinare regulated during the cell cycle by a PEST motif andproteasome dependent degradation pathway as well astranscriptional regulation (Cho et al., 1998; Blondelet al., 2005). Comparison of wild type Hof1 expressedfrom a plasmid or the chromosomal locus showed adifference in protein levels during the cell cycle (Figure 5).TheHof1 plasmid contains the endogenous promoter locatedin the upstream 265 bp sequence, but we suspect that the lackof another promoter or enhancer element prevents normalcell cycle regulation of Hof1 transcription. This may accountfor the published differences in the timing of Hof1appearance at the bud neck, and therefore it is likely thatendogenous Hof1 initially localizes to the bud neck inmitosis(Lippincott and Li, 1998a; Vallen et al., 2000). Even thoughthe protein levels of wild-type Hof1 expressed from theplasmid did not fluctuate like the chromosome tagged Hof1-HA, the kinetics of protein localisation at the bud neck duringand after cytokinesis were very similar, presumably due tointeraction with Grr1 and subsequent ubiquitination(Figure 5). This is supported by our analysis of plasmidexpressed hof1(10A) mutant proteins, which remained athigh levels at the bud neck after cytokinesis and did notinteract with Grr1. Analysis of hof1(10A) protein levels afterintegration into the chromosome shows that hof1(10A) levelsincreased during mitosis, likely due to transcriptionalregulation, but did not rapidly decrease in G1, presumablydue to failure to bind to Grr1. Therefore, hof1(10A)expressed from a plasmid should lack both transcriptionaland proteasome dependant regulation, yet still causes nocytokinesis defects. Why the cell would exert such tightcontrols over protein levels when there is no obvious reasonto do so is a mystery.



Conclusions

Altogether, our results suggest that phosphorylation of theHof1 PEST motif and interaction with Grr1 regulates Hof1dissociation from the bud neck. Failure to remove Hof1 fromthe site of cytokinesis causes bud necks to be smaller and therate of myosin contraction to be slower, but does not causecytokinesis defects.

Acknowledgements and funding

We would like to thank Rong Li, Matthias Peter, and Erfi Bifor strains and plasmids. Sequencing was performed by theMissouri S&T cDNA Resource Center. This work wassupported by a Missouri Research Board grant to K.B.S.and K.E.S. were supported by the Department of BiologicalSciences at Missouri S&T.

References

Balasubramanian MK, Bi E, Glotzer M (2004) Comparative

analysis of cytokinesis in budding yeast, fission yeast and animal

cells. Curr Biol 14: R806–18.

Bi E (2001) Cytokinesis in budding yeast: the relationship between

actomyosin ring function and septum formation. Cell Struct

Funct 26: 529–37.

Bi E, Maddox P, Lew DJ, Salmon ED, McMillan JN, Yeh E, Pringle

JR (2001) Involvement of an actomyosin contractile ring in

Saccharomyces cerevisiae cytokinesis. J Cell Biol 142: 1301–12.Blondel M, Bach S, Bamps S, Dobbelaere J, Wiget P, Longaretti C,

et al. (2005) Degradation of Hof1 by SCF(Grr1) is important for

actomyosin contraction during cytokinesis in yeast. EMBO J 24:

1440–52.

Bodenmiller B, Campbell D, Gerrits B, Lam H, Jovanovic M,

Picotti P, et al. (2008) PhosphoPep—a database of protein

phosphorylation sites in model organisms. Nat Biotechnol 26:

1339–40.

Calvert ME, Wright GD, Leong FY, Chiam KH, Chen Y, Jedd G,

et al. (2011)Myosin concentration underlies cell size-dependent

scalability of actomyosin ring constriction. J Cell Biol 195: 799–

813.

Carvalho A, Desai A, Oegema K (2009) Structural memory in the

contractile ring makes the duration of cytokinesis independent

of cell size. Cell 137: 926–37.

Cho RJ, Campbell MJ, Winzeler EA, Steinmetz L, Conway A,

Wodicka L, et al. (1998) A genome-wide transcriptional analysis

of the mitotic cell cycle. Mol Cell 2: 65–73.

Field C, Li R, Oegema K. (1999) Cytokinesis in eukaryotes: a

mechanistic comparison. Curr Opin Cell Biol 11: 68–80.

Fujiwara T, Bandi M, Nitta M, Ivanova EV, Bronson RT, Pellman D

(2005) Cytokinesis failure generating tetraploids promotes

tumorigenesis in p53-null cells. Nature 437: 1043–7.

GanemNJ, Storchova Z, PellmanD (2007) Tetraploidy, aneuploidy

and cancer. Curr Opin Genet Dev 17: 157–62.

Gietz D, St Jean A, Woods RA, Schiestl RH (1992) Improved

method for high efficiency transformation of intact yeast cells.

Nucleic Acids Res 20: 1425.

Jendretzki A, Ciklic I, Rodicio R, Schmitz HP, Heinisch JJ (2009)

Cyk3 acts in actomyosin ring independent cytokinesis by

recruiting Inn1 to the yeast bud neck. Mol Genet Genomics 282:

437–51.

Kamei T, Tanaka K, Hihara T, Umikawa M, Imamura H, Kikyo M,

et al. (1998) Interaction of Bnr1p with a novel Src homology

3 domain-containing Hof1p. Implication in cytokinesis in

Saccharomyces cerevisiae. J Biol Chem 273: 28341–5.

Kaufmann A, Philippsen P (2009) Of bars and rings: Hof1-

dependent cytokinesis in multiseptated hyphae of Ashbyagossypii. Mol Cell Biol 29: 771–83.

Lippincott J, Li R (1998a) Dual function of Cyk2, a cdc15/PSTPIP

family protein, in regulating actomyosin ring dynamics and

septin distribution. J Cell Biol 143: 1947–60.

Lippincott J, Li R (1998b) Sequential assembly of myosin II,

an IQGAP-like protein, and filamentous actin to a ring structure

involved in budding yeast cytokinesis. J Cell Biol 140: 355–66.

Lippincott J, Li R (2000) Involvement of PCH family proteins in

cytokinesis and actin distribution. Microsc Res Tech 49: 168–72.

Lippincott J, Shannon KB, Shou W, Deshaies RJ, Li R (2001) The

Tem1 small GTPase controls actomyosin and septin dynamics

during cytokinesis. J Cell Sci 114: 1379–86.

Meitinger F, Petrova B, Lombardi IM, Bertazzi DT, Hub B, Zentgraf

H, et al. (2010) Targeted localization of Inn1, Cyk3 and Chs2 by

the mitotic-exit network regulates cytokinesis in budding yeast.

J Cell Sci 123: 1851–61.

Meitinger F, Boehm ME, Hofmann A, Hub B, Zentgraf H,

LehmannWD, et al. (2011) Phosphorylation-dependent regula-

tion of the F-BAR protein Hof1 during cytokinesis. Genes Dev

25: 875–88.

Nishihama R, Schreiter JH, Onishi M, Vallen EA, Hanna J,

Moravcevic K, et al. (2009) Role of Inn1 and its interactions with

Hof1 and Cyk3 in promoting cleavage furrow and septum

formation in S. cerevisiae. J Cell Biol 185: 995–1012.Olaharski AJ, Sotelo R, Solorza-Luna G, Gonsebatt ME, Guzman P,

Mohar A, et al. (2006) Tetraploidy and chromosomal instability

are early events during cervical carcinogenesis. Carcinogenesis

27: 337–43.

Pinto IM, Rubinstein B, Kucharavy A, Unruh J, Li R (2012) Actin

depolymerization drives actomyosin ring contraction during

budding yeast cytokinesis. Dev Cell 22: 1247–1260.

Ren G,Wang J, Brinkworth R, Winsor B, Kobe B, Munn AL (2005)

Verprolin cytokinesis function mediated by the Hof one trap

domain. Traffic 6: 575–93.

Scherer S, Davis RW (1979) Replacement of chromosome

segments with altered DNA sequences constructed in vitro.

Proc Natl Acad Sci USA 76: 4951–5.

Sherman F, Fink GR, Hicks JB (1981) Cold spring harbor laboratory.Methods in Yeast genetics. Cold Spring Harbor, N.Y.: Cold Spring

Harbor Laboratory.

Storchova Z, Kuffer C (2008) The consequences of tetraploidy and

aneuploidy. J Cell Sci 121: 3859–66.



Tolliday N, PitcherM, Li R (2003) Direct evidence for a critical role

of myosin II in budding yeast cytokinesis and the evolvability of

new cytokinetic mechanisms in the absence of myosin II. Mol

Biol Cell 14: 798–809.

Tonikian R, Xin X, Toret CP, Gfeller D, Landgraf C, Panni S, et al.

(2009) Bayesian modeling of the yeast SH3 domain interactome

predicts spatiotemporal dynamics of endocytosis proteins. PLoS

Biol 7: e1000218.

Tully GH, Nishihama R, Pringle JR, Morgan DO (2009) The

anaphase-promoting complex promotes actomyosin-ring dis-

assembly during cytokinesis in yeast. Mol Biol Cell 20: 1201–12.

Vallen EA, Caviston J, Bi E (2000) Roles of Hof1p, Bni1p, Bnr1p,

and Myo1p in cytokinesis in Saccharomyces cerevisiae. Mol Biol

Cell 11: 593–611.

Waddle JA, Karpova TS, Waterston RH, Cooper JA (1996)

Movement of cortical actin patches in yeast. J Cell Biol 132:

861–70.

Supporting information

Additional supporting information can be found in theonline version of this article:

Table S1. Bud neck diameter in strains with integratedHof1 alleles.

Received 15 November 2012; accepted 31 December 2012.Final version published online 29 January 2013.



Documents

Mutation of Hof1 PEST motif phosphorylation sites leads to retention of Hof1 at the bud neck and a decrease in the rate of myosin contraction