Upload
marcus-joseph
View
222
Download
1
Tags:
Embed Size (px)
Citation preview
MUTANTSgenetic variation in human development
Lecture 6
Fall 2006Bennington College
homeotic genes all have a common amino acid sequence that confersthe necessary structure to bind to DNA and activate or repress genetranscription - this sequence is called the homeobox
homeotic genes specify the particular developmental fate of body parts
example: "build mouthparts here (and not everywhere)", and "put genitalia here (not over there)"
Homeobox and Homeodomain:
The homeobox is a 180 base pair sequence of DNA found in many regulatory genes.
The homeodomain is the 60 amino acid stretch that corresponds to the translated homeobox. This part of the protein is the DNA binding sequence.
for a given DNA sequence: ATGCCGCATCCAAGGGTCGACGTATTTCTTGTGGATCATCGGAGACGA
DNA consists of 4 possible bases/nucleotides - GCATA sequence of DNA is read 3 bases at a time when beingconverted to amino acids (and ultimately protein)
andM P H P R V D V F L V D H R R R is the resulting sequence of amino acids
TACGGCGTAGGTTCCCAGCTGCATAAAGAACACCTAGTAGCCTCTGCTwould be the transcribed mRNA sequence
mRNA
Amino AcidtRNA
codon
anti-codon
Translation of messenger RNA into protein
To initiate gene expression (or in some cases, to prevent gene expression), regulatory proteins (homeobox proteins and other transcription factors)bind to DNA upstream of the start of the target gene at regulatory elements.
The homeodomain region of homeotic genes folds into three helices formed such that helix 3 fit perfectly into a groove formed by the DNA spiral, and the amino acids in homeodomain regions specify binding to particular sequences in the DNA.
the homeodomain helix 3 likes to bind to TAAT
The homeodomain sequence is highly conserved. The DNA sequence is roughly 75% homologous when comparing different Hox genes within the fly; comparisons of just the homeodomain sequence show even higher homology (most nucleotide differences conserve the amino acid encoded)
K (lysine)Q (glutamine)
The prevailing myth that human deformity results from some moral failing
-“mark of Cain” philosophy…
With our modern scientific knowledge,clearly has no basis in fact - but sometimesevents conspire to make you wonder…
Thus was the fate of elderly Margaret McLauchlan and youthful Margaret Wilson(her younger sister would have suffered the same fate but her life was purchased)
it was demanded of them, as a test of their loyalty, that they should swear the abjuration oath. This was an oath rejecting a manifesto published by the Society People, or the Cameronians, on the 8th of November 1684, entitled 'The Apologetic Declaration and Admonitory Vindication of the True Presbyterians of the Church of Scotland, especially anent Intelligencers and Informers.'
Sentenced to death by “drowning at the stake”
The 1680’s in Scotland came to be known as “The Killing Time”
England, following up on what King Charles II started, was still trying to impose the English Church system on Scotland.
Dissenters were not tolerated and were put to death - often inspectacular and horrific fashion (to, of course, discourage otherpotential dissenters…)
Supposedly, the officer who last thrust the younger Margaretinto the waters was named Bell. His wife soon thereaftergave birth to a child with ectrodactyly (split-hand split-foot syndrome)
his descendants thus came to be known as the “cleppie Bells”
(why not parten Bells? I need a linguist to explain this to me…)
Ectrodactyly is dominantly inherited
but can also be chemically induced (at least in rats) by environmental factors: retinoic acid, cadmium, hydroxyurea, cytarabine, methotrexate, ethanol, caffeine, cocaine, valproic acid, acetazolamide and methoxyacetic acid
Ectrodactyly is only one of many possiblethings that can go wrong during limb development
well-formed limbs are not essential for viability(and are quite easily compensated for - especially if they were never there to begin with)
Ianakiev,P. et al., Acheiropodia Is Caused by a Genomic Deletion in C7orf2, the Human Orthologue of the Lmbr1 Gene, Am. J. Hum. Genet., v.68: 38-45, 2001.
Acheiropodia
phocomelia (tetraphocomelia)
Carl Hermann Unthanborn in East Prussia1848-1928
Phamous Phocomelia-ites
Marc Cazotte (Pepin)born in Paris1757-1801
Phamous Phocomelia-ites
Day 26 Day 28
Limb development - Buds, bones, and beyond…
Day 26 Day 28
the limb bud is capped with cells comprising an Apical Ectodermal Ridge (AER) - discovered by John Saunders in 1948
The AER is rich in signalling molecules - especially FGFs
FGF = Fibroblast Growth Factor = A family of protein growth factors involved in new blood vessel formation, wound repair, lung maturation, and the development of skeletal muscle, specific lineages of blood cells and bone marrow. FGFs are recognized by a family of cell surface receptors that have the ability to catalyze reactions inside the cell after they are activated by the FGFs.
Effects of mucking about with the AER
Induction of ectopic limb with FGF-soaked bead
Figure 1. The ectrodactyly phenotype and underlying AER defect. (A) Clinical variability of ectrodactyly. (B) Normal development of the autopod (top) and ectrodactyly malformation (bottom). Ectrodactyly is caused by a failure to maintain median AER activity (red) in the developing limb bud (left), leading to the absence of the central rays (right). (Future) positions of digits 1–5 are indicated. AER, apical ectodermal ridge; PZ, progress zone; ZPA, zone of polarizing activity.
Pascal H.G. Duijf, Hans van Bokhoven* and Han G. BrunnerPathogenesis of split-hand/split-foot malformationHuman Molecular Genetics, 2003, Vol. 12, Review Issue 1 R51-R60
For correct limb and digit development, three specialized cell clusters are of primary importance: the apical ectodermal ridge (AER), the progress zone (PZ), and the zone of polarizing activity (ZPA).
These groups of cells produce signalling molecules that determine the fate of neighbouring cells by instructing them to remain undifferentiated, to proliferate, or to differentiate into a particular cell type.
effects of thalidomide on human fetus development
Thalidomide effects on fetal marmosets
on the right, fetus of a marmoset treated with 25 mg/kg body weight thalidomide between days 38 and 46 of pregnancy