MOLECULAR BIOLOGY TEST #3

Gene Regulation in Prokaryotes

Regulation of transcription initiation by transcription factors (transcriptional activators or repressors)

-When a gene is turned OFF, it is not literally turned OFF completely. The mechanism is more like a tap; it can be opened to increase gene expression or closed to decrease gene expression

* Expression of housekeeping genes is different in different tissues. This up or down regulation is performed by the cell

-Most gene regulation occurs at the Initiation Stage: where RNA polymerase binds the promoter and activates transcription (95% of regulation occurs at this time)

* This happens b/c the cell doesn’t want to be wasteful = less waste if regulated before expression.

*Also because it is easier to regulate one or two copies of a gene instead of having to modify hundreds or thousands of RNA molecules.

-Outside chemicals can enter bacteria and affect transcription

-When bacteria is grown at a higher temperature than the ideal (37C), a group of genes (and therefore proteins), called heat-shock proteins, are activated.

* The function of these proteins is to protect the bacteria against the heat

Exracellular signals often control genes.In bacteria this means molecules present in the growth medium.

Transcriptional activators: Positively regulate transcription(often transcription initiation). Examples: CAP, NtrC, MerR.

Transcriptional repressors: Negative regulate transcription(often transcription initiation). Example: Lac repressor.

Transcription factors

Ways in which activators and repressors can regulate transcription initiation;Control of binding of RNA

Polymerase to the promoterRepressor bindsto operatorsite overlapping the promoter.Binding of RNAPto the promoteris inhibited.Activator bindsSimultaneouslyTo RNAP and a site on the DNA. Binding of RNAPto the promoteris enhanced(‘recruitment’).

-Promoters in Prokaryotic cells: since the promoter is not 100% promoter for the consensus sequence, the RNA polymerase has a relatively weak attraction and can only perform small amount of transcription = basal level transcription (Transcription of a gene in the absence of any activator)

-Repressor molecules can recognize and bind the promoter region, thus inhibiting the binding of RNA polymerase and transcription.

-Activator molecules help the RNA polymerase to bind the promoter region. The activator molecule itself will NOT bind the promoter, but a site adjacent to it. This allows the RNA polymerase to bind the promoter. The activator will bind both the DNA and the RNA pol.

-Open or Closed Complex: Refers to the DNA. When the RNAP is attached, it is in the open complex. When it is not attached, it is called the closed complex.

* For DNA to be transcribed it must be in the Open Complex

* The Activator cause the change in complex: It can either change the 3D conformation of the RNAP or it can act directly on the DNA (separating the two strands of the double helix.)

Ways in which activators and repressors can regulate transcription initiation;

Control of isomerization to the open complex

Note: Some repressors can inhibit isomerization from the closed to open complex or promoter escape (to be covered later).

-Sometimes, DNA Binding Proteins work together synergistically. In the above example:

Protein A cannot bind its site unless Protein B is already bound to its site; the presence of Protein B is aiding in the binding of Protein A.

*This provides a biological switch to turn on transcription. Sometimes, some genes may only be turned on when all 4 (example) specific proteins are present.

-Binding sites of proteins may be very far apart. DNA can bend to allow for proteins to interact.

Cooperativity among DNA binding proteins can play an important role in regulation of gene

expression

The ability of A and B to interact with each other can lead to cooperativity.

Example: Imagine that DNA sites A and B are on different DNA molecules and that the affinity of protein A for its DNA sites is 10 times greater than the affinity of protein B for its site. If proteins A and B interact tightly with each other and DNA sites A and B are now placed on the same piece of DNA, then binding of protein A to its site will increase the apparent affinity of B for its site. Another way of viewing this situation is that binding of A to its site increases the local concentration of B, thereby increasing the proportion of DNA molecules that have protein B bound at site B. Cooperativity will also occur among two DNA binding proteins that each bind DNA with similar, weak affinities. In this case, the apparent affinity of each of the two DNA binding proteins for their DNA sites will increase.

Ways in which activators and repressors can regulate transcription

initiation- Action at a distance via DNA bending

DNA bending (or ‘looping’) can increase the local concentration of a DNA-bound activator, thereby increasing the frequency of interactionbetween the activator and RNAP.

- Examples of DNA-bending proteins (covered in Chapter 11): Fis, IHF.

Example of such an activator: NtrC

Example of cooperativity between two transcription factors

Binding of protein B to siteB in the absence of site A

Binding of protein B to siteB in the presence of site A(and protein A) – MUCH steeper when A is present

If both A and B bindtheir sites with weakintrinsic affinities,then both A and Bwill show cooperativitywhen their sites areplaced on the same DNA molecule

-Bacteria prefer glucose as an energy source b/c it is a monomer, unlike lactose which must be broken down

Cooperativity can create a type of ‘switch’ where gene expression goes from ‘on’ to ‘off’ with just a small increase in concentration of DNA binding protein(s).

Such a cooperativity-driven switch is often used to promote rapid changes in gene expression in response to particular environmental or physiological signals in cells. In this way, cooperativity plays a critical role in signal integration: i.e. ensuring that cells express certain genes only when a given set of conditions (or ‘signals’) are present.

Regulation of Transcription Initiation;

The Example of The lac operonDiauxic growth. E. coli and many other bacteria can use glucose or other sugars as a sole carbon and energy source. When E. coli are given a grown in a medium containing glucose and lactose, the glucose is utilized first, cells then undergo a lag in growth, and then growth resumes as the bacteria utilize the lactose. Monod was one of the first to study such biphasic (diauxic) growth.

The lag phase suggests that the bacteria cannot initially metabolize the lactose, but later acquire the ability to do so. We now know that resumption of growth on lactose is due to de novo synthesis of mRNA and proteins needed for the import and catabolism of lactose.

-Lactose DOES NOT diffuse into the bacteria; it must use a channel formed by the Lac Permease.

*Once inside, lactose is broken down by Beta-galactosidase into Galactose & Glucose

Catabolism of lactose in E. coli

Lac permea

se

plasmamembrane

periplasmic space

OH

OOHOHCH2OH CH2OH

OOH

OOHOHlactose

OH

OOHOHCH2OH

OH OH

OOHOH

CH2OH

OHOH

OOHOHCH2OH CH2OH

OOH

OOHOH +b-galactosidase

Glucose 6-phosphate

glycolysis

Galactose Glucose

Galactose 1-phosphate

UDP-galactose

UDP-glucose

Glucose 1-phosphate

lactose

-Lac operon consists of 3 main genes: lacZ, lacY, and lacA – Each encodes something different (MEMORIZE)

The lac operon

lacZ encodes b-galactosidase (lactose catabolism)

lacY encodes lac permease (lactose transport)

lacA encodes thiogalactoside transacetylase (inactivates toxic thiogalactosides)

Transcription initiation at the lac promoter is regulated by a transcriptional activator (CAP) and a transcriptional repressor (Lac repressor)

-How do activator and repressor know when to bind to the DNA? They are regulated.

Transcription of the lac operon is regulated by two sugars, each of which affects activity of

a different transcription factor.

In the presence of glucose, Lac repressorinhibits binding of RNAPto the promoter

In the absence of glucose, CAPrecruits RNAPto the promoter

-cAMP (in the absence of glucose) binds CAP and causes a conformational change in the molecule (BELOW)

-The conformational change allows CAP to bind the DNA (Major Groove)

-Activator is in INVERSE CORRELATION with Glucose

The ability of Lac repressor or CAP to bind theirDNA sites is controlled allosterically by different ‘signals’

Binding of CAP to the small molecule cyclic AMP (cAMP) activates CAP’s DNA binding activity. This activation is due to a conformational change in CAP that occurs upon cAMP binding.

cAMP levels in the cell drop in the presence of glucose and increase as cellular glucose levels decrease. Therefore, cAMP can be regarded as a ‘signal’ that indicates the absence or scarcity of glucose.

Changes in cAMP levels are due to changes in the activity of the enzyme that makes cAMP, adenylyl cyclase.

Because of ability of cAMP to activate CAP’s DNA binding activity, CAP is able to stimulate transcription of the lac operon only in the absence of glucose (or the presence of very low glucose concentrations).

Mechanism of allosteric control of CAP

-DNA Binding Proteins usually sit on the DNA as homodimers or heterodimers.

Inversely… Lac repressor cannot bind its DNA sites when it is complexed with the ‘inducer’ molecule allolactose.

Allolactose is generated from lactose by the enzyme b-galactosidase. Therefore, allolactose can be regarded as a ‘signal’ indicating the presence of lactose.

Binding of allolactose to Lac repressor induces a conformational change in the repressor that prevents binding to the operator sites on the DNA.

DNA sites bound by RNAP, CAP, or Lac repressor

The DNA binding site of Lac repressor (the operator or O1) overlaps the binding site of RNAP. The affinity of Lac repressor for O1 is approximately 10 times higher than the affinity of RNAP for the lac promoter. In this way, Lac repressor prevents RNAP from binding the promoter.

The lac promoter is an intrinsically poor promoter, because its -35 region deviates from the consensus -35 sequence (TTGACA) and so binds RNAP with relatively low affinity.

By contacting both RNAP and its DNA site, CAP recruits RNAP to the promoter, thereby compensating for the poor -35 sequence.

* Homodimer: Two of the same molecule

* Heterodimer: Two different molecules

-Restriction enzymes are HOMODIMERS = have symmetry (bind DNA as homodimers)

DNA sites bound by CAP or Lac repressor

DNA sites bound by CAP or Lac repressor are imperfect inverted repeats (they are said to have partial ‘dyad symmetry’).

Each DNA binding site for CAP or Lac repressor is comprised of two ‘half sites’. Each half site binds a monomer of CAP or Lac repressor. Therefore, a dimer of either protein is bound to each full binding site.

In the cases of both CAP or Lac repressor, the centers of the two half sites are separated by multiples of 10 base pairs (approximately). Therefore, the two monomers of CAP or Lac repressor are located on the same side of the DNA helix.

AAATGTGATCT AGATCACATTTTTTACACTAGA TCTAGAGTAAA

‘Perfect’ (artificial)CAP-binding site

TAATGTGAGTT AGCTCACTCATATTACACTCAA TCGAGTGAGTA

‘Imperfect’CAP-binding site

Found at lac P1

CAP binding site

Lac repressor binding site (O1)

X-gal: B-galactosidase activation will cause cleavage of X-gal, producing a blue color

Lac repressor is a tetramer and binds two operator sites

The highest affinity operator (O1) overlaps the lac promoter.

Two additional operators (O2 or O3) are located upstream or downstream of O1.

Each operator site binds a dimer of Lac repressor.

Lac repressor dimers interact with each other, resulting in cooperativity.

As a result, the utilization of two operators by Lac repressor allows maximal repression of transcription.

O1

-Footprinting utilizes a DNase which cuts the DNA at random sites, except those areas bound by a DBP

(Footprint will correspond to area that is protected)

Use of DNA footprinting to map DNA binding sitesof proteins like CAP, Lac repressor, and RNAP

Recognition of DNA sites by transcriptionalregulators with helix-turn-helix domains

Many transcriptional regulators, including CAP and Lac repressor, use a domain called a ‘helix-turn-helix’ domain to bind their DNA sites.

-The core RNA polymerase in bacteria is the same, what is different is the promoters.

* Many different sigma factors bound in bacteria (protein bring RNAP to a promoter; it recognizes the DNA sequence)

-To “hijack” bacteria, bacteriophages take over the host cell with the use of certain operons which produce proteins that correspond to each sigma factor. These new sigma factors produced by the bacteriophage infecting the host will give the RNAP a different specificity for a different type of promoter, causing it to bind a different promoter and transcribing it.

END PCB 1.9

Ch17 – Eukaryotic Gene RegulationInitiation of Translation is the MAIN CONTROL STEP

**Most Eukaryotic regulation occurs at the INITIATION STAGE

As in prokaryotes, Transcription is regulated by ACTIVATORS and REPRESSORS

**Mechanisms of Translation have been relatively conserved from yeast to mammals

Information we have learned about how Translation works has been learned by studying yeast. Easier to use yeast in experiments rather than human cells

Eukaryotic cells have additional complexities UNIQUE to them:

1. Nucleosomes (The name of the structural unit made up of a HISTONE) and their modifiers influence access to genes (unique problem but also an opportunity for regulation).

The function of histones is to package DNA in an orderly way. Aids when going back and accessing different components of the DNA.

Gene regulation in Eukaryotes also works by modifying the histones.

2. Splicing (and its regulation) is unique to eukaryotes – Remove introns, etc…

3. Many eukaryotic genes have more regulatory binding sites and are controlled by more regulatory proteins than are typical bacterial genes.

In eukaryotes binding sites are more numerous and positioned further from the start site of transcription.

** Coupled Transcription/Translation exists in prokaryotes but NOT in eukaryotes. After it is transcribed, pre-mRNA (Still has introns that must be excised) leaves the nucleus to be translated by ribosomes in the cytoplasm.

Above Diagram:

- Bacterial gene has regulatory sequence right next to promoter- Yest is “between” bacterial and human gene. Promoter is present, as are regulatory sequences which

are slightly upstream of the promoter, but not very far. - The human gene has tolls for regulatory elements, of which there are many more present (They can

be both positive and negative) than in prokaryotes Regulatory elements can be very far away from initiation site, which may create many problems as

well. (Action from a distance requires insulators or boundary elements).Eukaryotes can also have regulatory elements downstream of the initiation site; the reason for this is that many eukayotic genes have introns, which are not transcribed/translated. Regulatory elements can be present within these introns.

-----BE ABLE TO NAME 5 DIFFERENCES/SIMILARITIES BETWEEN EUKS & PROKS-----

Conserved mechanisms of transcriptional regulation from yeast to mammals.

Yeast activators also work in mammalian cells.Reporter gene.Gene silencing.

ACTIVATORS

**Activators have separate DNA binding and activating functions/DOMAINS

**BOTH domains are necessary & essential for activation of transcription

If activation domain is removed, the DNA-binding domain will be able to bind the DNA by itself, but it WILL NOT be able to activate transcription.

If activation domain is present in the absence of the DNA-binding domain, nothing will happen either.

Example of a Yeast Gene

** GAL1 gene has Upstream Activating Sequence consisting of 4 DNA motifs/elements where GAL4 is going to bind.

Activating sequences often shown as one element, but most times they have various binding sites Having more binding sites allows for more activators to bind and for the upregulatory effect to be

multiplied

Figure Above:

Shows that an activating domain from Yeast can be used in a mammalian cell. Shows that these proteins are modular, have different domains, and can function in the context of

other domains.

What is unique about a DNA-Binding Domain?

There are 4 families of DNA-Binding Domains.

1. Homeodomain Proteins - Involved in Embryonic development. It has 3 alpha-helixes. The #3 alpha helix is the one that interacts with the major groove of the DNA.

2. Zinc containing DNA-binding domains (Zinc Finger Proteins) - Require zinc atoms to function. To inactivate them, you add the ZFP to a solution with EDTA or EGTA which will chelate the zinc out of the protein, protein will collapse. Biggest family of DNA-binding proteins

3. Leucine Zipper Motif – Forms a HOMODIMER that interacts with the DNA. Is a major class of transcriptional factors.

4. Helix-Loop-Helix Proteins – Two alpha-helixes. Can form HOMODIMERS as well as HETERODIMERS. This gives the protein more flexibility. Example of H-L-H is the Nik (sp?) family of genes

Activation Domain – Part of the protein that interacts with the RNA Polymerase (In Prokaryotic Cells) or the Mediator (In Eukaryotic Cells). It was discovered by analyzing many different ones that there is no particular motif or structure to activating domains.

They have a higher concentration of acidic amino acids. Some are glutamine rich, others are proline rich. Activating domains can be synthesized to fit your specific needs (Genetic Engineering)

In Bacteria, the activators interact directly with the RNA Polymerase. In Eukaryotics, they interact with the MEDIATOR. (**Major Difference**)

“Activators in Eukaryotes can recruit nucleosome modifiers.”

Mediator Complex is needed because since there is so many activators and repressors regulating one single gene, Mediators “weigh out” the many positive and negative interactions and expresses the final outcome on the RNA Polymerase.

Chromatin Immunoprecipitation (ChIP) – Not Tested On This?

ChIP: You have an activator (or repressor); want to find out what is the target of the activator-- and how many genes it activates (since most times one activator will regulate multiple genes.)

Proteins that “sit” on the DNA will be cross-linked and “frozen” in that particular location. Next, use a DNase/other enzyme/sonication to cut DNA into smaller pieces. Fragments of DNA with proteins attached to them. Use an antibody to precipitate out the protein that

you are interested in. By precipitating the protein, you will also precipitate the piece of DNA that is attached to it.

Use a chemical method to remove the protein from the DNA Perform a PCR to extend the DNA, then sequence them and see that those specific pieces of DNA

interact with your activator. You get multiple sequences as a result; a computer will tell you where each specific sequence is

located. You hope to find that this sequence is located in the promoter region of a gene, letting you know that this specific activator (protein) regulates this specific gene.

10/30

Activators also recruit nucleosome modifiers that help the transcription machinery bind at the promoter

**Two types of nucleosome modifiers:

1. Histone acetyl transferases (HATs) [A] - Transfer acetyl groups

2. Those that remodel the nucleosomes (ATP-dependent activity of SWI/SNF) [B]

A: Activator will recruit the histone acetylase to interact with it. The conformation of the DNA wrapped around the nucleus is changed, making previously inaccessible promoters once again accessible and allowing for transcription to take place.

B: Activator once again recruits the remodeling complex which changes the structure of the nucleosome, allowing transcription to take place.

**It is believed that these types of modifications precede others because they make the DNA more accessible**

Some of the enhancer sequences that are recognized by activators (or repressors) can be many thousands of BP away. Other genes may be in the vicinity of an activator. To make sure that the right promoter is activated, the cell utilizes insulators.

Insulators: proteins “sit” on the DNA between an enhancer and the promoter; by doing so, they block the effects of the enhancer on an undesired promoter. This will allow for the enhancer to interact with the desired promoter.

Examples of Cooperativity

Signal Integration

The HO gene is controlled by two regulators; one recruits nucleosome. Modifiers and the other recruits mediator.

SWI5 is the activator; when it recruits the CRC and HA to the DNA promote,r they change structure of the DNA next to the promoter and allow the SBF factor to bind and initiate transcription

Signal Integration: Cooperative binding of activators at the human b-interferon gene. 3 regulators come together to form enhancer sequence + HMG that form brackets (Need all)

Combinatorial control lies at the heart of the complexity and diversity of eukaryotes.

Since there is only about 2000 regulatory proteins, and over 25000 genes to regulate, different combinations of the same proteins must be used to regulate each gene.

Transcriptional Repressors: **(ways in which Transcriptional Repressors work)**

1. Competition [a] – Overlapping binding sites of activator & repressor

2. Inhibiton [b] – when activator & repressor bind to adjacent sites, the repressor will push of the activator

3. Direct repression [c] – A repressor will interact with the mediator, sending a negative signal to the RNA Polymerase

4. Indirect repression [d] – A repressor will recruit a histone deacetylase (vs an Activator Histone Acetylase) that removes the acetyl groups, decreasing transcription.

Signal Transduction and the control of transcriptional regulators.

- Signals are often communicated to transcriptional regulators through signal transduction pathways.

STATs: Transcriptional regulators that are present in the cytoplasm when they are not activated. When phosphorylated, stats dimerize and travel to the nucleus and affect transcription.

Ras Pathway: most common pathway. A receptor is triggered by a signal molecule (usually growth factors – found in medium). Importance in Human Cancers: A single mutation makes Ras permanently active, even when growth factors are not present in the plasma membrane, causing uncontrolled growth.

Why so many steps in a cascade? Different receptors can feed onto pathway at different points. More steps = finer regulation = increased amplification

Imprinting

Some genes are only expressed if they are on the paternal chromosome. The maternal chromosome will translate the H19 gene because the insulator prevents the translation of other genes.

In the paternal chromosome, the insulator is not present and therefore the enhancer will activate the Igf2 gene.

This demonstrates that some proteins are only coded for by parent-specific chromosomes. (Mitochondria = Mother)

RNAs in gene regulation

Double-stranded RNA inhibits expression of genes homologous to that RNA

Short interfering RNAs (siRNAs) are produced from dsRNA and direct machinery that switches off genes in various ways. “After integration into the RISC, siRNAs base-pair to their target mRNA and induce cleavage of the mRNA, thereby preventing it from being used as a translation template.”

Possible end results:

Degradation (dsRNA is 100% homologous to cell DNA) Translation Inhibition (dsRNA partially homologous to cell DNA) Amplification – believed to occur b/c very few molecules of siRNA in the cell are able to inhibit

many hundreds of Translocation to nucleus – shut down gene translation

Signals Control the activities of eukaryotic transcriptional regulators in a variety of ways:

(ppt 2.0 not reviewed)

Gene “Silencing” by modification of histones and DNA. (ppt 2.0, not reviewed)

Silencing is a position effect; a gene is silenced because of where it is located, NOT in response to environmental signals.

Silencing can “spread” over large stretches of DNA, switching off multiple genes, even ones quite a distance from the initiating event.

END PCB2.0

11/4

Bioinformatics

DNA Chip Microarrays

Put a large number (~100K) of cDNA sequences or synthetic DNA oligomers onto a glass slide (or other subtrate) in known locations on a grid.

Label an RNA sample and hybridize Measure amounts of RNA bound to each square in the grid Make comparisons

- Cancerous vs. normal tissue

- Treated vs. untreated

- Time course

* Many applications in both basic and clinical research

What genes are expressed determines what each cell is and what it does. With DNA microarrays, you can compare, for example, cells from the liver and cells from a cancer.

“Scientists use DNA microarrays to measure the expression levels of large numbers of genes simultaneously or to genotype multiple regions of a genome.”

From lecture: Compare the expression of every single RNA that is present in the cell. Can compare cancer vs. normal cells. Treated vs. untreated (by a specific drug).

Each dot on grid is a particular gene. Any RNA that has come from that specific gene during translation can hybridize the gene (binding of the DNA by the complementary RNA). You label the cDNA (YOU MUST USE DNA b/c it is more stable than RNA) population with fluorescent dyes. A gene expressed only in normal cells will be one color; a gene expressed in cancer cells will be another color. You can have colors in between the two that give proportions of gene expression.

Use this method to find a protein that is made in cancer cells but not in normal cells so that they can be targeted

Single-nucleotide polymorphisms (SNPs) - the most common known variation in the human genome sequence.

Any two unrelated individuals differ by one base pair every 1000

These are referred to a single nucleotide polymorphisms (SNPs)

It is believed that SNPs are the cause of most common genetic disorders

Many SNPs have no effect on cell function

Some could predispose people to disease or influence drug response

SNPs must happen in at least 10% of the population (MUTATIONS = much less common)

t

a

10%of the alleles have this slightly different sequence:

Why do we care about SNPs?

93% of all annotated genes contain at least one SNP.

59% of human genes have five or more SNPs

39% have ten or more SNPs

Discover how SNPs can cause diseases

Examine how SNPs can affect medical therapies

Common Diseases

If we carry a particular set of SNPs, we can be predisposed to one common disorders with a genetic component such as diabetes, asthma or cancer

There are a number of classic “genetic diseases” caused by mutations of a single gene.

There are also many diseases that are the result of the interactions of many genes:Asthma, Heart Disease, Cancer

Each of these genes may be considered to be a risk factor for the disease.

Groups of SNP markers may be associated with a disease without determining mechanism

END PCB2.3.1

11/6

Ch18 - Gene Regulation during Development Humans have more than 200 different cell types, each of which has distinct programs of gene

expression. Simpler organisms, including some bacteria, can generate distinct cell types that contribute to

developmental events What differentiates them is the identity and amount of gene expression How do genetically identical cells establish different programs of gene expression?

Stem Cell: cell that is able to differentiate and make different kinds of cells

Adult stem cells are limited to how many different cells they can differentiate into. Compared to embryonic stem cells, from which any of the 200 cell types can be made.

Strategies for controlling developmental gene expression - Each of these events establishes asymmetry in gene expression which, in turn, leads to morphological asymmetry

mRNA localization

Cell-cell contact

Secretion of a signalingmolecule

mRNA Localization – mRNA is localized to one part of the cell. When the cell divides, most of this mRNA will go with only one of the daughter cells. Use actin/myosin filaments to localize. An adapter protein binds UTR and is bound by filament to be localized. Ex. Yeast Mating Type Switching

Cell-cell Contact - Cell-cell contact and secreted signaling molecules often act by promoting changes in the activity and/or localization of transcription factor. Signal tells cell WHAT PHENOTYPE TO BECOME

Secretion of a Signaling Molecule - Since many transcription factors exhibit cooperative binding to their DNA sites, a very small change in the active concentration of such transcription factors can lead to a situation in which a target gene goes from being not expressed to being fully expressed. CLOSER TO SOURCE, CONCENTRATION FO CHEMICALS/SIGNALS IS HIGHER, MORE RECEPTORS ARE ACTIVATED AND A STRONG SIGNAL IS TRASNMITTED = TRANSCRIPTION OF A LOT OF GENES WHICH DETERMINE THE FATE OF THE CELL.

Ex. Sonic Hedgehog

HO Gene: Changes mother cell from “a cell” to alpha

END PCB2.1

Ch19 - Comparative Genomics and Evolution of animal Diversity

- Most Animals have essentially the same genes.- Three ways gene expression has changed during evolution.- Genome evolution and human origins.

**Flattish round worm believed to be the common ancestor**

How does GENE DUPLICATION give rise to biological diversity? (Forms of evolution?)

How does increasing the number of copies of certain genes lead to increased morphological diversity?

1. Genes are created that encode related proteins with slightly different activities.

-If mutations occur in coding regions, the function of the new gene will be slightly different

2. Duplicated genes acquire new regulatory DNA sequences = different pattern of expression within the developing organism.

**Gene duplication events offer the opportunity to expand the repertoire of protein

Both forms of evolution are seen in the globin genes in mammals; e and g are used by the fetus which lacks functional lungs.

Three ways gene expression is changed during evolution:

1. A given pattern determining gene can itself be expressed in a new pattern. (Changes in expression pattern)

- This in turn will cause those genes whose expression it controls (target genes) to acquire new patterns of expression.

2. The regulatory protein encoded by a pattern determining gene can acquire new functions (Changes in function of encoded regulatory protein) e.g. an activator domain can be converted into a repression domain. [b]

3. Target genes of a given pattern determining gene can now acquire new regulatory DNA sequences and thus come under the control of a different regulatory gene (Changes in the enhancers that are recognized and regulated by pattern determining proteins.) Thus their pattern of expression is altered. [c] “Can have mutations occur in site of activator binding, leading to inability of activator to bind to DNA, turning the gene OFF”

Experimental manipulations that alter animal morphology.

Fruit flies expressing the squid Pax6 gene; eyes obtained in tissues where pax6 is expressed. 30% overall similarity between Drosophila and squid Pax6.

Genome Evolution and Human Origins

Humans contain surprisingly few genes. 25,000-30,000 protein coding genes Organismal complexity is not correlated with gene number, but instead depends on THE NUMBER

OF GENE EXPRESSION PATTERNS. The human genome is very similar to that of the mouse and virtually identical to the chimp; There

are few if any “new” genes in the humans that are completely absent in mice.

**FOXP2 fosters speech in humans

END PCB2.2