RESEARCH ARTICLE

Molecular Screening of SHH, ZIC2, SIX3, and TGIFGenes in Patients With Features of Holoprosence-phaly Spectrum: Mutation Review and Genotype–Phenotype Correlations

Christele Dubourg,1,4n Leıla Lazaro,2 Laurent Pasquier,2 Claude Bendavid,1,4 Martine Blayau,1

Franck Le Duff,3 Marie-Renee Durou,1 Sylvie Odent,2 and Veronique David1,4

1Laboratoire de Genetique Moleculaire, CHU Pontchaillou, Rennes, France; 2Unite de Genetique Medicale, Hopital Sud, Rennes, France;3Departement d’Informatique Medicale, CHU Pontchaillou, Rennes, France; 4UMR 6061, Faculte de Medecine, Rennes, France

Communicated by Mireille Caustres

Holoprosencephaly (HPE; 1 out of 16,000 live births; 1 out of 250 conceptuses) is a complex brainmalformation resulting from incomplete cleavage of the prosencephalon, affecting both the forebrain and theface. Clinical expressivity is variable, ranging from a single cerebral ventricle and cyclopia to clinicallyunaffected carriers in familial dominant autosomic HPE. The disease is genetically heterogeneous, butadditional environmental agents also contribute to the etiology of HPE. In our cohort of 200 patients, 34heterozygous mutations were identified, 24 of them being novel ones: 13 out of 17 in the Sonic hedgehog gene(SHH); 4 out of 7 in ZIC2; and 7 out of 8 in SIX3. The two mutations identified in TGIF have already beenreported. Novel phenotypes associated with a mutation have been described, such as abnormalities of thepituitary gland and corpus callosum, colobomatous microphthalmia, choanal aperture stenosis, and isolatedcleft lip. This study confirms the great genetic heterogeneity of the disease, the important phenotypic variabilityin HPE families, and the difficulty to establish genotype-phenotype correlations. Hum Mutat 24:43–51,2004. r 2004 Wiley-Liss, Inc.

KEY WORDS: holoprosencephaly; Sonic hedgehog; SHH; ZIC2; SIX3; TGIF; mutation analysis; genotype–phenotype

DATABASES:

SHH – OMIM: 600725; GenBank: NM_000193.2ZIC2 – OMIM: 603073; GenBank: AF104902.1SIX3 – OMIM: 603714; GenBank: NM_005413.1TGIF – OMIM: 602630; GenBank: NM_003244.2

INTRODUCTION

Holoprosencephaly (HPE; MIM# 236100) is a com-plex brain malformation in humans, due to precociousabnormal cleavage (between the 18th and the 28th dayof gestation). This developmental disorder involvesespecially the forebrain. In 1963, DeMyer and Zeman[1963] defined three ranges of increasing severity, fromthe lobar (or incomplete) form to the alobar (orcomplete) one. The intermediate degree is semilobarHPE. The brain malformation is generally accompaniedby facial anomalies and there is an inverse relationbetween the facial phenotype severity and life expec-tancy.

HPE has a live birth prevalence of 1 out of 16,000, butan incidence as high as 1 out of 250 in conceptuses. Theetiology is very heterogeneous. This pathology can bedue to environmental factors, metabolic factors (such asmaternal diabetes, which increases the risk of HPE to 1%

of pregnancy outcomes), maternal hypocholesterolemia,or alcoholism associated with smoking [Ming andMuenke, 2002]. HPE in humans has also been notedin association with prenatal exposure to drugs (retinoicacid, cholesterol biosynthesis inhibitors) or to infections.HPE can be due to chromosomal abnormalities, with ahigher prevalence observed in trisomy 13, trisomy 18,and triploidy. Analysis of recurrent chromosomal anoma-lies led to the identification of 12 candidate regions on

Received 14 October 2003; accepted revised manuscript 5 March2004.

nCorrespondence to: Christe' le Dubourg, Laboratoire de Ge¤ ne¤ tiqueMole¤ culaire, CHU Pontchaillou, 2 rue Henri Le Guilloux, 35033 Re-nnes Cedex, France. E-mail : christele.dubourg@chu-rennes.fr

Grant sponsor: GIS Intitut des Maladies Rares, COREC (CHU,Faculte¤ de Me¤ decine, Rennes).

DOI10.1002/humu.20056Published online inWiley InterScience (www.interscience.wiley.com).

rr2004 WILEY-LISS, INC.

HUMANMUTATION 24:43^51 (2004)

11 chromosomes that may contain genes involved inHPE. Moreover, holoprosencephaly can also be asso-ciated with several defined multiple malformationsyndromes having a normal karyotype (such as: Smith-Lemli-Opitz syndrome, MIM#270400; Pallister-Hallsyndrome, MIM# 146510; and Rubinstein-Taybi syn-drome, MIM# 180849). Finally, HPE may be a solitarymanifestation (neither chromosomal nor syndromic).Pedigrees have been described that report autosomaldominant (MIM# 142945), autosomal recessive (MIM#236100), and possibly X-linked (MIM# 306990) in-heritance. The penetrance in autosomal dominant HPEis estimated to be 80%. To date, eight genes have beenpositively implicated in HPE: Sonic hedgehog (SHH;MIM# 600725) isolated from the human critical regionHPE3 on chromosome 7q36 [Belloni et al., 1996;Roessler et al., 1996], ZIC2 (MIM# 603073; 13q32;HPE5) [Brown et al., 1998], SIX3 (MIM# 603714;2p21; HPE2) [Wallis et al., 1999], TGIF (MIM#602630; 18p11.3; HPE4) [Gripp et al., 2000],PATCHED1 (MIM# 601309; 9q22) [Ming et al.,2002], TDGF1/CRIPTO (MIM# 187395; 3p21.31)[De la Cruz et al., 2002], FAST1 (MIM# 603621;8q24) [Ouspenskaia et al., 2002], and GLI2 (MIM#165230; 2q24) [Roessler et al., 2003]. These genes wereidentified from recurrent chromosomal rearrangementsor by studying the SHH signaling pathway actors, asSHH was the first HPE gene described.

SHH plays a critical role in early forebrain and centralnervous system development. SHH is expressed in thehuman embryo in the notochord, the floorplate of theneural tube, the posterior limb buds, and the gut. TheSHH protein is a secreted intercellular signalingmolecule that is synthesized as a precursor that under-goes autocatalytic cleavage into N-terminal domain(SHH-N) and C-terminal domain (SHH-C). Duringthe autoprocessing reaction, a cholesterol moiety iscovalently attached to the C-terminus of SHH-N [Wallisand Muenke, 1999]. Shh mutant homozygous mousepresents with cyclopia and often dies during embryonicdevelopment, whereas the heterozygous mouse appearsnormal [Chiang et al., 1996].

The second gene identified is ZIC2, which encodes amember of the transcription factor family that includesthe Drosophila odd-paired gene (opa), and which containszinc finger DNA binding motifs very closely related tothat of the GLI proteins. ZIC2 plays a great function inneurulation; Zic2 knockdown mice show a strongholoprosencephaly phenotype in which the cerebralhemispheres are fused, and structures derived from thedorsal midline of forebrain are missing or reduced [Nagaiet al., 2000].

SIX3 is a homeobox-containing gene that is homo-logous to the Drosophila sine oculis gene. It is involved inhead midline and eye formation. Mice with reducedlevels of Six3 expression present a failure of forebrain andeye development [Carl et al., 2002].

TGIF (TG-interacting factor) is another homeodo-main transcription factor that inhibits signaling throughNodal/transforming growth factor beta (TGFb) pathways

by blocking the action of SMAD proteins. Moreover,TGIF is a repressor of retinoic acid regulated genetranscription. No studies of brain development in Tgifmutant mice have yet been reported.

Recently, mutations associated with HPE have beenfound in other genes selected as candidates due to theirparticipation in an important signaling pathway for braindevelopment: PATCHED1 and GLI2 in SHH signaling,and TDGF1/CRIPTO and FAST1 in the Nodal/TGFbpathway.

The severity of HPE requires genetic counseling,which is made difficult by the extreme phenotypicvariability, the genetic heterogeneity, and a high risk ofrecurrence (13%) in apparently sporadic cases [Odentet al., 1998]. To improve genetic counseling in thiscomplex disease, we performed mutational analysis of thefour main HPE genes (SHH, ZIC2, SIX3, and TGIF) in200 patients, and found 34 mutations, 24 of which werenovel ones.

FIGURE 1. Schematic representationof theSHHgeneandhumanmutations (A), and protein structure (B).The SHH gene is com-posed of three exons (A) encoding a polypeptide of 462 aminoacids (B), which is synthesized as a precursor molecule that un-dergoes cleavageof signal peptide and thenautoproteolyticclea-vage (mediated by cholesterol) intoN-terminal product (SHH-N)and C-terminal product (SHH-C). Reported mutations in theSHH gene are located on the cDNA.

FIGURE 2. Schematic representationof theZIC2 geneandhumanmutations.Translated gene regions are shownas openboxes andnontranslated regions as closed boxes.

44 DUBOURG ETAL.

MATERIALSANDMETHODSSample Collection

A total of 200 HPE patients (88 fetuses and 112 living children)with normal karyotype were studied. Out of these probands, 30%were familial cases, with a predominance of these familial cases inthe group of live-born children. Standard DNA extractionprotocols were followed for the processing of blood samples orestablished lymphoblastoid cell lines. All samples were obtainedafter informed consent was obtained, in accordance with theguidelines of our institutional review boards.

PCR and Denaturing High-Performance LiquidChromatographyAnalysis

Coding sequences of the SHH, ZIC2, SIX3, and TGIF genes(GenBank accession numbers: for SHH cDNA is NM_000193.2;for ZIC2 cDNA, AF104902.1; for SIX3 cDNA, NM_005413.1;and for TGIF cDNA, NM_003244.2) were amplified according tothe conditions described in Table 1. Heteroduplexes were formedby denaturing at 951C and cooling by 11C per minute. Denaturinghigh performance liquid chromatography (DHPLC) analysis wasperformed using the Transgenomic WAVE system (www.transgenomic.com), as described by Kuklin et al. [1998], except for theZIC-3B fragment, which was analyzed by systematic sequencing.Table 1 summarizes the D-HPLC conditions used.

DIRECT SEQUENCING

Samples showing abnormal D-HPLC profiles wereanalyzed by direct sequencing using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit

and the ABI 3100 Genetic Analyser (Applied Bio-systems, Foster City, CA). PCR-mediated enzymaticdigestion or PCR-mediated site-directed mutagenesis(PCR-SDM) was used to confirm the mutations and toscreen other samples.

Gene mutation nomenclature used in this articlefollows the recommendations of den Dunnen andAntonarakis [2001]. Gene symbols follow the recom-mendations of the HUGO Gene Nomenclature Com-mittee [Povey et al., 2001]. For cDNA numbering (c.),+1 corresponds to the A of the ATG translationinitiation codon, and for protein numbering (p.), +1corresponds to the initiator codon.

RESULTS

We found 34 mutations in our 200 patient cohort(allelic frequency 17%), 24 of them being novel ones(Table 2): 13 out of 17 in SHH; 4 out of 7 in ZIC2; 7 outof 8 in SIX3. The two mutations identified in TGIF havealready been reported.

Mutations in the SHHGene

A total of 17 mutations were noted in SHH (12 infamilial cases and five in sporadic cases): three nonsense;three deletions; and 11 missense ones (Fig.1).

Nonsense mutations. The first nonsense mutation,c.72C4A (p.Cys24X), was detected in a familialcontext. This transversion in exon 1 abolishes an AciIrestriction site. It leads to a very premature terminationof SHH translation.

The second nonsense mutation, c.388G4T(p.Glu130X), was found in a male proband presentingwith semilobar holoprosencephaly, facial dysmorphism(microcephaly, hypotelorism and median facial cleft), andrenal hypoplasia. The mutation was inherited from hisfather who had cleft lip. Investigation of the familyhistory revealed that the father’s sister had died from apolymalformative syndrome.

The remaining nonsense mutation is c.474C4G(p.Tyr158X), which was discovered in a familial context[Odent et al., 1999].

Deletions. The c.211delG mutation was detected in afemale presenting with semilobar holoprosencephaly,nasal pyriform aperture stenosis, hypotelorism, micro-cephaly, diabetes insipidus, mental retardation, andcerebellar hypoplasia. This mutation was inherited fromher father, who had hypotelorism only.

A deletion of six bases (c.316_321delTTGAAC)results in the absence of two amino acids in the SHHprotein (p.Leu106_Asn107del). It was detected in a maleproband with alobar holoprosencephaly and cerebellarhypoplasia.

A deletion of nine bases (GAGTCCAAG) from the526th nucleotide (c.526_534del) was detected in afemale who was microcephalic at birth; an ultrasoundscan showed that part of corpus callosum was missing.This mutation leads to the deletion of three amino acidsin the protein (p.Glu176_Lys178del).

FIGURE 3. Schematic representation of the SIX3 gene andhuman mutations. Functionally important domains (the SIXdomain and the homeodomain) are shown as closed boxes.

FIGURE 4. Schematic representationof theTGIF gene (A) and hu-manmutations in the protein (B).Translated exons are shown asclosed boxes and nontranslated exons as open boxes (A). RD-1,RD-2a, andRD-2b are repressiondomains, andHDcorrespondsto the homeodomain (B).

MUTATION REVIEW IN HOLOPROSENCEPHALY 45

Missense mutations. The mutations c.300G4C(p.Gln100His) and c.562G4C (p.Glu188Gln) weredetected in isolated HPE cases, and mutationc.664G4A (p.Asp222Asn) was detected in a familialcase [Odent et al., 1999].

A c.17G4C sequence change (p.Arg6Thr) wasobserved in a fetus terminated because of semilobarholoprosencephaly.

A c.329C4A transversion (p.Ala110Asp) was de-tected in a 3-year-old female with microcephaly, agenesisof the corpus callosum, diabetes insipidus, and unilateralcleft lip. She also has a minor urogenital malformation

and a moderate degree of developmental delay. Thismutation was inherited from her father, who presentsvery mild features of HPE spectrum; it destroys an EaeIrestriction site.

A c.449C4G (p.Thr150Arg) missense mutationin exon 2 was observed in a 10-year-old femalewith semilobar holoprosencephaly and diabetesinsipidus. This mutation creates a SexAI restrictionsite.

The five remaining missense mutations occur in exon3, which codes for the C-terminal domain of the SHHprotein.

TABLE 1. PCR andD-HPLCAnalysis Conditions for theCoding Sequences ofSHH, ZIC2, SIX3, andTGIF

FragmentPrimers sequence

50-30

Ampliconlength(bp)

MgCl2(mM)

Annealingtemp(1C)

Oven temp(1C)

% acetonitrilestart/end

Timeshift(sec)

SHH-1A F: cagccagcgagggagagagcgagcgggcgaR : tcttcgcgaaccccctgcccgg

242 4 65 66.567.5

55/5955/59

�0.50

SHH-1B F: ctggtatgctcgggactggcttR : taagtctggaagtgttcggcttctc

327 3 59/52 60.061.5

59/6358/62

�0.2�0.3

SHH-2A F: ggcaggctgatggaggggccgggaR : agacgtggtgatgtccactgcgcg

235 3 70 62.064.0

56/6055/59

�0.6�0.6

SHH-2B F: cactcagaggagtctctgcactacR : aagcagtcatgcccagcgaccctgc

293 3 71/64 61.064.067.0

57/6756/6653/63

0+0.2+1.3

SHH-3A F: caatgccctgtcctctcttcttR : ggtgagcagcaggcgctcgcgcg

281 3 60 66.068.0

55/6554/64

+0.5+0.7

SHH-3B F: gtgatcgagacgcgggagccgR : gctcggccaccacgtacacgc

202 3 66 71.0 53/60 0

SHH-3C+D F: gcccgggccagcgcgtgtacgtggR : cccctcccccggccccccggcttc

483 2 62 66.071.0

62/7256/63

�0.1+1.0

ZIC-1A F: agagcggctcccagggctgaagtgR : tgagcttgaaggctcccatgtgcg

331 3 65 69.070.5

58/6857/67

0+0.2

ZIC-1B F: gcaggaccgtgaactgR : ccagagtaggagccaacgtgcg

225 3 65 69.071.0

54/6454/58

00

ZIC-1C F: tcctactctgggccgcccttcaacR : attgctccgagcgcccgaacacct

262 2.5 65 67.570.0

56/6556/65

00

ZIC-1D F: cagagcagcacgggccgcacgR : tgggattgctcagttgctcggg

321 2 65 62.064.067.5

59/6358/6256/60

�0.50

+1ZIC-1E F: cagtgcatcaagcaggagctaatc

R : aaaaacacctcccatcccaggtcc452 3 65 59.0

61.065.0

62/7262/7259/69

�0.2�0.2+0.2

ZIC-2 F : gtttgccgtccacaggggagaagR : tggtaccttcatgtgcttccgcag

177 2 65 63.5 52/56 0

ZIC-3A F: ggggaacatttctgggggtgR : gggcgtggacgactcatagc

175 1.5 57 64.0 52/59 0

ZIC-3B F: cagctccggctatgagtcgtccacR : acccgtcacacgtaccattcattg

273 Advantages-GC 2 PCRKit(Clontech)

68/58 Not analyzedbyD-HPLC

Not analyzedbyD-HPLC

Not analyzedbyD-HPLC

SIX3-SIX domain

F : ggcccccccggaagagttgtccR : gcaacaggctccgagtccgct

452 4 65/56 62.565.067.0

62/7260/7059/69

�0.30

+0.3SIX3-homeodomain

F : aagttcccgctcccacgcaccR : gcgggccccgccactaac

239 4 62 65.5 54/64 +0.2

TGIF-1 F : tccagacccccgccttgcR : cagcccctcgtgttgtgt

257 2.5 66 63.565.067.0

56/6353/6053/60

000

TGIF-2 F : tcgctctcagttgttggR : tcacgctctctttcttta

361 3.5 56/50 58.060.0

59/6658/65

+0.1+0.2

TGIF-3A F: tctcagaacccgttggctR : gaccgactggcagagaga

393 3 60 61.061.5

56/6355/62

0+0.3

TGIF-3B F: gttttggctcgtccatcagtR : ccggcaatcatgacatttct

369 2.5 56 60 59/69 0

46 DUBOURG ETAL.

A c.812T4C transition (p.Leu271Pro) in exon 3 wasdetected in a male proband. This missense mutationcreates a BsrBI restriction site. The patient presents withhypotelorism, choanal stenosis, developmental delay,microcephaly (–4.3 SD), mental retardation, and lan-guage difficulties. He also had brachymetacarpy andclinodactyly of the fifth finger. His brother died fromholoprosencephaly with cleft lip and palate. Themutation is inherited from the mother, who had acolobomatous microphthalmia, epilepsy, mental retarda-tion, and brachymetacarpy.

A c.995T4C transition changes a valine to an alanine(p.Val332Ala) and abolishes an ApaLI restriction site.This mutation was detected in two unrelated patients.

The first patient is an Italian female who hasmicrocephaly, a flat face, hypotelorism, horizontalpalpebral fissures, flattened nose, depressed nasal bridge,depressed premaxillary region, abnormal and hypoplasticcolumella long philtrum, solitary median maxillary incisor

syndrome, and midnasal stenosis detected by a cranialcomputed tomography scan. Echocardiography showedpatent ductus arteriosus in this patient. The mutationwas not present in either of her parents.

The second patient with the c.995T4C mutation isfrom South Africa. He is small (less than third centile onall parameters), with a disproportionately small head. Hehas hypotelorism and hypoplastic nostrils. He is delayedwith low tone, but is progressing, and is crawling at 1 yearof age. He had a cleft palate, and computed tomographyshowed corpus callosum dysgenesis with colpocephaly.Parents have no obvious features, although the fatherpresents the c.995T4C mutation.

A c.1040C4A sequence change (p.Pro347Gln) wasdetected in three sibling male fetuses terminated becauseof holoprosencephaly; the mutation was inherited fromtheir father, who presented with hypotelorism and smallcranial perimeter only. This mutation creates an AluIrestriction site.

TABLE 2. Summary of SequenceVariations in SHH (n=17 Mutations), ZIC2 (n=7 Mutations Plus 2 Polymorphisms), SIX3 (n=8Mutations), andTGIF (n=2 Mutations) That Result inHoloprosencephaly SpectrumPhenotypen

Gene Exon /domain Mutation Predicted protein change Inheritance

SHH Exon1 c.17G4Ca p.Arg6Thr Maternalc.72C4Aa p.Cys24X Familialc.211delGa Frameshift Paternalc.300G4C p.Gln100His Sporadic

Exon 2 c.316_321delTTGAACa p.Leu106_Asn107del Sporadicc.329C4Aa p.Ala110Asp Paternalc.388G4Ta p.Glu130X Paternalc.449C4Ga p.Thr150Arg Sporadicc.474C4G p.Tyr158X Maternalc.526_534dela p.Glu176_Lys178del Maternalc.562G4C p.Glu188Gln Maternal

Exon 3 c.664G4A p.Asp222Asn Maternalc.812T4Ca p.Leu271Pro Maternalc.995T4Ca p.Val332Ala Sporadicc.1040C4Aa p.Pro347Gln Paternalc.1061T4Ca p.Ile354Thr Sporadicc.1142G4Ca p.Arg381Pro Maternal

ZIC2 Exon1 c.107A4Ca p.Gln36Pro Sporadicc.136C4Ta p.Gln46X Sporadicc.172G4Ta p.Gly58X Sporadicc.457_458GA4TT p.Asp153Phe Maternalc.718_720dela p.His239del ?c.718_720dupa p.His239dup ?c.811_812ins17a,b Frameshift Sporadicc.1028_1029delAA Frameshift Sporadic

Exon 2 c.1094_1095delAG Frameshift De novo

SIX3 SIX c.275T4Ga p.Val92Gly Maternaldomain c.313A4Ga p.Ile105Val Paternal

c.518A4Ca p.His173Pro Maternalc.556_557dup Frameshift Paternalc.542_576dupa Frameshift Paternalc.605C4Ta p.Thr202Ile Maternal

Homeo c.692C4Ga p.Pro231Arg ?domain c.769C4Ta p.Arg257Trp Paternal

TGIF Exon 2 c.177C4G p.Tyr59X PaternalExon 3 c.320A4T p.Gln107Leu Maternal

nZIC2 polymorphisms listed in italics. For cDNA numbering (c.), +1corresponds to theA of theATG translation initiation codon, and for protein num-bering (p.), +1 corresponds to the initiator codon. GenBank accession number for SHH cDNA is NM_000193.2, for ZIC2 cDNA: AF104902.1, for SIX3cDNA: NM_005413.1, and forTGIF cDNA: NM_003244.2.aIndicates novel mutations.b810_811ins17: the bases inserted are CTTTATGAGCCCCAAGA.

MUTATION REVIEW IN HOLOPROSENCEPHALY 47

Another missense mutation, c.1061T4C(p.Ile354Thr), was detected in a female fetus with alobarholoprosencephaly, arhinencephaly, coloboma and retinaldysplasia, cerebellum corpus hypoplasia, and renalhypoplasia.

A c.1142G4C transition in exon 3 results in thep.Arg381Pro missense mutation. This sequence changewas detected in a 1-year-old male with semilobarholoprosencephaly, cleft lip and palate, and cerebellumcorpus agenesis. We suspect that this mutation wasinherited from his mother (no DNA available).

Mutations in ZIC2 Gene

Seven mutations were noted in ZIC2(Fig. 2). Six ofthem are restricted to the first exon encoding the zinc-finger domain.

The c.457_458GA4TT (p.Asp153Phe) mutation andthe AG deletion at nucleotides 1094–1095(c.1094_1095delAG), creating a stop signal at codon366 have already been reported [Brown et al., 2001].

A 2-bp deletion (c.1028_1029delAA) creates a frame-shift leading to a stop signal at codon 365. This mutationwas identified in a female with semilobar holoprosence-phaly, but was not found in her parents.

A c.107A4C sequence change (p.Gln36Pro) wasdetected in the mother of a fetus who was terminatedbecause of semilobar holoprosencephaly. The motherherself presented with hypotelorism and a bad arrange-ment of the teeth. This mutation creates a RsrIIrestriction site.

Recently a c.136C4T transition leading to a stopcodon at codon 46 (p.Gln46X) was identified in a 12-year-old female with semilobar holoprosencephaly andpartial agenesis of the corpus callosum. The mutationwas not present in either of her parents.

A c.172G4T transversion (p.Gly58X) was identifiedin a fetus with semilobar holoprosencephaly. Thismutation creates a NspI restriction site.

An insertion of 17-bp (CTTTATGAGCCCCAAGA)in the terminus of the first exon (c.811_812ins17) wasdetected in a fetus terminated because of semilobarholoprosencephaly detected by MRI. With her firsthusband, the mother had a child with alobar holopro-sencephaly who died on the fifth day of life, but she doesnot present the insertion. In this case, however, thismutation was searched by the reference method (DNAsequencing), so this suggests a germinal mosaicism.

We observed a lack of one histidine (c.718_720del)within a tract of nine histidines in one patient [Brownet al., 2001], and an addition of one histidine(c.718_720dup) in another. Since the mouse Zic2 genehas eight histidines, we are unsure of their significance,even though Brown et al. [2002] did find some evidenceof a possible association between this histidine tractpolymorphism and neural tube defects.

Mutations in SIX3 Gene

Eight mutations were noted in SIX3: one GG insertioncreating a frameshift and leading to a nonsense mutation

downstream in the homeodomain (c.556_557dup)[Pasquier et al., 2000]; one duplication; four missensemutations that occur in the SIX domain; and twomissense ones in the homeodomain (Fig. 3).

A 35-bp duplication in the SIX domain(c.542_576dup) leads to a stop codon 58 amino acidsdownstream in the homeodomain. It was detected in thecontext of a precocious termination of pregnancybecause of alobar HPE, as showed by an ultrasonographicscan. Fetopathological examination demonstrated sy-nophthalmy and 11 bilateral ribs. This duplication wasinherited from the father, who has no features ofholoprosencephaly spectrum.

A c.275T4G sequence change (p.Val92Gly) wasidentified in a female with semilobar holoprosencephaly,cleft lip palate, and motor and mental retardation. Thistransversion creates a NlaIV restriction site.

A c.313A4G (p.Ile105Val) mutation was detected ina second fetus who presented with hydrocephaly andoccipital meningocele, macrocephaly, and hypertelorism.This mutation creates a HpyCH4IV restriction site and,interestingly, it was not found in the first fetus presentingwith anencephaly.

A c.518A4C (p.His173Pro) sequence change wasdetected in a female proband with semilobar holopro-sencephaly. Her mother and her aunt, though phenoty-pically normal, have also this mutation. However, heraunt has had three babies with severe holoprosencephaly,two of which were terminated and the third pregnancyresulted in a miscarriage. This c.518A4C transversioncreates a HaeII restriction site.

A c.605C4T (p.Thr202Ile) mutation was detected ina female with semilobar holoprosencephaly, and cleft lip-palate and nostril. Her mother presents the samesequence change, but does not show any feature ofHPE spectrum. This c.605C4T transition creates aSfaNI restriction site.

The two last missense mutations reside in thehomeodomain.

The first one, c.692C4G (p.Pro231Arg), was ob-served in an aborted fetus with HPE and median cleftpalate. The mutation was not inherited from mother; noDNA sample was available from the father.

The other, c.769C4T, consists of an arginine totryptophan change (p.Arg257Trp) and was found in afamilial context with two pregnancy terminationsbecause of alobar HPE. This missense mutation wasinherited from the father, who had no features of theHPE spectrum.

Most of these mutations in SIX3 are localized in theSIX domain, although the first ones described implicatedthe homeodomain exclusively.

Mutations inTGIFGene

Two mutations have been detected in TGIF (Fig. 4).The first one is a nonsense mutation (p.Tyr59X)

caused by a c.177C4G transversion [Aguilella et al.,2003]. This mutation creates a BsmI restriction site. Itwas detected in a female fetus after the observation of

48 DUBOURG ETAL.

semilobar holoprosencephaly with microcephaly, hypote-lorism, and cebocephaly. The same mutation was foundin her father, who presented with mild hypotelorism anda lateral cleft lip.

The second mutation, c.320A4T, consists of aglutamine-to-leucine change (p.Gln107Leu), and wasdetected in a 35-year-old woman with microcephaly, cleftlip and palate, and mild mental retardation [Aguilellaet al., 2003]. She had a daughter who died fromholoprosencephaly before the age of 2 years, but nosample was available for her.

DISCUSSION

The analysis of the four genes (SHH, ZIC2, SIX3, andTGIF) in 200 patients with holoprosencephaly led us toidentify 34 heterozygous sequence variations. Mutationsin these genes, therefore, have been identified in 17% ofthe HPE cases in our cohort of patients with normalkaryotype. Surprisingly, a higher percentage of mutationswas found in living children (20.5%), than in fetuses(12.5%). Half of these mutations have been found in theSHH gene, which appears to be the main causal geneimplicated in holoprosencephaly (8.5% of cases) to date.Mutations in ZIC2, SIX3, and TGIF represent, 21, 23,and 6% of the known mutations, respectively, and 3.5, 4,and 1% of HPE cases. These data suggest that TGIF maybe implicated in only a very small proportion of all HPEcases. No hotspot of mutation exists in these genes, andall kinds of mutations have been found: nonsense,missense, and frameshift ones.

This study confirms the great phenotypic variability inHPE: members of the same family with the implicatedmutation can present either minor features of holopro-sencephaly spectrum (hypotelorism, solitary medianmaxillary incisor), or severe malformations that oftenlead to pregnancy termination after ultrasound scandetection. Genotype–phenotype correlations are there-fore difficult to perform, in spite of the size of our cohort.

However, this study has allowed us to outline a fewconcepts that may help genetic testing trends. Mutationsof the SHH gene have been found predominantly insubjects with choanal stenosis, cerebellar hypoplasia, andpituitary gland anomalies. Several reports have impli-cated SHH, not only in the development of cerebellum[Dahmane et al., 1999; Traiffort et al., 1999; Wallace,1999], but also in the proliferation and differentiation ofhypophyseal cells [Treier et al., 2001]. Ophthalmologicalmalformations are preferentially associated with SHHand SIX3 mutations. Unlike SHH, SIX3, and TGIFgenes, ZIC2 is more often implicated in patients withonly a few facial anomalies. Particular phenotypes besidesthe classical HPE spectrum have been revealed to beassociated with mutations of SHH, ZIC2, or SIX3 genesby this study. For example, we found a missense mutationof SIX3 (c.275T4G) in an atelencephaly phenotype.The observation of HPE and atelencephaly in the samefamily demonstrates a continuum in forebrain anomaliesthat are not easy to differentiate. Moreover, we haveidentified a nonsense mutation of SHH (c.474C4G) in asubject with choanal stenosis, leading us to search forSHH mutations in a cohort of patients with this feature.In other respects, concomitant neural tube malforma-tions (spina bifida, anencephaly) and HPE have beenpreviously described [Lemire et al., 1981]. In our cohort,we report an exceptional case of monozygous twins, onewith semilobar HPE and the other with anencephaly andfacial cleft. We have found a de novo mutation of ZIC2(c.1094_1095delAG) in the living twin and we assumethat his monozygous twin had the same mutation, asanencephaly is another expression of cerebral develop-ment disorder. Associations between HPE and ophthal-mologic malformations have been noted: 19 patientspresented with microphthalmia, anophthalmia, cataract,or coloboma. Three out of these 19 patients had anSHH mutation, and one of them had a SIX3 sequencechange. Moreover, in one case, colobomatous micro-phthalmia was the reason for the consultation. Thusanalysis of HPE genes can be extended to craniocerebral

FIGURE 5. Pedigree of the family with the c.211delGmutation in the SHH gene. M (mutated), mutation carrier; N, no c.211delGmuta-tion. Filled symbols indicate typical cases of HPE; partially ¢lled symbols indicate minor manifestations of the HPE spectrum. I1,solitary median maxillary incisive, choanal stenosis; II3, solitary median maxillary incisive, choanal stenosis; II5, hypotelorism,microcephaly; III, choanal stenosis, microcephaly, hypotelorism, mental retardation; III3, choanal stenosis, microcephaly, hypotel-orism, mental retardation.

MUTATION REVIEW IN HOLOPROSENCEPHALY 49

malformations that do not belong to the classicalspectrum of HPE.

A particular mutation may lead to different pheno-types in the same family. As shown in Figure 5, thec.211delG mutation in the SHH gene is associated withtypical cases of HPE (mental retardation), or with minoror atypical manifestations (hypotelorism, solitary medianmaxillary incisive, choanal stenosis). This phenotypicvariability may be due both to environmental factors andto potential modifier genes. For example, maternalhypocholesterolemia during pregnancy increases the riskof HPE in the offspring. Moreover, the phenotype may bemodulated by mutation in another gene; even though wehave not found double heterozygotes in our cohort,mutations in both SHH and ZIC2 or in SHH and TGIFhave already been described [Nanni et al., 1999]. HPEdevelopment must be a multihit process, which im-plicates more genes; this illustrates the importance offurther identification of new genes, particularly since wehave not identified the mutations in 83% of HPE cases,although the sensitivity and specificity of DHPLC exceed96%. Thus, a number of other genes are likely to beinvolved in HPE. As a result of the clinical and geneticheterogeneity of HPE, and the lack of informativefamilies, a conventional positional cloning strategy basedon a genome-wide scan is not possible. However, acytogenetic-based strategy may be considered, sinceadditional candidate genes would include those thatmap to a chromosomal region in which rearrangementsare associated with HPE.

ACKNOWLEDGMENTS

We thank all our colleagues who referred cases, andthe patients and their families for generously participat-ing in this study. We are grateful to Phillip Jordan forrevising the English text.

REFERENCES

Aguilella C, Dubourg C, Attia-Sobol J, Vigneron J, Blayau M,Pasquier L, Lazaro L, Odent S, David V. 2003. Molecularscreening of the TGIF gene in holoprosencephaly: identificationof two novel mutations. Hum Genet 112:131–134.

Belloni E, Muenke M, Roessler E, Traverso G, Siegel-Bartelt J,Frumkin A, Mitchell HF, Donis-Keller H, Helms C, Hing AV,Heng HHQ, Koop B, Martindale D, Rommens JM, Tsui LC,Scherer SW. 1996. Identification of Sonic hedgehog as a candidategene responsible for holoprosencephaly. Nat Genet 14:353–356.

Bertolino E, Wildt S, Richards G, Clerc RG. 1996. Expression of anovel murine homeobox gene in the developing cerebellarexternal granular layer during its proliferation. Dev Dyn205:410–420.

Brown LY, Odent S, David V, Blayau M, Dubourg C, Apacik C,Delgado MA, Hall BD, Reynolds JF, Sommer A, Wieczorek D,Brown SA, Muenke M. 2001. Holoprosencephaly due tomutations in ZIC2; alanine tract expansion mutations may becaused by parental somatic recombination. Hum Mol Genet10:791–796.

Brown LY, Hodge SE, Johnson WG, Guy SG, Nye JS, Brown S.

2002. Possible association of NTDs with a polyhistidine tractpolymorphism in the ZIC2 gene.

Brown SA, Warburton D, Brown LY, Yu CY, Roeder ER, Stengel-

Rutkowski S, Hennekam RC, Muenke M. 1998. Holoprosence-phaly due to mutations in ZIC2, a homologue of Drosophilaodd-paired. Nat Genet 20:180–183.

Carl M, Loosli F, Wittbrodt J. 2002. Six3 inactivation reveals itsessential role for the formation and patterning of the vertebrateeye. Development 129:4057–4063.

Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H,Beachy PA. 1996. Cyclopia and defective axial patterningin mice lacking Sonic hedgehog gene function. Nature 383:

407–413.Dahmane N, Ruiz i Altaba A. 1999. Sonic hedgehog regulates the

growth and patterning of the cerebellum. Development

126:3089–3100.De la Cruz JM, Bamford RN, Burdine RD, Roessler E, Barkovich

AJ, Donnai D, Schier AF, Muenke M. 2002. A loss-of-function

mutation in the CFC domain of TDGF1 is associated withhuman forebrain defects. Hum Genet 110:422–428.

DeMyer W, Zeman W. 1963. Alobar holoprosencephaly (arhinen-cephaly) with median cleft lip and palate: clinical, electro-encephalographic and nosologic considerations. Confin Neurol

23:1–36.den Dunnen JT, Antonarakis SE. 2001. Nomenclature for the

description of human sequence variations. Hum Genet

109:121–124.Gripp KW, Wotton D, Edwards MC, Roessler E, Ades L, Meinecke

P, Richieri-Costa A, Zackai EH, Massague J, Muenke M, Elledge

SJ. 2000. Mutations in TGIF cause holoprosencephaly and linkNODAL signalling to human neural axis determination. NatGenet 25:205–208.

Kuklin A, Munson K, Gjerde D, Haefele R, Taylor P. 1998.Detection of single nucleotide polymorphisms with the WAVEDNA fragment analysis system. Genet Test 1:201–206.

Lemire RJ, Cohen MM Jr, Beckwith JB, Kokich VG, Siebert JR.1981. The facial features of holoprosencephaly in anencephalichuman specimens. Teratology 23:297–303.

Ming JE, Muenke M. 2002. Multiple hits during early embryonicdevelopment: digenic diseases and holoprosencephaly. Am JHum Genet 71:1017–1032.

Ming JE, Kaupas ME, Roessler E, Brunner HG, Golabi M, TekinM, Stratton RF, Sujansky E, Bale SJ, Muenke M. 2002.Mutations in PATCHED-1, the receptor for SONIC HEDGE-

HOG, are associated with holoprosencephaly. Hum Genet110:297–301.

Nagai T, Aruga J, Minowa O, Sugimoto T, Ohno Y, Noda T,

Mikoshiba K. 2000. Zic2 regulates the kinetics of neurulation.Proc Natl Acad Sci USA 97:1618–1623.

Nanni L, Ming JE, Bocian M, Steinhaus K, Bianchi DW, de Die-Smulders C, Giannotti A, Imaizumi K, Jones KL, del Campo M,Martin RA, Meinecke P, Pierpont MEM, Robin NH, Young ID,

Roessler E, Muenke M. 1999. The mutational spectrum of theSonic hedgehog gene in holoprosencephaly: SHH mutations causea significant proportion of autosomal dominant holoprosence-

phaly. Hum Mol Genet 8:2479–2488.Odent S, Le Marec B, Munnich A, Le Merrer M, Bonaiti-Pellie C.

1998. Segregation analysis in nonsyndromic holoprosencephaly.

Am J Hum Genet 77:139–143.Odent S, Attie-Bitach T, Blayau M, Mathieu M, Auge J, Delezoıde

AL, Le Gall JY, Le Marec B, Munnich A, David V, Vekemans M.

50 DUBOURG ETAL.

1999. Expression of the Sonic hedgehog (SHH) gene during earlydevelopment and phenotypic expression of new mutationscausing holoprosencephaly. Hum Mol Genet 8:1683–1689.

Ouspenskaia MV, Karkera JD, Roessler E, Shen MM, GoldmuntsE, Bowers P, Towbin J, Belmont J, Muenke M. 2002. Role ofFAST1 gene in the development of holoprosencephaly (HPE)and congenital cardiac malformations in humans. Am J HumGenet 71(Suppl):313.

Pasquier L, Dubourg C, Blayau M, Lazaro L, Le Marec B, David V,Odent S. 2000. A new mutation in the six-domain of Six3 genecauses holoprosencephaly. Eur J Hum Genet 8:797–800.

Povey S, Lovering R, Bruford E, Wright M, Lush M, Wain H. 2001.The HUGO Gene Nomenclature Committee (HGNC). HumGenet 109:678–680.

Roessler E, Belloni E, Gaudenz K, Jay P, Berta P, Scherer SW, TsuiLC, Muenke M. 1996. Mutations in the human Sonic hedgehoggene cause holoprosencephaly. Nat Genet 14:357–360.

Roessler E, Du YZ, Mullor JL, Casas E, Allen WP, Gillessen-Kaesbach G, Roeder ER, Ming JE, Ruiz i Altaba A, Muenke M.2003. Loss-of-function mutations in the human GLI2 gene areassociated with pituitary anomalies and holoprosencephaly-likefeatures. Proc Natl Acad Sci USA 100:13424–13429.

Sampath K, Rubinstein AL, Cheng AM, Liang FO, Fekany K,Solnica-Krezel L, Korzh V, Halpern ME, Wright CV. 1998.

Induction of the zebrafish ventral brain and floorplate requirescyclops/nodal signalling. Nature 395:185–189.

Sulik KK, Dehart DB, Rogers JM, Chernoff N. 1995. Teratogeni-city of low doses of all-trans retinoic acid in presomite mouseembryos. Teratology 54:398–403.

Traiffort E, Charytoniuk D, Watroba L, Faure H, Sales N, Ruat M.1999. Discrete localisations of hedgehog signalling componentsin the developing and adult rat nervous system. Eur J Neurosci11:3199–3214.

Treier M, O’Connel S, Gleiberman A, Price J, Szeto DP, Burgess R,Chuang PT, McMahon AP, Rosenfeld MG. 2001. Hedgehogsignaling is required for pituitary gland development. Develop-ment 128:377–386.

Wallace VA. 1999. Purkinje-cell-derived Sonic hedgehog regulatesgranule neuron precursor cell proliferation in the developingmouse cerebellum. Curr Biol 9:445–448.

Wallis DE, Muenke M. 1999. Molecular mechanisms of holopro-sencephaly. Mol Genet Metab 68:126–138.

Wallis DE, Roessler E, Hehr U, Nanni L, Wiltshire T, Richieri-Costa A, Gillessen-Kaesbach G, Zackai EH, Rommens J, MuenkeM. 1999. Mutations in the homeodomain of the human SIX3gene cause holoprosencephaly. Nat Genet 22:196–198.

Wotton D, Lo RS, Lee S, Massague J. 1999. A Smad transcrip-tional corepressor. Cell 97:29–39.

MUTATION REVIEW IN HOLOPROSENCEPHALY 51