Embed Size (px)
Citation preview
Molecular investigation of macrolide and Tetracyclineresistances in oral bacteria isolated from Tunisian children
Bochra Kouidhi a,*, Tarek Zmantar a, Hajer Hentati c, Fayrouz Najjari c,Kacem Mahdouni b, Amina Bakhrouf a
a Laboratoire d’Analyses, Traitement et Valorisation des Polluants de l’Environnement et des Produits, Faculte de Pharmacie de Monastir,
Biologie Clinique, Rue Avicenne, 5000 Monastir, Tunisieb Laboratoire de Biologie moleculaire, Hopital Regionale de Kairouan, TunisiecService de Medecine et chirurgie buccales Clinique hospitalo-universitaire d’Odontologie, Monastir, Tunisie
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5
a r t i c l e i n f o
Article history:
Accepted 13 September 2010
Keywords:
Caries
Streptococci
Antibiotic susceptibility
Resistance genes
a b s t r a c t
Objective: This study aims to investigate the antibiotic susceptibility of strains isolated from
the oral cavity of Tunisian children.
Design: Strains were isolated from the oral cavity of Tunisian children (60 caries-actives and
30 caries-free). Molecular characterization was assessed by PCR assay to detect erythromy-
cin methylase gene (ermB), macrolide efflux (mefI) and tetracycline resistance genes (tetM
and tetO).
Results: A total of 21 species were isolated and identified. Antimicrobial susceptibility
revealed that the resistance rate to antibiotics was as follow: erythromycin (22%), tetracy-
cline (15.6%), cefotaxim, (7.3%), trimethoprim-sulfamethoxazol (37.6%), nitrofurantoine
(2.8%), pristinamycin (17.4%), quinupristin-dalfopristin (15.6%), and rifampicin (3.7%). The
majority of mefI positive strains (31.2%) were isolated from the carious children (n = 34) in
comparison with 8.25% from the control group (n = 9). In addition, frequency of strains
caring resistance genes were as follow: 12.84% for ermB, 9.17% for tetM and 27.52% for tetO
from the carious children in comparison to 0.092%, 3.67% and 3.67% from the caries free
group respectively.
Conclusion: Multi-resistance strains towards macrolides and tetracycline were recorded.
The majority of strains carrying antibiotics resistance genes were isolated from the caries
active children. The presence of multi-resistant bacteria in the oral cavity can be the major
cause of antibiotic prophylaxis failure in dental practise.
# 2010 Elsevier Ltd. All rights reserved.
avai lab le at www.sc iencedi rec t .com
journal homepage: http://www.elsevier.com/locate/aob
1. Introduction
Dental caries is one of the most important causes of oral
infections not only in dentistry but also in medicine. Oral
streptococci associated with dental caries have long been
considered as significant pathogenic agents in dental caries,1
for which they represent the most frequent causative
agent.2,3 Indeed, their clinical importance includes acting
* Corresponding author. Tel.: +216 99225866.E-mail address: [email protected] (B. Kouidhi).
0003–9969/$ – see front matter # 2010 Elsevier Ltd. All rights reservedoi:10.1016/j.archoralbio.2010.09.010
as causative agents in infective endocarditis, cardiovascular
diseases and bacterial pneumonia which often take place
after some sort of dental procedure.4 More importantly,
oral infections can lead with the introduction of oral
microorganisms into the bloodstream system.5 In addition,
oral streptococci play a significant role as a reservoir of
antimicrobial resistance genes transferable to more patho-
genic organisms.6
d.
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5128
The antibiotic prophylaxis contributes in the spread of
resistant streptococci. The most frequent antibiotic prescribed
for dental and oral infection was penicillin V (60% of total
prescriptions); erythromycin (14%), amoxicillin (12%) and
metronidazole (8%). Tetracycline are used infrequently in
dental practise because of the side-effects associated with this
family of drugs, which can affect tooth colour.7 However,
association of tetracycline resistance with penicillin and
erythromycin resistance makes it potentially dangerous and
may facilitate the dissemination of other resistance determi-
nants.8
Resistance to erythromycin is most commonly due to the
acquisition of erm genes which codes for rRNA methylases.
Other mechanisms by which bacteria express macrolide
resistance include drug inactivation by an enzyme encoded
by mph, and efflux of macrolides by an ATP-binding
transporter encoded by msrA.9 Low-level macrolide resistance
in the oral flora may also be associated with the expression of
genes in the mef family, encoding another efflux pump.10
Two mechanisms of resistance against tetracycline have
been described in enterococci: an efflux-mediated mechanism
encoded by tet(K) or tet(L) genes and ribosomal protection
mediated by tet(M), tet(O), or tet(S) genes.11 The erm(B) gene is
frequently linked with the tet(M) gene on the highly mobile
conjugative transposon Tn1545, which predominates in
clinically important Gramme-positive bacteria.12,13 Macrolide
and glycopeptide resistance genes have also been described on
the same transferable genetic element in Enterococcus faecium
from pigs and humans.14
Cells within a biofilm has been shown to be conducive to
gene transfer.15 The most extensively studied group of
conjugative transposons are those of the Tn916 family,16
which usually encode tetracycline resistance which is
transferable in vitro biofilm models 17 and in vivo mouse
gastrointestinal tracts.18 In a recent study, it has been shown
that Veillonella dispar transfers in oral biofilms Tn916 to
Streptococcus spp. Furthermore, its DNA can transform Strepto-
coccus mitis to tetracycline resistance strains.19
The different patterns of susceptibility to a number of
antibiotics 20 make it necessary to increase our knowledge of
the activity of antibiotics on oral streptococci.
The objective of this study was to determine the prevalence
of antibiotic susceptibility and the distribution of erythromy-
cin resistance gene (ermB), the macrolide efflux (mefI) and
tetracycline resistance genes (tetM, tetO) in oral bacteria
including streptococci and enterococci isolated from Tunisian
children.
2. Material and methods
2.1. Patients and bacterial strains
The study was done on 90 children (60 subjects and 30
controls) from dental clinic of Monastir, Tunisia from July 2008
to January 2009. The age group selected for the present study
was about 4–12 years. Ethical clearance was taken prior to the
commencement of study. Written informed consent was
obtained from the parents of all participants. All clinical
procedures were approved by the Ethical Committee of the
Faculty of Medicine, University of Monastir, Tunisia. A detailed
medical and dental history was obtained from each parent.
The criteria for inclusion were: no antibiotic treatment
during the 4 weeks previous to sampling, no use of mouth
rinses or any other preventive measure that might involve
exposure to antimicrobial agents and no systemic disease. The
dental caries was determined by a calibrated dentist using
WHO criteria.
Samples were taken from the oral cavity of each patient
(one of dental caries, and one of plaque) with a steril swab.
After incubation in brain heart infusion (BHI) during 24 h the
swab were plated on 5% defibrinated sheep’s blood agar plates.
Plates were incubated for 48 h at 37 8C in an atmosphere
containing 10% CO2. Identification of streptococci was based
on their colony morphology and confirmed by biochemical
tests.
Isolated strains were identified with Api 20 Strep strips
(bioMerieux, France) according to the manufacturer’s recom-
mendations. The results were read with a microbiological
mini-Api automate (Biomerieux, Fance).
2.2. Antimicrobial susceptibility testing
The inoculum was standardized to 0.5 McFarland with a
densimat (Bio-Merieux, Ltd., France). Antimicrobial suscepti-
bility was tested using the ATB Strep strips (Bio-Merieux, Ltd.,
France) which contain a range of 18 antibiotics: penicillin
(PEN), amoxicillin (AMO), ampicillin enterococcus (AMPE),
cefotaxim, (CTX), kanamycin HC (KAH), gentamycin HC (GEH),
tetracycline (TET), trimethoprim-sulfamethoxazol (TSU),
erythromycin (ERY), nitrofurantoine (FUR), telithromycin
(Tel), pristinamycin (PRI), quinupristin-dalfopristin (QDA),
levofloxacin streptococcus (LVXS), vancomycin (VAN), teico-
planin (TEC), rifampicin (RFA), and linezolid (LNZ).
The results were interpreted with a mini-Api automate
(Bio-Merieux, Ltd., France) according to the published guide-
lines of the manufactures.
2.3. Detection of resistance genotypes by PCR
The presence of genes encoding antibiotics resistance (ermB,
mef, tetM, and tetO), was examined in all isolated strains using
specific primers as shown in Table 1.
We used a duplex PCR technique to amplify ermB, and mefI21 and a PCR assay to amplify tetM and tetO genes in the tested
strains as described by Perez-Trallero et al. 22
Chromosomal DNA was extracted using a Wizard Genomic
purification Kit (Promega, USA), 60 ml of lysozyme at 0.1 mg/l
(Sigma) was added to the cell lysate. Negative PCR control
without the bacterial DNA was included with each PCR reaction.
Duplex PCR assays were performed in 25 ml PCR containing
1 U of GO Taq DNA polymerase (Promega, Lyon, France), 5 ml
green Go Taq buffer (5�), 25 pM each forward and reverse
primers of ermB and mefI gene, 100 mM concentrations (each)
of the four dNTPs and DNA template (50 ng). The PCR mixtures
were subjected to thermal cycling conditions presented in
Table 1 with a Gene Amp PCR System 9700 (Applied
Biosystems Int, USA).
In the PCR assay, mixture was prepared as previously
described and 25 pM of forward and reverse primers of tetM or
Table 1 – List of primers used for the detection of antibiotics resistances genes.
Genes Primers 5–3 Product size (bp) PCR conditions References
ermB GAAAAGGTACTCAACCAAATA 639 94 8C, 30S; 52 8C, 30S; 72 8C, 60S 21
AGTAACGGTACTTAAATTGTTTAC
mefI ATGGAAAAATACAACAATTGGAAA 263
CCAGCTGCTGCGATAATTAA
tetM AGTTTTAGCTCATGTTGATG 1862 94 8C, 30S 22
TCCGACTATTTGGACGACGG 58 8C, 45S
72 8C, 45S
tetO GCGGAACATTGCATTTGAGGG 538 94 8C, 30S
CTCTATGGACAACCCGACAGAAG 53 8C, 30S
72 8C, 30S
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5 129
tetO genes were used separately. Ten microliter of PCR product
were resolved on a 2% agarose gel containing ethidium
bromide (0.5 mg/ml) in Tris-borate-EDTA buffer (89 mM Tris,
89 mM boric acid, 2 mM EDTA) at 90 V for 1 h which was
visualized under UV transillumination and photographed
using Gel Doc XR apparatus (Bio-rad, USA).
Table 2 – Correlation between erythromycin susceptibility tesantibiotic resistance genes (ermB and mefI) in oral streptococc
Species identification (number of strains) Erya
Streptococcus mutans (n = 13) I
R
S
Streptococcus oralis (n = 13) I
R
S
Enterococcus faecalis (n = 12) I
R
S
Streptococcus constellatus (n = 11) R
S
Streptococcus mitis (n = 10) S
Streptococcus salivarius ssp. salivarius (n = 9) R
S
Streptococcus pyogenes (n = 5) R
S
Gemella morbillorum (n = 5) I
S
Enterococcus faecium (n = 5) R
S
Gemella haemolysans (n = 4) I
S
Streptococcus anginosus (n = 4) R
S
Streptococcus sanguis (n = 3) S
Lactococcus lactis ssp. cremoris (n = 3) S
Streptococcus uberis (n = 2) R
Streptococcus bovis (n = 2) S
Aerococcus viridans (n = 2) S
Lactococcus lactis ssp lactis (n = 2) S
Leuconostoc spp. (n = 1) S
Streptococcus pneumoniae (n = 1) R
Streptococcus equinus (n = 1) S
Enterococcus avium (n = 1) S
(–) Absence of gene.a Erythromycin susceptibility (ATB Strep).b Numbers of strains.c Numbers of strains carrying the ermB or the mefI gene.
3. Statistical analysis
Statistical analysis was performed on SPSS v.17.0 statistics
software. Pearson’s chi-square x2 test was used to assess inter-
group significance. In addition Statistical significance was set
at P < 0.05.
ting (ATB Strep) and the presence of clinically relevanti.
Nb ermBc mefIc
1 – –
2 2 –
10 2 4
1 – 1
4 1 3
8 1 4
1 – 1
2 – –
9 – –
1 – 1
10 3 3
10 2 6
2 1 2
7 – 2
3 – 1
2 – 1
1 – 1
4 – 2
4 – 1
1 – –
2 – 2
2 – 1
3 2 2
1 – 1
3 – 1
3 – 2
2 – 1
2 1 –
2 – –
2 – –
1 – –
1 – –
1 – –
1 – –
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5130
4. Results
4.1. Biochemical characterization and antibioticsusceptibility
109 strains were isolated and identified by the Api 20 Strep
system. As presented in Table 2, the most isolated strains were
Streptococcus mutans (n = 13), Streptococcus oralis (n = 13), Entero-
coccus faecalis (n = 12), Streptococcus constellatus (n = 11), S. mitis
(n = 10) and Streptococcus salivarius ssp. salivarius (n = 9). In
addition 15 various species which may be implicated in dental
caries such as Streptococcus sanguis (n = 3), Lactococcus lactis ssp.
lactis (n = 2), Lactococcus lactis ssp. cremoris (n = 3) were identified.
The antibiotic susceptibility test revealed the presence of
multi-resistant strains towards the 18 previously cited anti-
biotics. Amongst the 109 strains, resistance was detected to
erythromycin (22%), tetracycline (15.6%), cefotaxim, (7.3%),
trimethoprim-sulfamethoxazol (37.6%), nitrofurantoine
(2.8%), pristinamycin (17.4%), quinupristin-dalfopristin
(15.6%), and rifampicin (3.7%). In addition we noted that 21
out of 24 erythromycin resistant strains were isolated from the
children group with carious teeth.[()TD$FIG]
Fig. 1 – (a) Agarose gel electrophoresis of polymerase chain reacti
DNA molecular size marker (Invitrogen, USA); lane 2, negative co
amplification of oral bacteria; lane 3, B198; lane 4, B509; lane 5, B6
B484; lane 11, B403; lane 12, B496; lane 13, B580; lane 14, B155; l
electrophoresis of polymerase chain reaction (PCR) amplification
(Invitrogen, USA); lane 2, negative control; lanes 3–8, PCR amplico
B560; lane 4, B619; lane 5, B9; lane 6, B480; lane 7, B585; lane8, B
reaction (PCR) amplification of tetO gene. Lane 1, 100 bp DNA Ladd
amplicons obtained with DNA amplification of oral bacteria; lane
Furthermore, 96.3% of intermediate susceptibility was
recorded in the case of kanamycin HC and gentamycin HC.
The intermediate susceptibility to the other antibiotics was as
follow: penicillin (38.5%), amoxicillin (18.3%), pristinamycin
(4.6%), ampicillin enterococcus (2.1%), cefotaxim (16.5%),
erythromycin (5.5%), tetracycline (2.8%), quinupristin-dalfo-
pristin (13.8%), levofloxacin streptococcus (7.3%), vancomycin
(3.7%), rifampicin (13.8%) and linezolid (15.6%). We noted also
that all the tested strains were susceptible to ampicillin
enterococcus, telithromycin and teicoplanin.
4.2. Detection by PCR of resistance genes
Erythromycin-resistance genes (ermB and mefI) were identi-
fied by duplex PCR (Fig. 1a), 15 out of 109 (13.8%) were ermB
positive (Table 2). The majority of these strains were isolated
from caries-actives children. However mefI gene was present
in 43 of 109 strains (39.4%) amongst them eight carried the
ermB gene.
Tetracycline resistance genes were also detected by PCR
(Fig. 1a and b), 14 out of 109 (12.8%) were tetM+ and 34 (31.2%)
were tetO+. We noted also the presence of six strains which
on (PCR) amplification of ermB and mefI gene. Lane 1, 100 bp
ntrol; lanes 3–17, PCR amplicons obtained with DNA
1; lane 6, B160; lane 7, B736; lane 8, B9; lane 9, B860; lane 10,
ane 15, B448; lane 16, B673; lane 17, B215. (b) Agarose gel
of tetM gene. Lanes 1, 100 bp DNA molecular size marker
ns obtained with DNA amplification of oral bacteria; lane 3,
155. (c) Agarose gel electrophoresis of polymerase chain
er (Promega, France); lane 2, negative control; lanes 3–7, PCR
3, B100; lane 4, B76; lane 5, B677; lane 6, B634; lane 7, B496.
[()TD$FIG]
Fig. 3 – Correlation between tetracycline susceptibility and the presence of tetracycline resistance genes (tetM and tetO).
[()TD$FIG]
Fig. 2 – Correlation between erythromycin susceptibility strains and the presence of erythromycin resistance gene (ermB)
and the macrolide efflux (mefI).
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5 131
were tetM+ and tetO+ (Table 4). However in seven tetracycline
resistant strains the tetM and tetO were not detected.
As presented in Fig. 2, three ermB and mefI positive were
isolated from caries-actives children and were erythromycin
resistant. In addition only one ermB and mefI positive strain
was isolated from the control group and was erythromycin
intermediate susceptible. The three erythromycin resistant
isolated from the caries-free children were ermB negative and
mefI positive (Fig. 2). Two strains (one from carious children
and one from control) were tetM and tetO positive and
tetracycline resistant. In addition five tetracycline resistances
strains isolated from caries actives children were tetM and
tetO negatives (Fig. 3).
5. Discussion
Early childhood caries continue to be a serious public health
problem in many areas of the world.23 Cariogenic diet and oral
hygiene contribute to the development of caries.
Table 3 – Association between species identification and carie formation.
Strains Numbers of strains (%) P-valuesa Odds ratio (95%CI)b
Streptococcus mutans 13 (11.9%) 0.034 7.250 (0.895, 58.699)
Streptococcus oralis 13 (11.9%) 0.034 7.250 (0.895, 58.699)
Enterococcus faecalis 12 (11%) 0.048 6.510 (0.799, 53.056)
Streptococcus constellatus 11 (10.1%) 0.820 0.858 (0.230, 3.198)
Streptococcus mitis 10 (9.2%) 0.018 –c
Streptococcus salivarius ssp. salivarius 9 (8.3%) 0.456 1.849 (0.360, 9.502)
Gemella morbillorum 5 (4.6%) 0.745 0.737 (0.116, 4.665)
Enterococcus faecium 5 (4.6%) 0.515 2.071 (0.221, 19.394)
Streptococcus pyogenes 5 (4.6%) 0.745 0.737 (0.116, 4.665)
Streptococcus anginosus 4 (3.7%) 0.148 –
Gemella haemolysans 4 (3.7%) 0.148 –
Streptococcus sanguis 3 (2.8%) 0.213 –
Lactococcus lactis ssp. cremoris 3 (2.8%) 1 1 (0.087, 11.490)
Lactococcus lactis ssp. lactis 2 (1.8%) 0.613 0.492 (0.030, 8.142)
Aerococcus viridans 2 (1.8%) 0.613 0.492 (0.030, 8.142)
Streptococcus bovis 2 (1.8%) 0.312 –
Streptococcus uberis 2 (1.8%) 0.312 –
Enterococcus avium 1 (0.9%) 0.477 –
Streptococcus equinus 1 (0.9%) 0.155 –
Streptococcus pneumoniae 1 (0.9%) 0.477 –
Leuconostoc spp. 1 (0.9%) 0.477 –
a Calculated using Pearson’s chi-square tests.b Odds of being a children with caries active associated with species identification.c Non applicable.
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5132
In this study, 109 Streptococci were isolated from the oral
cavity of Tunisian children (Table 2). The most isolated strains
were S. mutans and S. oralis (n = 13) which were isolated
essentially from the caries-active children group. Dental caries
is closely associated with mutans streptococci colonizing the
oral cavity.24 In our investigation, only 12% of S. mutans were
isolated and identified. We noted also the presence of 15
various species which may be implicated in dental caries such
as Streptococcus anginosus, S. sanguis, Lactococcus lactis ssp. Lactis
and L. lactis ssp. cremoris.
As presented in Table 3, statistical analysis revealed that
there is a correlation between the presence of S. mutans
(P = 0.034), S. oralis (P = 0.034), E. faecalis (P = 0.034), S. mitis
(P = 0.034), and caries formation in the studied population.
It has been reported a higher isolation frequencies of S.
mutans and lactobacilli in Dundee, Scotland, 1-year old infants
with caries compared to those who were clinically caries-
free.25 Moreover, earlier studies reported that the most species
frequently detected in school children were S. mutans,
Streptococcus sanguinis, S. salivarius and S. anginosus.26
The failure of antibiotic prophylaxis in dental practise is the
major cause of bacteremia after dental procedures. The ability
of antibiotic therapy to reduce the frequency of bacteremia
associated with dental procedure is controversial.27 The
antibiotic resistance amongst oral bacteria must be investi-
gated before dental practise. This study was focused on the
susceptibility testing of oral bacteria since these microorgan-
isms are frequently isolated from the oral cavity and play a
significant role as a reservoir of antimicrobial resistance
genes.
The susceptibility analysis showed a 19.26% rate of
resistance to erythromycin and 12.84% to tetracycline in
caries-active group compared to 2.75% in the caries-free one.
Our result was contradictory with another study 28 which
reported no high resistance to tetracycline in the healthy
group. Ono et al. 29 indicated much higher resistance rate to
erythromycin for S. mitis, S. oralis and S. sanguis isolated from
oral infections. We noted also that all the isolated strains were
susceptible to telithromycin. This result was in agreement
with other study which found that telithromycin have a higher
in vitro activity.30
Macrolide resistance rates of clinical Streptococci pyogenes
isolates has been recognized in many parts of the world.31 In
this study only one S. pyogenes (B205) was erythromycin and
tetracycline resistant. Examination of macrolide-resistance
genes is very important to understand the erythromycin
susceptibility state.32 Transformation of DNA is a major
contributor to horizontal gene transfer in many species of
bacteria inhabiting the oral cavity.19
The most prevalent mechanisms of macrolide resistance in
streptococci are target modification due to ribosomal methyl-
ation associated with the erm(B) or the erm(A) gene and a
macrolide-specific efflux mechanism encoded by mef genes.33
MLS antibiotics are frequently used as first-line treatment for
streptococcal infections in children.34 Acquired resistance
against these antibiotics has frequently been described in
enterococci.35 A strong association of the erm(B) and tet(M)
genes with the mobile transposon Tn1545-related elements
was found in human oral streptococci.36 Lancaster et al.37
suggested that the high prevalence of tetracycline and
macrolide resistance in oral bacteria may be due to acquisition
of resistance genes from food products.
In this study we found that 15 out of 109 (13.8%) strains
were ermB positive (Table 2), amongst them 14 strains were
isolated from caries-actives children. This result is contradic-
tory with a recent study of Liu et al. 38 who reported that the
ermB gene was frequently present in streptococci. Other
Japanese studies showed that the ermB gene was detected in
Table 4 – Correlation between tetracycline susceptibility testing (ATB Strep) and the presence of clinically relevantantibiotic resistance genes (tetM and tetO) in oral streptococci.
Species identification (number of strains) Teta Nb tetMc tetOc
Streptococcus mutans (n = 13) I 3 1 3
R 1 1 1
S 9 – 5
Streptococcus oralis (n = 13) R 1 – 1
S 12 2 2
Enterococcus faecalis (n = 12) R 1 – 1
S 11 – 6
Streptococcus constellatus (n = 11) R 1 – –
S 10 2 1
Streptococcus mitis (n = 10) R 1 – 1
S 9 – 2
Streptococcus salivarius ssp. salivarius (n = 9) R 2 1 –
S 7 1 –
Streptococcus pyogenes (n = 5) R 3 – –
S 2 – –
Gemella morbillorum (n = 5) S 5 – 1
Enterococcus faecium (n = 5) S 5 1 3
Gemella haemolysans (n = 4) S 4 – 1
Streptococcus anginosus (n = 4) R 2 2 –
S 2 1 1
Streptococcus sanguis (n = 3) R 3 1 –
Lactococcus lactis ssp. cremoris (n = 3) R 1 – 1
S 2 – –
Streptococcus uberis (n = 2) S 2 – 1
Streptococcus bovis (n = 2) R 1 – 1
S 1 – 1
Aerococcus viridans (n = 2) S 2 1 –
Lactococcus lactis ssp. lactis (n = 2) S 2 – 1
Leuconostoc spp. (n = 1) S 1 – –
Streptococcus pneumoniae (n = 1) S 1 – –
Streptococcus equinus (n = 1) S 1 – –
Enterococcus avium (n = 1) S 1 – –
(–) Absence of gene.a Tetracycline susceptibility (ATB Strep).b Numbers of strains.c Numbers of strains carrying the tetM or the tetO gene
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5 133
57.1% 39 and in 50% of the erythromycin-non-susceptible
isolates.21 mefI gene was present in 39.4% strains. We noted
also that only three ermB and mefI positive strains were
isolated from carious children and were erythromycin resis-
tant (Fig. 2).
In addition ten strains isolated from the carious children
were erythromycin resistant but they do not carry the ermB
and mefI genes (Fig. 2). Statistical analysis showed that the
presence of ermB gene in oral streptococci is not correlated
with erythromycin resistance obtained with ATB Strep
(P = 0.143). This discordance may be explained by the presence
of other erythromycin resistant genes as previously described
in streptococci.40
Tetracycline is a broad-spectrum antibiotic used in the
treatment of oral infection. Tetracycline-resistant streptococ-
ci are frequently isolated from the oral cavity of humans,41 and
resistance is most commonly conferred by tetM, a ribosomal
protection protein often associated with the conjugative
transposon Tn916.42 Transferable Tn916-like elements have
been found in many oral streptococci.43 It has been shown in a
recent study that tet(M) was the most prevalent tetracycline
resistance genes found in the oral metagenomes extracted
from saliva samples.44 Additionally, tetO have been shown to
be common.45
As presented in Fig. 3, the susceptibility analysis showed a
12.84% rate of resistance to tetracycline in caries-active group
compared to 2.75% in the control group. In addition six strains
were tetM and tetO positives (Table 4). The presence of these
two genes was previously demonstrated but was not detected
in other European studies.46 The tetO gene has been found in
different species from the oral and respiratory tracts.41 As
shown in Fig. 3, eight Streptococcus strains were susceptible to
tetracycline but they carry the tetM gene. As presented in
Table 3, statistical analysis showed no correlation between the
tetracycline resistance and the presence of tetM (P = 0.039) or
tetO genes (P = 0.028).
In conclusion, this study revealed that the most isolated
strains were S. mutans, S. oralis, E. faecalis and S. constellatus.
Multi-resistance strains towards macrolides and tetracycline
were also recorded. A discordance between the phenotypic
and genotypic analysis of drugs resistances was noted. The
emergence of antibiotic-resistant bacteria within the oral flora
will have an impact on the prescription of antibiotics in
dentistry. The presence of resistant bacteria in the oral cavity
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5134
can be the major cause of dental antibiotic prophylaxis failure.
Particular attention should be paid to antibiotics that are most
frequently used in dental practise.
Funding: ‘‘Ministere Tunisien de l’Enseignement Superieur,
de la Recherche Scientifique’’ through the ‘‘Laboratoire
d’Analyses, Traitement et Valorisation des Polluants de
l’Environnement et des Produits, Faculte de Pharmacie, rue
Avicenne 5000 Monastir (Tunisie)’’.
Conflict of interest: Not declared.
Ethical approval: All clinical procedures were approved by
the Ethical Committee of the Faculty of Medicine, University of
Monastir, Tunisia.
r e f e r e n c e s
1. Nyvad B, Fejerskov O. Structure of dental plaque and theplaque–enamel interface in human experimental caries.Caries Res 1989;23:151–8.
2. Bayliss R, Clarke C, Oakley C, Somerville W, Whitfield AG.The teeth and infective endocarditis. Br Heart J 1983;50:506–12.
3. Von Reyn CF, Levy BS, Arbeit RD, Friedland G, CrumpackerCS. Infective endocarditis: an analysis based on strict casedefinitions. Ann Intern Med 1981;94:505–18.
4. Li X, Kolltveit KM, Tronstad L, Olsen I. Systemic diseasescaused by oral infection. Clin Microbiol Rev 2000;13:547–58.
5. Seymour RA, Lowry R, Whitworth JM, Martin MV. Infectiveendocarditis, dentistry and antibiotic prophylaxis; time for arethink? Br Dent J 2000;189:610–6.
6. Bryskier A. Viridans group streptococci: a reservoir ofresistant bacteria in oral cavities. Clin Microbiol Infect2002;8:65–9.
7. van der Bijl P, Pitigoi-Aron G. Tetracyclines and calcifiedtissues. Ann Dent 1995;54:69–72.
8. Ready D, Qureshi F, Bedi R, Mullany P, Wilson M. Oralbacteria resistant to mercury and to antibiotics are presentin children with no previous exposure to amalgamrestorative materials. FEMS Microbiol Lett 2003;223:107–11.
9. Roberts MC. Antibiotic toxicity, interactions and resistancedevelopment. Periodontology 2000–2002;28:280–97.
10. Arpin C, Canron MH, Noury P, Quentin C. Emergence of mefAand mefE genes in beta-haemolytic streptococci andpneumococci in France. J Antimicrob Chemother 1999;44:133–4.
11. Chopra I, Roberts M. Tetracycline antibiotics: mode ofaction, applications, molecular biology, and epidemiology ofbacterial resistance. Microbiol Mol Biol Rev 2001;65:232–60.
12. Clewell DB, Flannagan SE, Jaworski DD. Unconstrainedbacterial promiscuity: the Tn916-Tn1545 family ofconjugative transposons. Trends Microbiol 1995;3:229–36.
13. Rice LB. Tn916 family conjugative transposons anddissemination of antimicrobial resistance determinants.Antimicrob Agents Chemother 1998;42:1871–7.
14. Maniatis AN, Pournaras S, Kanellopoulou M, Kontos F,Dimitroulia E, Papafrangas E, et al. Dissemination of clonallyunrelated erythromycin- and glycopeptide-resistantEnterococcus faecium isolates in a tertiary Greek hospital. JClin Microbiol 2001;39:4571–4.
15. Molin S, Tolker-Nielsen T. Gene transfer occurs withenhanced efficiency in biofilms and induces enhancedstabilisation of the biofilm structure. Curr Opin Biotechnol2003;14:255–61.
16. Roberts AP, Mullany P. A modular master on the move: theTn916 family of mobile genetic elements. Trends Microbiol2009;17:251–8.
17. Ready D, Pratten J, Roberts AP, Bedi R, Mullany P, Wilson M.Potential role of Veillonella spp. as a reservoir of transferabletetracycline resistance in the oral cavity. Antimicrob AgentsChemother 2006;50:2866–8.
18. Alpert CA, Mater DD, Muller MC, Ouriet MF, Duval-Iflah Y,Corthier G. Worst-case scenarios for horizontal genetransfer from Lactococcus lactis carrying heterologous genesto Enterococcus faecalis in the digestive tract of gnotobioticmice. Environ Biosaf Res 2003;2:173–80.
19. Hannan S, Ready D, Jasni AS, Rogers M, Pratten J, Roberts AP.Transfer of antibiotic resistance by transformation witheDNA within oral biofilms. FEMS Immunol Med Microbiol2010;59:345–9.
20. Quinn JP, DiVincenzo CA, Lucks DA, Luskin RL, Shatzer KL,Lerner SA. Serious infections due to penicillin-resistantstrains of viridans streptococci with altered penicillin-binding proteins. J Infect Dis 1988;157:764–9.
21. Reinert RR, Filimonova OY, Al-Lahham A, Grudinina SA,Ilina EN, Weigel LM, et al. Mechanisms of macrolideresistance among Streptococcus pneumoniae isolates fromRussia. Antimicrob Agents Chemother 2008;52:2260–2.
22. Perez-Trallero E, Montes M, Orden B, Tamayo E, Garcia-Arenzana JM, Marimon JM. Phenotypic and genotypiccharacterization of Streptococcus pyogenes isolatesdisplaying the MLSB phenotype of macrolide resistance inSpain, 1999 to 2005. Antimicrob Agents Chemother2007;51:1228–33.
23. Beltran-Aguilar ED, Barker LK, Canto MT, Dye BA, Gooch BF,Griffin SO, et al. Centers for Disease Control and Prevention(CDC). Surveillance for dental caries, dental sealants, toothretention, edentulism, and enamel fluorosis—United States,1988–1994 and 1999–2002. MMWR Surveill Summ2005;54:1–43.
24. Warren JJ, Weber-Gasparoni K, Marshall TA, Drake DR,Dehkordi-Vakil F, Dawson DV, et al. A longitudinal study ofdental caries risk among very young low SES children.Community Dent Oral Epidemiol 2009;37:116–22.
25. Radford JR, Ballantyne HM, Nugent Z, Beighton D, RobertsonM, Longbottom C, et al. Caries-associated micro-organismsin infants from different socio-economic backgrounds inScotland. J Dent 2000;28:307–12.
26. Soncini JA, Kanasi E, Lu SC, Nunn ME, Henshaw MM, TannerAC. Oral microbiota of children in a school-based dentalclinic. Anaerobe 2010;16:278–82.
27. Lockhart PB, Durack DT. Oral microflora as a cause ofendocarditis and other distant site infections. Infect Dis ClinNorth Am 1999;13:833–50.
28. Bilavsky E, Eliahou R, Keller N, Yarden-Bilavsky H, Harel L,Amir J. Effect of benzathine penicillin treatment onantibiotic susceptibility of viridans streptococci in oral floraof patients receiving secondary prophylaxis after rheumaticfever. J Infect 2008;56:244–8.
29. Ono T, Shiota S, Hirota K, Nemoto K, Tsuchiya T, Miyake Y.Susceptibilities of oral and nasal isolates of Streptococcusmitis and Streptococcus oralis to macrolides and PCR detectionof resistance genes. Antimicrob Agents Chemother2000;44:1078–80.
30. Tomas I, Alvarez M, Lopez-Melendez C, Limeres J, Tomas M,Diz P. In vitro activity of telithromycin against mefA andermB erythromycin-resistant viridans streptococci isolatedfrom bacteremia of oral origin in Spain. Oral MicrobiolImmunol 2005;20:35–8.
31. Palavecino EL, Riedel I, Berrios X, Bajaksouzian S, Johnson D,Kaplan E, et al. Prevalence and mechanisms of macrolideresistance in Streptococcus pyogenes in Santiago. ChileAntimicrob Agents Chemother 2001;45:339–41.
32. Ubukata K, Iwata S, Sunakawa K. In vitro activities of newketolide, telithromycin, and eight other macrolideantibiotics against Streptococcus pneumoniae having mefA
a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 7 – 1 3 5 135
and ermB genes that mediate macrolide resistance. J InfectChemother 2003;9:221–6.
33. Clancy J, Petitpas J, Dib-Hajj F, Yuan W, Cronan M, KamathAV, et al. Molecular cloning and functional analysis of anovel macrolide-resistance determinant, mefA, fromStreptococcus pyogenes. Mol Microbiol 1996;22:867–79.
34. Portillo A, Ruiz-Larrea F, Zarazaga M, Alonso A, Martinez JL,Torres C. Macrolide resistance genes in Enterococcus spp..Antimicrob Agents Chemother 2000;44:967–71.
35. Martel A, Devriese LA, Decostere A, Haesebrouck F. Presenceof macrolide resistance genes in streptococci andenterococci isolated from pigs and pork carcasses. Int J FoodMicrobiol 2003;84:27–32.
36. Rodriguez-Avial I, Rodriguez-Avial C, Culebras E, Picazo JJ.Distribution of tetracycline resistance genes tet(M), tet(O),tet(L) and tet(K) in blood isolates of viridans groupstreptococci harbouring erm(B) and mef(A) genes.Susceptibility to quinupristin/dalfopristin and linezolid. Int JAntimicrob Agents 2003;21:536–41.
37. Lancaster H, Ready D, Mullany P, Spratt D, Bedi R, Wilson M.Prevalence and identification of tetracycline-resistant oralbacteria in children not receiving antibiotic therapy. FEMSMicrobiol Lett 2003;228:99–104.
38. Liu X, Shen X, Chang H, Huang G, Fu Z, Zheng Y, et al. Highmacrolide resistance in Streptococcus pyogenes strainsisolated from children with pharyngitis in China. PediatrPulmonol 2009;44:436–41.
39. Harimaya A, Yokota S, Sato K, Yamazaki N, Himi T, Fujii N.High prevalence of erythromycin resistance and macrolide-resistance genes, mefA and ermB, in Streptococcus
pneumoniae isolates from the upper respiratory tracts ofchildren in the Sapporo district, Japan. J Infect Chemother2007;13:219–23.
40. Woodbury RL, Klammer KA, Xiong Y, Bailiff T, Glennen A,Bartkus JM, et al. Active Bacterial Core Surveillance Team.Plasmid-Borne erm(T) from invasive, macrolide-resistantStreptococcus pyogenes strains. Antimicrob Agents Chemother2008;52:1140–3.
41. Villedieu A, Diaz-Torres ML, Hunt N, McNab R, Spratt DA,Wilson M, et al. Prevalence of tetracycline resistance genesin oral bacteria. Antimicrob Agents Chemother 2003;47:878–82.
42. Flannagan SE, Zitzow LA, Su YA, Clewell DB. Nucleotidesequence of the 18-kb conjugative transposon Tn916 fromEnterococcus faecalis. Plasmid 1994;32:350–4.
43. Warburton PJ, Palmer RM, Munson MA, Wade WG.Demonstration of in vivo transfer of doxycycline resistancemediated by a novel transposon. J Antimicrob Chemother2007;60:973–80.
44. Diaz-Torres ML, Villedieu A, Hunt N, McNab R, Spratt DA,Allan E, et al. Determining the antibiotic resistance potentialof the indigenous oral microbiota of humans using ametagenomic approach. FEMS Microbiol Lett 2006;258:257–62.
45. Seville LA, Patterson AJ, Scott KP, Mullany P, Quail MA,Parkhill J, et al. Distribution of tetracycline anderythromycin resistance genes among human oral and fecalmetagenomic DNA. Microb Drug Resist 2009;15:159–66.
46. Marimon JM, Valiente A, Ercibengoa M, Garcia-Arenzana JM,Perez-Trallero E. Erythromycin resistance and geneticelements carrying macrolide efflux genes in Streptococcusagalactiae. Antimicrob Agents Chemother 2005;49:5069–74.
