Molecular Diversity Analysis of Whitefly(Bemisia tabaci) Collected from Different

Regions of Madhya Pradesh

THESIS

Submitted to the

Jawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur

In partial fulfillment of the requirement forthe Degree of

MASTER OF SCIENCE

In

AGRICULTURE(MOLECULAR BIOLOGY AND BIOTECHNOLOGY)

By

SUMIT PRAKASHRAO KALEDivision of Plant Molecular Biology

Biotechnology CentreJawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur

Jabalpur (MP)

2013

CERTIFICATE- I

This is to certify that the thesis entitled, “Molecular Diversity Analysisof Whitefly (Bemisia tabaci) Collected from Different Regions of MadhyaPradesh” submitted in partial fulfillment of the requirement for the degree of

MASTER OF SCIENCE in Agriculture (Molecular Biology andBiotechnology) of Jawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur is a

record of the bonafide research work carried out by Mr. SUMITPRAKASHRAO KALE under my guidance and supervision. The subject of

the thesis has been approved by the Student’s Advisory Committee and the

Director of Instruction.

No part of the thesis has been submitted for any other degree or

diploma (Certificate awarded etc.) or has been published / published part has

been fully acknowledged. All the assistance and help received during the

course of the investigation has been acknowledged by him.

(Dr. S. Tiwari)Chairman of the Advisory Committee

THESIS APPROVED BY THE STUDENT’S ADVISORY COMMITTEE

Chairman (Dr. S. Tiwari) ……………………………………………..

Member (Dr. L. P. S. Rajput) ……………………………………………..

Member (Dr. U. K. Khare) …. ……………………………………….

CERTIFICATE - II

This is to certify that the thesis entitled, “Molecular Diversity Analysisof Whitefly (Bemisia tabaci) Collected from Different Regions of MadhyaPradesh” submitted by Mr. SUMIT PRAKASHRAO KALE to the Jawaharlal

Nehru Krishi Vishwa Vidyalaya, Jabalpur, in partial fulfillment of the

requirement for the degree of MASTER OF SCIENCE in AGRICULTURE((Molecular Biology and Biotechnology) JNKVV, Jabalpur, after evaluation

has been approved by the External Examiner and Student’s Advisory

Committee after an oral examination on the same.

Place : Jabalpur (Dr. S. Tiwari)Date: ………… Chairman of the Advisory Committee

MEMBER OF THE STUDENT’S ADVISORY COMMITTEE

Chairman : Dr. S. Tiwari .…………………

Member : Dr. L. P. S. Rajput .…………………

Member : Dr. U. K. Khare .…………………

Director, Biotechnology Centre : Dr. S. Tiwari .…………………

Director of Instructions : Dr. P. K. Mishra .…………………

i

List of Contents

ChapterNo.

Title Page

I Introduction 1 – 4

II Review of Literature 5 – 20

III Materials and Methods 21 – 30

IV Results 31 – 36

V Discussion 37 – 41

VI Summery, Conclusions and Suggestionsfor further work 42 – 43

6.1 Summary 42

6.2 Conclusions 43

6.3 Suggestions for further work 43

References 44 – 53

Vita

ii

List of Tables

TableNo. Title Page

3.1.1 Bemisia tabaci samples used for present studywith their location of collection.

21

3.2.1 Composition of DNA extraction solution. 24

3.3.1a Mitochondrial Cytochrome Oxidase I (mtCOI)primers and their sequences used in the study.

28

3.3.1b List of components with their concentrations usedfor mtCOI-PCR.

28

3.3.1c Temperature profile used in PCR Amplification forCI-J-2195 and L2-N-3014.

29

3.4 List of components with their concentrationsused for RAPD-PCR.

29

3.5.1 Temperature profile used in PCR Amplification forRAPD.

30

3.5.2 RAPD primers and their sequences used in thestudy.

30

4.1 Populations of whitefly, Bemisia tabaci collectedfrom various host plants in different geographicalregions of East Madhya Pradesh.

32

4.1.2 Efficiency of the whitefly DNA extraction method. 33

4.1.3 Spectrophotometric data of whitefly DNA extractedthrough standardized protocol.

34

4.5 RAPD primers analysis. 36

iii

List of Figures

SI. Title Page(between pages)

3.1.1a Map of B. tabaci collection site in MadhyaPradesh.

22

3.1.1b Images of Bemisia tabaci. 22

4.1 DNA isolation of whitefly population by CTAB method. 36 – 37

4.2 DNA isolation of whitefly population by Nonidet NP-40method.

36 – 37

4.3 DNA isolated from 17 populations of whitefly (B.tabaci) collected from different geographical regions ofMadhya Pradesh.

36 – 37

4.4 mtDNA analysis generated among the 17 samples ofwhitefly (B. tabaci) (Lane 1-17) using primer

36 – 37

4.5 RAPD analysis generated among the 17 samples ofwhitefly (B. tabaci) (Lane 1-17) using primer OPF-2

36 – 37

4.6 RAPD analysis generated among the 17 samples ofwhitefly (B. tabaci) (Lane 1-17) using primer OPH-9

36 – 37

4.7 RAPD analysis generated among the 17 samples ofwhitefly (B. tabaci) (Lane 1-17) using primer OPH-11

36 – 37

4.8 RAPD analysis generated among the 17 samples ofwhitefly (B. tabaci) (Lane 1-17) using primer OPH-16

36 – 37

iv

ABBREVIATIONS

% : Per centl : Micro literM : Micro molarAFLP : Amplified fragment length polymorphismBp : Base pairCTAB : Cetyl trimethyl ammonium bromideDNA : Deoxyribose nucleic acidEDTA : Ethylene diamine tetra-acetate

ISSR : Inter simple sequence repeatITSI : Internally transcribed spacer 1 sequenceFW : ForwardM : MolarmA : Mili ampereMbp : Million base pairMg : Mili gramMl : Mili litermM : Mili molarmt COI : Mitochondrial cytochrome oxidase IMin : MinuteNg : Neno gramNaOH : Sodium hydroxideNaCl : Sodium chlorideNonidet NP-40 : 4-Nonylphenyl-polyethylene glycolHCL : Hydrochloric acidO.D. : Optical densityPAGE : Polyacrylamide gel electrophoresisPCR : Polymerase chain reactionPVP : Poly-vinyl poly propilidinepH : Power of hydrogenpg : PicogramRAPD : Random amplified polymorphic DNARFLP : Restriction fragment length polymorphismRW : ReverseRpm : Revolution per minuteSCAR : Sequence characterized amplified regionSSR : Simple sequences repeatSDS : Sodium-dodocel sulphateKb : Killo base pairTAE : Tris base acetic acid glacial EDTATris : Trisma baseTE : TrisUV : Ultra violet

v

v/v : Volume by volumew/v : Weight by volume

1

INTRODUCTION

The whitefly Bemisia tabaci (Genn.) (Hemiptera: Aleyrodidae) is

one of the most important crop pest in the world and it serves as for

vector of more than 100 plant viruses (Jones, 2003). Most of these

viruses belong to the genus Begomovirus, one of the most important

emerging groups of plant viruses (Brown, 2000). B. tabaci has a high

intraspecific biological and genetic variability (De Barro et al., 2000).

On the basis of morphological characters it is very difficult to

distinguish different juvenile and adult B. tabaci (Rosell et al., 1997;

Calvert et al., 2001).

B. tabaci comprises biotypes which are difficult to differentiate

through conventional taxonomy due to morphological similarity (Brown

et al., 1995), whereas such biotypes of whitefly can be distinguished at

molecular level because of finding more genetic complexity in

whiteflies (Boykin et al., 2007). The genetics complexity within B.

tabaci was first recognized in the 1950’s when morphologically

indistinguishable populations were reported to differ in host range,

host-plant adaptability, and plant virus-transmission capabilities (Bird

and Maramorosch, 1978). B. tabaci was composed of a series of

biotypes (Costa and Brown, 1991; Bedford et al., 1994) that are

complex of highly cryptic sibling species, which lack morphological

traits for differention of behavioral and or genetic variants which proved

by biochemical and molecular analysis on B. tabaci collected from

different geographical regions of the world.

Whitefly (Bemisia tabaci) is a noxious insect which attack several

field and greenhouse cultivated crops in India. It belongs to a group of

insects named whiteflies that is commonly known as different names

based on crops on which it attack e.g. tobacco, cotton or sweet potato

whitefly (Rekha et al., 2005). It (Gennadius) (Hemiptera: Aleyrodidae)

is one of the most devasting tropical and sub-tropical agricultural pests

(Byrne and Bellows, 1991) affecting the yield of a broad range of

2

agricultural, fiber, vegetable and ornamental crops (Cahill et al., 1996)

and is considered one of the world’s top invasive species (Boykin et

al., 2007). B. tabaci became an important globally as a serious pest

because of the polyphagous nature of some biotype and the diverse

ways that it damage crops (Rekha et al., 2005). Both nymphs and

adults feed on plant sap and cause yellowing, molting and leaf fall. The

excretion of a substance known as honeydew facilitates fungus (sooty

mold) to colonize the leaf surface, which may affect the development of

the plant (Byrne and Bellows, 1991). Dinsdale et al., (2010) have

recently proposed that B. tabaci should be considered as a cryptic

species complex comprising 11 groups containing 24 species. The

more reproducible and informative method available to determine the

genetic affiliation of a B. tabaci population is sequencing the

mitochondrial cytochrome oxidase I (mtCOI) gene (De Barro et al.,

2005) and use consensus sequences to assign group affiliation

(Dinsdale et al., 2010). The Middle East-Asia Minor 1 group contains

the B and B2 biotypes and the Mediterranean the Q, J, L, Sub Saharan

Africa Silver leaf biotypes (Dinsdale et al., 2010). The biotype B was

introduced in Brazil in the beginning of the 1990’s (Lourencao and

Nagai, 1994) and in the last few years has spread to several states

causing losses in many crops (Lima et al., 2002).

Accurate identification of insects that are pests and or virus

vectors is a prerequisite for their effective management to reduce crop

damage (Brown, 2000). Analysis of the mitochondrial cytochrome

oxidase I (mtCOI) gene of worldwide collections of the whitefly have

greatly improved the understanding of the genetic diversity of the B.

tabaci species complex (Bosco et al., 2006; Dinsdale et al., 2010). On

the basis of microsatellite, mitochondrial and ribosomal markers

analysis, molecular phylogeny of B. tabaci specimens has identified a

large number of races and genetic groups that has established in

different parts of the world with each one represented by a large

number of genetic population and sub populations with little or no gene

flow between them. In a specific geographic region, native whiteflies

3

remain active on many cultivated plant as hosts and on weeds as

collateral hosts throughout the year. These host plant serving as

alternate hosts to whiteflies are known to exert a strong influence on

selection of specific whitefly genotypes out of the existing genotypes in

a particular agro-climatic region (Gupta et al., 2010).

The analysis of genetic variation using DNA fingerprinting

techniques has become an important approach in taxonomic,

population genetic and evolutionary studies of a variety of insect

species. Ambiguity in the identification of B. tabaci biotypes can be

eliminated using molecular markers. A major advantage of employing

DNA markers is that they are not influenced by environmental effects

or epistatic interactions. Molecular markers detect variation at the level

of the DNA sequence and have proved to be an extremely effective

tool for distinguishing between closely related genotypes.

Molecular markers have become available for identifying the

different genetic groups of B. tabaci that are mitochondrial COI or

ribosomal ITS1 DNA sequences. Molecular based assays have been

used to distinguish various populations of B. tabaci. Among the

different molecular markers, RAPD-PCR (Lima et al., 2000; Lima et al.,

2002; Fontes et al., 2010), Mitochondrial Cytochrome Oxidase I

(mtCOI), Microsatellite markers, Internally transcribed spacer 1

sequences (ITS1) (Boykin et al., 2007) and AFLP markers (Cervera et

al., 2000) have been used to analyze genetic diversity and amplify

various specific fragments linked to genes in the whitefly genome

(Boykin et al., 2007). Molecular technology has provided valuable

molecular marker investigational tools. The genetic differentiation of B.

tabaci populations may lead to important implications for the control of

this pest in India and worldwide, since it includes populations of

different host plants, from different geographic regions, and genetic

variations within these populations (Valle et al., 2011). For most

molecular studies, the isolation of high quality DNA is an essential

prerequisite. Isolation of DNA is difficult when insects are too small to

dissect them. The extraction and purification of intact DNA is often

4

extremely difficult due to two major problems: the minute size of the

individuals and the low amount of total DNA in insects (Redi and

Garagna 1987; Bertolani et al., 1994; Garagna et al., 1996). Additional

problems are encountered with the step of preservation, the handling

of specimens in the field or laboratory, the choice of the extraction

protocol or commercial kit, or the polymerase enzymes and the

sequencing reactions. Additionally, some DNA isolation methods and

commercially available kits tend to produce low DNA yields with short

storage life (Zidani et al., 2005), which make them unsuitable for some

molecular applications. Due to these facts, standardization of DNA

extraction protocol from whitefly for molecular analysis is needed.

This research is based on the identification of species in the

genus Bemisia, but the taxonomy of whiteflies has long been

problematic because of similarities in the morphology of pupae and

adults. The aim of this study was to characterize B. tabaci populations

collected on host plants from different geographical regions of East

Madhya Pradesh.

In the light of above facts, the present experiments were

envisaged to fulfill following objectives:

• To standardize protocol for DNA isolation from whitefly.

• To analyze the genetic diversity of whitefly using DNA fingerprinting.

5

REVIEW OF LITERATURE

Whiteflies are small, often inconspicuous insects that are

globally distributed as agricultural pests of both greenhouse and field

crops. Although > 1,500 species of whiteflies exist, only a few cause

serious economic losses (Bink-Moenen, 1990; Martin, 2004). Their

common name, whitefly, is due to the presence of white wax and lipid

particles that cover the body and wings of most adult species (Byrne

and Hadley, 1988; Buckner et al., 1994). Whiteflies are polyphagous

herbivores that reduce crop yields by extracting water, carbohydrates

and amino acids from plant phloem (Lioyd, 1922). Whitefly can

transmit plant viruses. However, serious viral diseases are more

commonly associated with B. tabaci (Cohen, 1990). As phloem-feeding

insects, whiteflies excrete sticky honeydew that can cover fruit and

foliage of crops. Honeydew fosters the growth of sooty mold

(Cladosporium) on plants and reduces plant photosynthesis (Lioyd,

1922; Hoddle et al., 1998; Smith et al., 2001)

2.1 Host Plant and Natural Enemies

B. tabaci has been recorded from more than 600 different plant

species (Mound and Halsey, 1978; Greathead, 1986; Secker et al.,

1998) and its polyphagous nature has been document worldwide (Bird,

1957; Costa and Russell, 1975; Bird and Maramorosch, 1978; Butler et

al., 1986, Costa and Brown, 1990, 1991; Costa et al., 1991; Burban et

al., 1992). B. tabaci also is a major pest of greenhouse crops,

particularly ornamentals, although major crops under greenhouse

production such as tomato, pepper, beans eggplant, and cucumber are

also attacked (Cock, 1986).

Since whiteflies are minute insects, many of their predators in

particular the more prey specific ones are small arthropods. The

location of whiteflies, especially the immature stages that are fixed

upon plant leaves also limits the kind of predators to those that occur

on foliage. The natural enemies of whitefly are Encarsia sp., Chrysopa

6

basalis Walker, Chrysopa sp., Lycoza sp., Oxypes sp., and

Coccinellidae (Kheinmeesook, 1997). In addition to parasitoids and

predators, pathogens are also natural enemies of whiteflies. Several of

them were found to cause fatal disease to whitefly especially the

entomophathogenic fungi. It is well known that fungi invade insect via

external cuticle and not be ingested to initiate disease. This makes

them prime candidates for use against plant sucking insects including

whitefly. The fungi, Aschersonia aleyrodis and Paecilomyces

fumosoroseus were commercially produced and used effectively for

controlling whitefly (Lacey et al., 1996). In greenhouse, the fungi,

Verticillium lecanii and A. aleyrodis were used to control whitefly and

aphids (Dowell, 1990). It is believed that there are still numerous other

species of fungi that can serve as potential biological agents for

controlling whitefly as well as for other plant sucking insect species.

2.2 Whiteflies as Agricultural Pests

Whiteflies are major pests of many agricultural crops worldwide.

They belong to the family Aleyrodidae of the order Hemiptera. More

than 1450 species have been described as belonging to two

subfamilies and the most economically important pest species are

members of the Aleyrodinae (Bink-Moenen and Mound, 1990; Martin

et al., 2000).

Whiteflies that are commonly known as different names based

on crops on which it attacks e.g., cotton, tobacco or sweet-potato

whitefly, is a diverse species found outdoors in tropical and sub-

tropical regions. In temperate countries it can be found only in crops

grown under protection (Martin et al., 2000). It affects hundreds of

different plant species (Byrne et al., 1990; Martin et al., 2000) and

transmitting more than 110 plant viruses, belonging to the

Begomovirus, Crinivirus and Carlavirus genera (Jones, 2003). Most of

those viruses can cause severe damage to crops and so even very low

populations of this pest can result in major crop failures. Several

biotypes of B. tabaci have been identified; the two currently of most

7

importance to agricultural environments are termed biotypes B and Q

(Perring, 2001).

2.3 Molecular Markers for the identification of species/biotype

Markers are characters whose inheritance pattern can be

followed at morphological (e.g. flower colour), biochemical (proteins

and isozymes) and DNA levels (molecular markers). These characters

are called markers as they are used to obtain indirect information

about the genetics of other traits of interest in the organism under

investigation (Jena, 2000). Variation in DNA sequences have been

extensively explored as genetic markers for genome mapping. DNA

based markers have several advantages over morphological and

biochemical markers such as pleiotropic or epistatic effects, enabling

the use of non-destructive method and use less amount of tissue,

independent to environmental stresses or management practices and

provide easy access, high reproducibility and high genetic resolution.

Perhaps the most widespread application of DNA markers is in the

construction of genetic maps, which can be used to determine the

chromosomal location of genes affecting either simple or complex traits

(Lander and Botstein, 1989; Dudley et al., 1992; Lee et al., 1996).

Genetic markers were being used in biology, well before it was

known that DNA was the hereditary material. Visible markers,

mutations in genes with visible consequences such as dwarfism or

colours, have been used in genetic studies since early in the twentieth

century (Morgan, 1911). In recent years the burgeoning field of

molecular biology has provided tools suitable for rapid and detailed

genetic analysis of higher organisms, including agricultural species.

Information from DNA markers serves many diverse purposes, such as

forensic science, paternity testing, identifying genes and inferring

evolutionary relationships among organisms (Paterson et al., 1993).

The advent of molecular markers revolutionized the entire

scenario of biological sciences. DNA-based molecular markers have

acted as versatile tools and have found their own position in various

8

fields like taxonomy, physiology, embryology, genetic engineering, etc.

(Joshi et al., 1999). They are no longer looked upon as simple DNA

fingerprinting markers in variability studies or as forensic tools. Since

their development, they are constantly being modified to enhance their

utility and to bring about automation in the process of genome

analysis. Random Amplified Polymorphic DNA (RAPD) markers are

one of the most commonly used markers as they offer easy handling

and produce quick results. RAPD markers have been extensively used

in many crops as genetic markers for assessment of genetic variability

and have proved highly efficient for assessment of genetic diversity.

These markers are mostly dominant and detect variations in both

coding as well as non-coding regions of the genome.

About 1,200 whitefly species have been described (Mound and

Halsey, 1978), although the real number in existence is probably much

higher. Most whitefly species are insect pests in the tropic. Variation in

host plant preference, life cycle and even disease transmission

capability can be expected between populations in different regions

and habitats. Whiteflies were commonly described only from their

pupal case (Bink-Moenen, 1983; Martin, 1985). At the same level

distinction such as host race is biotype, a term used to designate

populations that lack morphological distinction, but that possess other

characteristics which serve to separate them from other populations

(Claridge et al., 1997).

Recently, molecular based assays have been used to distinguish

various populations of B. tabaci. A popular technique has been the use

of Mitochondrial Cytochrome Oxidase I (mtCOI), Microsatellite

markers, internally transcribed spacer 1 sequences (ITS1) and AFLP

markers to amplify various fragments in the whitefly genome. These

fragments are easily seen as variable sized bands using standard

agarose gel electrophoresis.

Campbell (1993) and Campbell et al. (1994, 1996) performed

sequence analyses of the 18S rRNA genes from biotype A and B and

9

showed 2bp substitutions out of the 1039bp fragments analysed. Other

genes have been used as well for proper identification.

Frohlich et al. (1999) performed Phylogenetic analyses on 10 B.

tabaci populations from various locations using 550bp region of the

mitochondrial 16S rDNA and 700bp region of the mitochondrial

cytochrome oxidase I (COI) gene. They reported that the 16S

fragments were useful in separating New World and Old World whitefly

biotypes, and they placed esterase biotype B within Old World Israel-

Yemen clade. Analysis of CO1 sequences supported 5 distinct clades;

Benin (esterase biotype B), Sudan (esterase biotype L), India

(esterase biotype G), Israel-Yemen-USA (esterase biotype B), and

Costa Rica-Mexico-Puerto Rico-USA (esterase biotype A).

Cervera et al. (2000) used AFLP markers for showing the

genetic similarities between B. tabaci with B. medinae Gomez-Memor

and another of B. afer Priesner and Hosny and analysis showed that B.

tabaci a minimum similarity coefficient of 0.32 and separated from the

two other species with a similarity coefficient of 0.07.

Li et al. (2005) used internally transcribed spacer 1 sequences

(ITS1) of ribosomal DNA of B biotype and other biotypes which were

collected from different location in China, were sequenced and

analysed. The B biotype-specific primers were then designed for rapid

identification of B biotype of B. tabaci and result showed that the

diagnostic primer only gave a positive result with B biotype

Delatte et al. (2005) showed two genetic types of B. tabaci were

distinguished using RAPD-PCR and Cytochrome Oxidase I (COI) gene

sequence comparison. One type was assigned to B biotype and other

was genetically dissimilar to the population named Ms after the

Mascarenes Archipelago. Both B and Ms Population of B. tabaci

induced silverleaf symptoms on cucurbita spp, and were able to

acquire and transmit TYLCV. Taken together these results indicate that

Ms Genetics type should be considering a new biotype of B. tabaci.

10

Bosco et al. (2006) used PCR-RFLP identification of B. tabaci

biotype in the Mediterranean Basin. Developed a method for rapid

biotyping of B. tabaci populations for five biotypes such as B, Q, M, S

and T reported until now in Mediterranean have been tested by PCR

amplification of the cytochrome oxidase I mitochondrial gene followed

by restriction with enzyme True91.

Ueda and Brown (2006) showed first report of the Q biotype of

B. tabaci in Japan by mitochondrial cytochrome oxidase I sequence

analysis. The molecular genetics identification and phylogenetic

relationships of 12 B. tabaci populations collected from representative

location in Japan. Phylogenetic analysis of the whitefly mtCOI

sequence indicated that both the invasive B and Q biotype was found

at four locations Mihara in Hiroshima, Nishigoshi in Kumamoto,

Miyanojo and Okuchi in Kagoshima, the remaining eight collections

were identified as B biotype. This is the first report of the introduction of

Q biotype in Japan.

Boykin et al. (2007) used a Bayesian phylogenetic technique for

understanding of global B. tabaci phylogenetic relationships to

elucidate the relations among all COI DNA sequence data available in

Genbank for B. tabaci worldwide and analyze 12 major well-resolved

genetic groups showing a close relationship with Asian biotype.

Hsieh et al. (2007) used mitochondrial cytochrome oxidase I

(mtCOI) gene was to reconstruct a phylogenetic tree for identification

of biotype B and Q and to study the relationships between invasive

events and ornamental plants.

Scott et al. (2007) showed first record of B. tabaci biotype Q in

New Zealand. The whitefly was identified morphologically as B. tabaci

and capsicum represents a new host. Biotypes B and Q are

morphologically indistinguishable. Molecular diagnosis (Cytochrome

oxidase subunit I) of samples collected in a survey in 2006 from

capsicums and poinsettias revealed the presence of B. tabaci biotype

Q in New Zealand.

11

Tsagkarakoua (2007) showed biotype status and genetic

polymorphism of the whitefly (B. tabaci) (Hemiptera: Aleyrodidae) in

Greece by using sequencing of the mitochondrial cytochrome oxidase I

(mtCOI) gene and genotyping using microsatellite markers. Analyses

of the mtCOI sequences revealed a high homogeneity between the

Greek samples which clustered together with Q biotype samples that

had been collected from other countries. When genetic polymorphism

was examined using six microsatellite markers, the Greek samples,

which were all characterized as Q biotype were significantly

differentiated from each other and clustered into at least two distinct

genetic populations.

Bel-Kadhi et al. (2008) used Bem-23 microsatellite marker for

molecular characterization of B. tabaci Biotypes in Southern Tunisia.

The samples were collected from 8 geothermal areas and one from

Douz Oasis. Which showed that presence of biotype “B” 7 of the 8

geothermal sites having 220 base pair band for this biotypes while the

geothermal sites of B. tabaci population is present as a mixture of

biotype “B” and “Q” as revealed by the 410 base pair bands.

Rabello (2008) diversity analysis of B. tabaci biotypes by using

RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. He

analysed B. tabaci biotypes B, BR, Q and Cassava, which showed a

high similarity between the individuals of the B and Q biotypes, which

could be distinguished from the BR individuals. A phylogenetic tree

based on ITS1 rDNA sequence was constructed. This is the first report

of the ITS1 rDNA sequence of B. tuberculata and of the BR biotype of

B. tabaci.

Bethke et al. (2009) showed first record of the Q biotype of the

sweet potato whitefly (B. tabaci) in Guatemala, using esterase isozyme

patterns and mtCOI sequencing. Adult whitefly and immature were

collected from commercially grown poinsettia plants and only Q biotype

was found on commercially grown poinsettia plants. This is the first

reports of the Q biotype in Guatemala.

12

Fujiie et al. (2009) used mitochondrial cytochrome oxidase I

(mtCOI) sequence for identification of the whitefly biotype collected

from different geographical location of autumn-cultured potato fields in

Syria (Japan) and confirmed that they were the Q, B and non-B (B2)

biotype of B. tabaci.

Mckenzie (2009) showed distribution of B. tabaci (Hemiptera:

Aleyrodidae) biotypes in Florida-Investigating the Q Invasion by using

mitochondrial cytochrome oxidase I subunit and microsatellite markers.

The biotype status of submitted B. tabaci samples was determined by

polymerase chain reaction (PCR) amplification and sequencing of a

700-800bp small subunit (mtCOI) gene fragment, PCR amplification,

and size determination of two unique microsatellite markers and

esterase zymogram analysis. 180 collections were sampled from 23

counties. Of these samples, 58% were from vegetables, 37% were

from ornamentals, and 5% were from peanuts, alfalfa, and weeds. 18%

of all collections were found to be the Q biotype that came from

greenhouse grown ornamental and herbs located in six counties.

Sequence comparison of the mtCOI gene identified three separate

haplotypes within Florida that were defined as Q1, Q2, and Q3.

Shatters (2009) showed improved DNA barcoding method for B.

tabaci and related Aleyrodidae: development of universal and B. tabaci

biotype-specific mitochondrial cytochrome oxidase I polymerase chain

reaction primers. These primers produce a 478bp, 405bp, and 303bp

mtCOI fragment for the B, New World, and Q biotypes, respectively in

their study.

Chu et al. (2010) applied mitochondrial cytochrome oxidase I

(mtCOI) specific marker for phylogenetic analysis among whitefly from

china and grouped into different cluster.

Fontes et al., (2010) used microsatellite marker for diversity

analysis among whitefly isolate collected from different regions of

Brazil and found geographical grouping among them.

13

Chu et al. (2011) showed investigation of the genetic diversity of

an invasive whitefly (Bemisia tabaci) in China using both mitochondrial

and nuclear DNA markers. He explains the changes in genetic

variation between its home range in the Mediterranean region and its

invasion range we show that Q in Shandong likely originated in the

western Mediterranean. His studied also found that the haplotype

diversity was low compared with its presumed geographic origin,

whereas microsatellite allele diversity showed no such decline.

Ma et al. (2011) used microsatellite markers for the identification

of the spiralling whitefly (Aleurodicus dispersus) species examined in

individual whitefly from Hainnan Island and Canary Islands (China) and

observed expected heterozygosity values were 0.773 and 0.585,

respectively. Conclude that microsatellite markers provide powerful

tools for ecological, epidemiological and population genetics studies on

this highly invasive insect.

Rocha et al. (2011) found mitochondrial cytochrome oxidize I

(mtCOI) marker for the identification of B-Biotype of B. tabaci is

presents on vegetable in Sao Paul State, Brazil.

Valley et al. (2011) used COI gene marker for the mtDNA

variability in whitefly populations in Brazil. He collected three individual

samples from host plant species, such as soybean, pumpkin and

tomato. He found that all haplotypes belong to biotype B, which is

confirmed by the haplotype network as well as genetic structure

analysis, showed that the host plant species do not influence

population structuring of this pest, only the geographical location

mattered.

Mugerw et al. (2012) showed genetic diversity and geographic

distribution of B. tabaci (Gennadius) (Hemiptera: Aleyrodidae)

genotypes associated with cassava in East Africa by using partial

sequences of the mitochondria cytochrome oxidase I (mtCOI) DNA, in

cassava growing areas of Kenya, Tanzania and Uganda. Two distinct

species were obtained including sub-Saharan Africa 1 (SSA1),

14

comprising of two sub-clades (I and II), and a South West Indian

Ocean Islands (SWIO) species. Showed the SSA1, sub-clade I

sequences shared similarity of 97.8-99.7% with the published Uganda

1 genotypes, and diverged by 0.3-2.2%. A pairwise comparison of

SSA1 sub-clade II sequences revealed a similarity of 97.2-99.5% with

reference southern Africa genotypes, and diverged by 0.5-2.8%. The

SSA1 sub-clade I whiteflies were widely distributed in East Africa (EA).

The SWIO species had a sequence similarity of 97.2-97.7% with the

published Reunion sequence and diverged by 2.3-2.8%.

Xiao-Jun (2012) showed diversity and genetic differentiation of

the whitefly B. tabaci species complex in China based on mtCOI and

cDNA-AFLP analysis. In an extensive field survey of the B. tabaci

complex present throughout part of China from 2004 to 2007. He

obtained 93 samples of B. tabaci from 22 provinces. He determined

that these Chinese haplotypes included 2 invasive species (Middle

East-Asia Minor 1 and Mediterranean), and 4 indigenous cryptic

species (Asia II 1, Asia II 3, China 3 and Asia II 7) by sequencing

mitochondrial cytochrome oxidase I gene (mtCOI). The diversity and

genetic differentiation of a subset of 19 populations of B. tabaci were

studied using cDNA amplified fragment length polymorphism (AFLP).

Mediterranean showed the lowest degree of similarity than the other

species. The data indicate that both Middle East-Asia Minor 1 and

Mediterranean were rapidly established in China.

2.3.1 Random Amplified Polymorphic DNA (RAPD)

RAPD primer was first developed in 1990 by Welsh and

McClelland using PCR to randomly amplified anonymous segments of

nuclear DNA with an identical pair of primers 8-10bp in length. RAPD

polymorphism could occur to base substitution at the primer binding

site or due to indels in the regions between the sites.

William et al. (1990) proposed the use of single arbitrary 10 base

oligonucleotide PCR primer for generation of molecular markers called

as RAPD markers. These could be easily developed and since were

15

based on PCR amplification followed by agarose gel electrophoresis,

they were readily detected. As a result, RAPD permit the wider

application of molecular maps in plant and insect science.

RAPD techniques have many other applications, including the

identification of cultivars/varieties, introgression studies, determination

of parentage, phylogenetic analysis and construction of genetic maps.

Polymorphisms were generated by random amplified polymorphic DNA

analysis used for fingerprinting by Connolly et al. (1994) and for

evaluating genetic relationships among diversified cultivars by Stiles et

al. (1993).

2.3.2 Molecular Markers and Diversity Analysis

Markert and Moller (1959) showed that genetic differences in

easily assayed enzymes (isozymes) changed their rate of migration

through gel matrices, in response to an electrical field. Using visible

markers together with isozymes, substantial genetic maps of some

organism had already been assembled by the late 1970s.

Litt and Luty (1989) found that microsatellite as simple sequence

repeats (SSRs) were short DNA sequence stretches consisting arrays

of mono, di, tri, tetra, or penta nucleotide units widely dispersed

throughout the genome.

Bell-Johnson et al. (1998) found the most fundamental of these

tools was DNA markers that detect differences in the genetic

information carried by different individuals. By knowing the location of a

gene, one can determine its presence by using nearby DNA markers,

without actually observing the phenotype, which could save a lot of

time and money, especially for quantitatively inherited traits.

Rafalski (2002) stated that DNA based genetic markers had

forever changed the practice of genetics. In the 20 years since that

discovery many different types of DNA based genetic marker had been

used for the construction of genetic maps, for the analysis of genetic

diversity, trait mapping as well as for applied diagnostic purposes.

16

Dangi et al. (2004) reported that RAPD markers were generated

through PCR amplifications of random genomic DNA segments using

10-15 base pairs of arbitrary sequence.

2.4 Genetic diversity in whitefly (Bemisia tabaci)

Perring et al. (1993) used RAPD-PCR to show differences in

amplification products between biotype A and biotype B. They found

90% similarity in the bands within each biotype and only 10% similarity

in the bands between biotypes.

Gawal and Bartlett (1993) found biotype A and B were easily

distinguished by RAPD-PCR. They noted that the speed, ease, and

ability to quantify differences among RAPD marker make this

technique a desirable tool for genetic studies of B. tabaci.

De Barro and Driver (1997) showed RAPD-PCR similar banding

patterns from populations of the B biotype from Australia, Cook Island,

Israel, Netherlands, New Caledonia, and USA. They also reported

differences in banding patterns among whiteflies from Sudan (esterase

biotype L), India (esterase biotype H, esterase biotype G), Pakistan

(esterase biotype K), New Zealand (esterase biotype unknown), Costa

Rica (esterase biotype C), Hainan (esterase biotype unknown), and

Nauru (esterase biotype unknown).

Guiro et al. (1997) evaluated B biotype from Denmark, France,

Israel, Italy, Japan, Netherlands, Spain and USA. They reported

90%similarity among biotypes in their study. They also found

populations from Spain and Portugal (both designated as RAPD type

II) to be distinct from all other populations tested in their study. RAPD-

PCR also showed distinct banding patterns from between the B

biotype, RAPD type II, and population from India, Pakistan, Turkey,

and biotype A from the USA.

De Barro et al. (1998) found distinct RAPD-PCR banding

patterns between a native population from Australia (Australian biotype

AN), the B biotype, and a unknown population from Nauru (designated

the Nauru biotype NA).

17

Lima et al. (2000) studied on identification of Bemisia tabaci

(Gennadius) (Hemiptera: Aleyrodidae) biotypes in Brazil using RAPD

markers. Whiteflies were collected from cultivated plants and weeds

from 57 different localities and on 27 distinct crops. RAPD analyses

using two selected 10-mer primers reliably identified the BR biotype

and the B biotype of B. tabaci and also differentiated other whitefly

species. The presence of the B biotype was confirmed in 20 Brazilian

states. The BR and B biotypes of B. tabaci were found to coexist in the

whitefly populations of three different localities: Jaboticabal, SP;

Rondonopolis and Cuiaba, MT, and Goiania, GO.

Banks et al. (2001) reported that presence of B-biotype of B.

tabaci in the Kolar district of Karnataka state, India. Adult B. tabaci

collected from tomato plants at nine states within epidemic zone and

analyzed by RAPD-PCR using primers OPB-20 and OPB-11, indicated

that hundred per cent of individuals per site had identical patterns to

those of B-biotype individuals from Israel and Florida.

Lima et al. (2002) showed genetic diversity of B. tabaci (Genn.)

populations in Brazil revealed by RAPD markers. A total of 72 markers

were generated by five RAPD primers and used in the analysis. All

primers produced RAPD patterns that clearly distinguished the Bemisia

biotypes and the two other whitefly species. Results also showed that

populations of the B biotype have considerable genetic variability.

Cluster analysis demonstrated that, in general, Brazilian biotype B

individuals are scattered independently in the localities where samples

were collected. The present study showed that the B biotype is

disseminated throughout the sampled areas, infesting several host

plants and predominates over the A biotype.

Horowitze et al. (2003) showed Q of B. tabaci identified in Israel

by using polyacrylamide gel electrophoresis (PAGE) during 1999-2000.

Whitefly samples were collected from several field as well as

greenhouse sites was determined by PAGE and by RAPD-PCR using

primers of arbitrary sequence. Based on the collected samples, it

18

appeared that both the B and Q biotype were presents in Israel and

that field population consist of a mixture of the two biotypes.

Callejas et al. (2005) used RAPD markers to detect genetic

pattern in spiralling whitefly (Aleurodicus disperses) (Hemiptera:

Aleyrodidae) populations from the Canary Islands. He found that, 68

different band were scored in 7 population using 6 primers for

amplification and no different RAPD pattern were found among

population from different Islands of Canaries. It will indicate that a very

high genetic similarity among populations and low level of genetic

variability.

Delatte et al. (2005) showed two genetic types of B. tabaci were

distinguished using RAPD-PCR and Cytochrome Oxidase I (COI) gene

sequence comparison. One type was assigned to B biotype and other

was genetically dissimilar to the population named Ms after the

Mascarenes Archipelago. Both B and Ms Population of B. tabaci

induced silverleaf symptoms on cucurbita spp, and were able to

acquire and transmit TYLCV. Taken together these results indicate that

Ms Genetics type should be considering a new biotype of B. tabaci.

Hasan (2006) used RAPD markers for diversity analysis of B.

tabaci (Gennadius) (Homoptera: Aleyrodidae) biotypes in Jordan.

Whiteflies were collected from cultivated plants, wild plants and weeds.

RAPD analysis identified B-Biotypes as well as cluster analysis

demonstrated that, biotype B individual which are scattered

independently in the localities according to the host plant and coexists

with cultivated plants. While an intermediate whitefly population BA

having biotype A distinguish band only with ORP-04 according to

Jaccard’s similarity. They have higher genetic distance with B-

Biotypes as well as percentage of biotypes A, B and BA samples.

Sharma et al. (2008) used RAPD markers for identification of

genetic diversity among whitefly collected from different plant hosts

and concluded that RAPD markers are able to differentiate the whitefly

isolates with specific host.

19

Qiu et al. (2009) used morphological characters, RAPD-PCR

and COI gene sequence for identification of three major B. tabaci

biotypes in China. He concluded that B, Q and Cv biotypes are

morphologically different in posterior wax and RAPD-PCR band

showed revealed differences in these biotypes using H16 primer as

well as based on COI gene.

Perumal et al. (2009) used RAPD markers for host plant

mediated population variation of cotton whitefly B. tabaci Gennadius

(Aleyrodidae; Homoptera) characterized with random DNA markers

and found that variation based on host plants being utilized by the

whitefly population.

Helmi (2010) used RAPD markers for identification of whitefly on

different host plant species in Egypt. Six host plant populations were

screened with seven RAPD primers and these populations were

clustered into two main groups with higher similarity matrix

percentages.

Gupta et al. (2010) used RAPD markers for identification of

specificity in B. tabaci for host plants were sequenced and developed

SCAR markers from B. tabaci genotype holding specificity to a specific

host plant.

Hameed et al. (2012) showed genetic diversity analysis of B.

tabaci population in Pakistan using RAPD markers. A total 80 samples

of B. tabaci collected from 14 district of the Punjab province and 7

district of the Sindh province were included. B. tabaci populations were

grouped into three main clusters and clearly distinguished the non B

biotype from the B biotype. This analysis showed that non B biotype is

prevalent in both provinces however B biotype is restricted to few

locations in Sindh.

Abdullahi (2013) showed molecular characterization of whitefly,

B. tabaci (Hemiptera: Aleyrodidae) populations infecting cassava. B.

tabaci collected from cassava and other plants in major cassava-

cultivation area of sub-Sahara Africa and from around the world. The

20

RAPD-PCR marker used to examine the genetic structure of the

population. Analysis of the internally transcribed spacer regions I (ITS

1) of the ribosomal DNA confirmed that the cassava population of B.

tabaci population were distinct from non-cassava population.

21

MATERIALS AND METHODS

The present study entitles “Molecular Diversity Analysis ofWhitefly (Bemisia tabaci) Collected from Different Regions ofMadhya Pradesh” was conducted at Plant Molecular Biology

Laboratory, Biotechnology Centre, Jawaharlal Nehru Agriculture

University, Jabalpur, India. This chapter deals with the materials and

methods used for molecular diversity analysis using different RAPD

molecular markers.

3.1 Materials

3.1.1 Source of Biological Material

About 17 populations of whiteflies (Table 3.1.1) were collected

from different geographical regions of East Madhya Pradesh.

Table 3.1.1: Bemisia tabaci samples use for present study withtheir location of collection.

SI. Collection site Latitude (N) Longitude (E)

1 Seoni 22º06”N 79º35”E2 Chhindwada 22º03”N 78º59”E3 Betul 21º88”N 77º98”E4 Hoshangabad 22º46”N 77º45”E5 Piparia 22º45”N 78º21”E6 Narsinghpure 22º57”N 79º15”E7 Sagar 23º5”N 78º5”E8 Tikamgarh 24º45”N 78º53”E9 Chhatarpure 24º54”N 79º38”E10 Katni 23º47”N 80º27”E11 Rewa 24º32”N 81º18”E12 Sidhi 24º2”N 82º39”E13 Satna 24º34”N 80º55”E14 Mandla 22º43”N 80º35”E15 Dindori 22º57”N 81º41”E16 Shahdol 23º00”N 81º3”E17 Jabalpur 23º10”N 79º59”

22

Collection site of B.tabaci

Fig. 3.1.1a: Map of B. tabaci collection site in Madhya Pradesh

Fig. 3.1.1b: Images of Bemisia tabaci.

23

3.1.2 Collection of Samples

Different host crops were selected to collect whitefly in morning

hours from the field during the kharif season 2012 for extraction of

genomic DNA. The collected samples were placed in centrifuge tubes

to transfer and then stored at -20°C.

3.1.3 Chemicals

Chemicals used for DNA extraction were purchased from Sigma

Aldrich (USA) and for PCR from Bangalore, Genie (India). DNA

ladders were purchased from Bangalore Genie (100bp) and Fermentas

Pvt. Ltd. India (1kb).

3.1.4 Molecular Markers

3.1.4.1 Mitochondrial Cytochrome Oxidase I (mtCOI)

mtCOI gene used as specific molecular marker to identify B

biotype of B. tabaci variant that exhibit rich biological differences, but

lack in morphological features.

3.1.4.2 Random Amplification Polymorphic (RAPD)

Random amplification polymorphic (RAPD) molecular markers

were used for diversity analysis in B. tabaci (Whitefly) collected from

different regions of East Madhya Pradesh. Random Amplified

Polymorphic DNA analysis of B. tabaci was done by using decamer

nucleotide primer obtained from R. Admin.

3.2 Methods

3.2.1 DNA isolation

Genomic DNA was isolated using standardized protocol. The

method described below gave a good quality and quantity of DNA.

Whiteflies are the most preferred material as it is difficult to collect at

any time and few amount of inhibitors and pigments that may hamper

the quality of DNA. The primary requirement for DNA isolation is to

extract DNA from cells in solution. Physical grinding results in physical

breakage of cells. Subsequently, addition of extraction solution

24

containing detergent like sodium-dodocel sulphate (SDS) assist

breakage of cell and nuclear membrane made up of lipids, which aids

in cell lysis and the components of cell are dispersed in the solution.

The DNA extraction solution was prepared as per details given

below.

Table 3.2.1: Composition of DNA extraction solution

S.NO. Chemicals Finalconcentration(10ml)

Workingconcentration

1 1M Tris 0.02 200μl

2 0.25M EDTA 0.002 80μl

3 5% SDS 0.035 70μl

4 ProtenaseK 0.0014 7μl

5 5M NaCL 0.05 100μl

1M Tris (pH 8.0): 30.28 gm. of Trizma base (Qualigens, FW =

121.1) was dissolved in 200 ml of distilled water. The pH was

adjusted to 8.0 with concentrated HCL (about 10.5 ml). The solution

was allowed to cool at room temperature (25°C) before final

adjustment of the pH. The volume of the solution was adjusted to a

total of 250 ml with distilled water before autoclaving.

0.25M EDTA (pH 8.0): 23.25 gm. of disodium

ethylenediaminetraacetate (EDTA) (Sigma, FW = 372.24) was

added in 100 ml distilled water slowly add with NaOH. The volume

of the solution was adjusted to a total of 250 ml with distilled water

before autoclaving.

TE (pH 8.0): 1M Tris (200µl) and 0.25M EDTA (80µl) was dissolved

in 1720 µl autoclaved distilled water and mix properly before use.

Use chilled TE for DNA isolation process.

25

5% SDS: 5 gm. of Sodium-dodocel sulphate (SDS) (Himedia, Mol.

Wt. = 288.38) was added in autoclaved distilled water and makeup

volume 100 ml. It was mix properly in distilled water before use.

ProtinaseK: 40mg (Thermo Scientific, ~20mg/ml) dissolved in 2 ml

nuclease free water and mix properly before use. Keep in deep

freeze for further use.

5M NaCl: 73.05 gm. Sodium Chloride pellets (Merck, FW = 58.44)

was dissolved in 200 ml distilled water. The total volume was

adjusted to 250 ml with distilled water before autoclave.

3.2.2 The steps for DNA isolation are:

1. 30 whiteflies were thoroughly macerated with a micropestle in a

1.5 ml microcentrifuge tube.

2. Add 500 µl chilled TE, 70µl 5% SDS and 6µl proteinase-K was

added and mixed thoroughly.

3. The samples were incubated in a water bath at 55°C for 30 min.

Meanwhile, the samples were frequently mixed every 10 min to

ensure complete and even extraction.

4. The samples then removed from water bath, add chilled 100µl

(5M) NaCl and invert two times (slowly) properly. Keep the

sample in -20°C deep freeze or on ice cube for 30 min.

5. The samples were then cooling centrifuged for about 10 min at

10,000 rpm.

6. Supernatant so obtained was transferred to a fresh tube.

7. Then an equal (to supernatant) volume of chloroform: isoamyl

alcohol (24:1) v/v was added and mixed thoroughly but gently for

not less than 5 min.

8. The mixture was then centrifuged for about 10 min at 10,000

rpm.

9. Supernatant so obtained was transferred to a fresh tube.

26

10. An equal (to supernatant) volume of (100%) absolute ethanol

was added, mixed gently by inverting tubes and kept for

overnight undisturbed in normal freeze.

11. The mixture was then centrifuged for about 12 min at 10,000

rpm.

12. The supernatant was now discarded.

13. The tubes were placed at room temperature and allowed the

traces of ethanol to evaporate and dry the pellet. Then pellet was

dissolved in 40 µl TE for further use.

3.2.3 DNA Purification

The purification of DNA was carried out in order to remove the

impurities like RNA, proteins and polysaccharides. These are

considers as inhibitors in DNA amplification during PCR. Following

method was followed.

1. 5µl of RNase (5 mg/ml) was added to DNA extract, mixed well and

incubated at 37°C for 30 min.

2. This was followed by the addition of equal volumes of phenol:

chloroform: isoamyl alcohol (25:24:1) v/v and mixed vigorously.

3. The above mixture was centrifuged at 14,000 rpm for 10 min.

4. Supernatant was transferred to a fresh microcentrifuge tube. Equal

volume of pre-chilled ethanol (100%) was added and mixed gently

for DNA precipitation.

5. The precipitated DNA was pelleted by centrifugation at 12,000 rpm

for 5 min.

6. The pellet was dried at room temperature to completely remove

ethanol and was then dissolved in 40µl TE buffer and stored at -

20°C for further use.

3.2.4 Purity of DNA

Purity of DNA was checked by taking the ratio of Optical Density

(O.D) using UV-Spectrophotometer at 260 nm to that of 280 nm. 1ml

27

TE buffer was taken in a cuvette tube and calibrated the UV-

Spectrophotometer at 260 nm as well as 280 nm wavelength. 2µl of

DNA were added to 998μl of TE buffer, mixed properly and the optical

density (O.D) was measured. The samples which had the O.D ratio

between 1.7-1.9 (Maniatis et al., 1982) were used in subsequent

experiments. The DNA samples showing ratio beyond these values

were purified again.

3.2.5 Quantification of DNA

Isolated DNA was quantified by measuring the absorbance at

260 nm and 280 nm on a UV-spectrophotometer. 50µl/ml

concentration of double stranded DNA showed an absorbance of 1 at

260 nm. Concentration of DNA sample was calculated using following

formula:

O.D. 260 nm × 50µl DNA/ml × Dilution factor1000

3.2.6 Quality of DNA

The quality, quantity and integrity of isolated DNA were also

checked by horizontal submarine gel electrophoresis. 4µl of DNA

samples were loaded in each well in agarose gels along with the 1µl

λHind-III standard digested DNA ladder in 0.8% gel concentration at 60

volts for 90 min. The gel was stained by ethidium bromide and

observed under UV-Trans-illuminator. The amount of fluorescence was

proportional to the total mass of DNA. After quantification the DNA was

diluted by TE. The final concentration of DNA obtained was 25ng/µl.

3.2.7 Dilution of DNA

The quantified DNA was diluted according to the DNA quantity in

each sample for PCR amplified in sterile double distilled water.

Dilutions were carried out according to the following formula:

Dilution =Required concentration of DNA (ng/µl) X Total volume required (µl)

Available concentration of DNA (ng/µl)

28

3.3 DNA analysis of Mitochondrial Cytochrome Oxidase I(mtCOI)

The amplification of genomic DNA was carried out by using

mtCOI gene sequence. The COI region of the mtDNA gene was

partially amplified with the CI-J-2195 and L2-N-3014 pair of primers.

Procedure for amplification of DNA was followed as per protocol

described by Rocha et al. (2011). Primer sequences, the components

and their concentration used in the mtCOI-PCR reaction were

prepared as described in Table 3.3.1a and Table 3.3.1b.

Table 3.3.1a: Mitochondrial Cytochrome Oxidase I (mtCOI)primers and their sequences used in the study.

SI Primers Sequences 5’-3’

01 CI-J-2195 (F) TTGATTTTTTGGTCATCCAGAAGT

02 L2-N-3014 (R) TCCAATGCACTAATCTGCCATATTA

Table 3.3.1b: List of components with their concentrations usedfor mtCOI-PCR.

Sl. Components Concentration

1 PCR buffer 1X

2 MgCl2 2.5mM

3 dNTPs 200µM

4 Primer 10pm

5 Taq Polymerase 1Unit

6 Nuclease free H2O -

7 DNA 50ng

3.3.1 PCR conditions for mtCOI primers

The amplification of DNA was done in BIO-RAD T100TM

programmable thermal cycler as program given in table 3.3.1c.

29

Table 3.3.1c: Temperature profile used in PCR Amplification forCI-J-2195 and L2 –N-3014

Steps Temperature (ºC) Duration Cycles Activity

1 94 5 min 1 Initial Denaturation

2 94 30 sec

30

Denaturation

3 45 45 sec Annealing

4 72 1 min Elongation

5 72 10 min 1 Final elongation

6 4 ∞ Storage

3.4 DNA Analysis of Random Amplified Polymorphic DNA(RAPD)

Procedure for amplification of DNA was followed as per protocol

described by William et al. (1990). The component and their

concentration used in the RAPD-PCR reaction were prepared as

described in Table 3.4.

3.4 List of components with their concentrations used forRAPD-PCR

Sl. Components Concentration

1 PCR buffer 1X

2 MgCl2 2.5mM

3 dNTPs 200µM

4 Primer 10pm

5 Taq Polymerase 1Unit

6 Nuclease free H2O -

7 DNA 50ng

3.5 PCR conditions for RAPD primers

The amplification of DNA was done in BIO-RAD T100TM

programmable thermal cycler as program given in Table 3.5.1. The

amplification of genomic DNA was carried out by using 5 random

decamer nucleotide primers in table 3.5.2.

30

Table 3.5.1: Temperature profile used in PCR Amplification forRAPD

Steps Temperature(ºC)

Duration Cycles Activity

1 94 5 min 1 Initial Denaturation

2 94 1 min

45

Denaturation

3 37 1 min Annealing

4 72 2 min Elongation

5 72 5 min 1 Final elongation

6 4 ∞ Storage

Table 3.5.2 RAPD primers and their sequences used in the study

SI. Primer Sequences 5’-3’ GC - Contents %

01 OPH9 GAGGATCCCT 60%

02 OPH16 ACGGTACCAG 60%

03 OPF2 TGTAGCTGGG 60%

04 OPF12 TCTCAGCTGG 60%

05 OPB-11 GTAGACCCGT 60%

31

RESULTS

Whitefly, Bemisia tabaci ranks among the most noxious insects

attacking several field and greenhouse cultivated crops in India.

Biotypes of whitefly cannot be differentiated morphologically. DNA

markers represent very effective tool for analyzing genetic diversity of

any insect. With the known frequencies of each allele in the population

efficient characterization of whitefly could be achieved through

molecular markers.

A total of 17 samples (Table 4.1) of whitefly collected from

different hosts growing in open environments areas from 17 different

geographical regions of East Madhya Pradesh. Apart from collection of

samples of whitefly, mainly from soybean crop whitefly populations

were also collected from green gram, black gram, eggplant and tomato

cultivated nearby soybean field. It is expected that whitefly may use

these plants as alternate hosts during harvesting time of soybean. At

least 200 individual adult whiteflies were collected from each location

for DNA analysis.The whiteflies were morphologically indistinguishable

from those collected from other localities. Collected samples were

used for molecular characterization during the present investigation

with the help of RAPD markers.

DNA fingerprinting or molecular characterization approaches

based on polymerase chain reaction have become methods of choice

for molecular diversity studies. It has distinct advantages to

discriminate samples with similar morphological characters. Being the

dominant marker, RAPD is one of the most common markers used in

the study of insect genetic diversity and characterization. These

markers may detect variation in both coding as well as noncoding

regions of the genome.

32

The results of the present investigation are described as under:

4.1 DNA extraction

4.2 RAPD Analysis

Table 4.1: Populations of whitefly, Bemisia tabaci collected fromvarious host plants in different geographical regionsof East Madhya Pradesh

SI Collection Site Host I Host II

1 Seoni Soybean -

2 Chhindwada Soybean -

3 Betul Soybean Green gram

4 Hoshangabad Soybean -

5 Piparia Black gram -

6 Narsinghpur Soybean Black gram

7 Sagar Soybean -

8 Tikamgarh Soybean -

9 Chhatarpur Soybean Black gram

10 Katni Soybean -

11 Rewa Soybean -

12 Sidhi Soybean -

13 Satna Black gram -

14 Mandla Soybean -

15 Dindori Soybean Black gram

16 Shahdol Soybean -

17 Jabalpur Soybean Eggplant, Tomato

4.1 DNA extraction

A good quality of DNA is prerequisite for any genetic diversity

analysis programme. The present investigation was planned to

standardize DNA isolation protocol for whitefly. Genomic DNA of

whitefly was extracted using following protocols.

33

Cetyl Trimethyl Ammonium Bromide (CTAB) method (Reported)

4-Nonylphenol-polyethylene glycol (Nonidet NP-40) method

(Reported)

Sodium Dodecyl Sulphate (SDS) + Proteinase-K method

(Standardized)

Table 4.1.2: Efficiency of the whitefly DNA extraction method

Factor Method

CTAB Nonidet SDS + Proteinase-K

Quantity Low Very low High

Viscosity High High Low

Pellet Colour White White Transparent

Bands Smeared Smeared Intact

Molecular weight of DNA Low Low High

PCR amplification No No Yes

The DNA obtained from CTAB and Nonidet methods, was not of

enough quantity and the quality was very poor (Fig. 4.1 and Fig. 4.2).

The preparations (including DNA) in the test tubes were highly viscous

and white in color, which showed no or very faint bands (or smears of

the bands) upon gel electrophoresis while there were no amplification

products after PCR analysis. However, the results from the

standardized SDS + Proteinase-K method were encouraging,

especially in case of low amount of samples. The standardized SDS +

Proteinase-K method of genomic DNA extraction from whitefly was

further tested and refined to compare its efficiency in terms of quantity

and quality of the DNA (Table 4.1.2).

DNA was extracted successfully from whitefly samples using

SDS + Proteinase-K protocol standardized in our laboratory. Total DNA

isolated was checked by means of agarose gel electrophoresis (Fig

4.3). High-molecular weight DNA in larger quantities and of good

quality was obtained by standardized protocol. The purity of the DNA

samples was checked by spectrophotometric absorbance (A260/A280)

34

ratio, which was 0.95-2.27 (Table 4.1.3). The standardized protocol

thus yielded DNA of high purity, free from interfering compounds in

further analysis. The DNA obtained was suitable for enzymatic

manipulations such as PCR and showed high intensity amplification

with arbitrary RAPD primers. Genomic DNA was dissolved in TE buffer

and final concentration was made 50ng/µl used for further RAPD

analysis. PCR amplification also indicates that the DNA was of good

quality, free from interfering compounds, and it would be suitable for

other DNA analyses such as restriction, Southern transfer and

hybridization when performing restriction fragment length

polymorphism (RFLP).

Table 4.1.3: Spectrophotometric data of whitefly DNA extractedthrough standardized protocol

SI Nucleic AcidConcentrations

A260(10 mm path)

A280(10 mm path) 260/280 260/230 Factor

1 94.5nglμl 1.891 1.996 0.95 0.14 50

2 81.4nglμl 1.627 1.116 1.46 0.17 50

3 76.5nglμl 1.530 1.540 0.99 0.11 50

4 258.0nglμl 5.160 2.691 1.92 0.43 50

5 293.8nglμl 5.876 2.910 2.02 0.48 50

6 150.0nglμl 2.999 1.449 2.07 0.30 50

7 169.0nglμl 3.379 1.594 2.12 0.33 50

8 158.4nglμl 3.168 1.536 2.06 0.31 50

9 191.9nglμl 3.837 1.898 2.02 0.32 50

10 163.9nglμl 3.277 1.570 2.09 0.32 50

11 171.5nglμl 3.430 1.588 2.16 0.34 50

12 148.9nglμl 2.979 1.399 2.13 0.34 50

13 222.7nglμl 4.453 2.223 2.00 0.40 50

14 120.3nglμl 2.407 1.070 2.25 0.27 50

15 146.1nglμl 2.922 1.396 2.09 0.30 50

16 154.4nglμl 3.091 1.743 1.77 0.61 50

17 110.1nglμl 2.201 0.969 2.27 0.24 50

35

Analysis of mitochondrial cytochrome oxidase I (mtCOI)

Gene mtCOI was used as molecular marker to identify B. tabaci

variant that exhibit rich biological differences. Part of the mitochondrial

cytochrome oxidase I (mtCOI) gene was amplified with pairs of primers

C1-J-2195 (F) and L2-N-3014 (R) specific to COI region of whitefly

were used for PCR amplification. The PCR products derived from all

samples of DNA were of expected size, ~880bp (Fig. 4.4). This

suggested that the primer pair used was specific to COI region of B.

tabaci and could be used to amplify mtDNA region for further analysis.

The presence of mtCOI amplification was visualized by electrophoresis

in 1.2% agarose gel stained with ethidium bromide.

Analysis of RAPD-PCR in all whitefly populations

RAPD analysis is simple technique and can be performed even

in a moderately equipped laboratory. Initially five primers were

screened and a total of three primers were selected on the basis of

sharp and clear banding pattern for final RAPD-PCR analysis. The

PCR reaction was carried out using a single decamer primer at a time.

The sequences of these primers are presented in table 3.5.2.

During the present investigation five decamer primers amplified

8 RAPD marker loci. The size of amplified marker ranged from 100bp-

1000bp. Maximum number of bands i.e. three were scored by primers

OPB-11 while minimum numbers of bands i.e. one produced by OPH-

16.

Out of eight bands scored by RAPD markers, all found to be

monomorphic. Average numbers of bands per primers were 2.0. In this

study, used primers for diversity analysis such as, OPF-02, OPH-09,

OPB-11, OPF-12 and OPH-16 all have same GC contents percentage

(60%). We found OPF-2, OPH-9 and OPB-11 with sharp and clear

band, while OPH-16 RAPD amplified DNA only in five samples. OPF-

12 did not amplify DNA among tested population.

36

Table 4.5: RAPD primers analysis.

SI Primer Total Bands Monomorphic Polymorphic Band Size

1 OPF-02 2 Yes No 250-500bp

2 OPH-09 2 Yes No 500-1000bp

3 OPB-11 3 Yes No 250-1000bp

4 OPF-12 0 NA NA 0

5 OPH-16 1 Yes No 100-250bp

Average 2.00

NA-Not Amplified

During the present investigations results clearly demonstrated

that there was no detectable genetic variation among whitefly, B.

tabaci populations used in this study. Allele frequency could not be

determined among these populations. mtCOI DNA among whitefly

populations in East Madhya Pradesh may be of low divergence and

cannot be used as efficient marker to determine their genetic variation

using RAPD-PCR method.

37

DISCUSSION

The whitefly (Hemiptera: Aleyrodidae) is one of the most

important pest of crops in the world and is a vector of more than 100

plant viruses (Jones et al., 2003). Bemisia tabaci belongs to a group of

insects named whiteflies that is commonly known as different names

based on crops on which it attack e.g. tobacco, cotton or sweet potato

whitefly (Rekha et al., 2005). It (Gennadius) (Hemiptera: Aleyrodidae)

is one of the most devasting tropical and sub-tropical agricultural pests

(Byrne and Bellows, 1991) affecting the yield of a broad range of

agricultural, fiber, vegetable and ornamental crops (Cahill et al., 1996)

and is considered one of the world’s top invasive species (Boykin et

al., 2007). B. tabaci has increased in importance globally as a serious

pest, because of the polyphagous nature of some biotype and the

diverse ways that it damage crops (Rekha et al., 2005).

Genetic diversity analysis is the first and foremost step bio-

control agent improvement programmed against strain of pest or

insects. However, to have a reliable estimate of genetic relationship

and genetic diversity, generally a large number of polymorphic markers

are required. DNA markers are very effective tool for analysing genetic

diversity in any organism.

Genetic diversity analysis is possible using various molecular

markers such as ISSR (Blair et al., 1999), RAPD (Dawson et al., 1993)

and AFLP (Negi et al., 2000) etc. It greatly depends upon type of

markers used, their distribution in the genome, loci they amplify, level

of polymorphism and reproducibility. PCR based molecular markers

(RAPDs, ISSRs, STMSs etc.) are preferred over hybridization based

markers like RFLPs for genetic diversity analysis, because they permit

the use of smaller amount of DNA from each plant or insect being

genotype and also reduce the time, labour and operational cost of DNA

extraction (Sant et al., 1999).

38

The whitefly, Bemisia tabaci populations were collected from

plants growing in open environments areas in different geographical

regions of East Madhya Pradesh during kharif season 2012. A total of

17 populations of whiteflies were collected different geographical

regions.

Prerequisite for taking advantage of these techniques is good

quality of genomic DNA. Whitefly contains small fragment size of DNA,

which make the DNA isolation task more difficult. Different published

protocols were used for whitefly genomic DNA extraction. We used

proteinase-K with SDS in our protocol. The ultimate goal of DNA

extraction is to obtain DNA with high molecular weight and without

impurities. The disruption of cellular and nuclear membrane is the first

necessary step to obtained purified DNA. The detergents

(Surfactants), such as the sodium dodecyl sulfate (SDS) and CTAB,

were adopted to accomplish disruptions but unable to stable DNA for

long time in case of whitefly. CTAB can precipitate genomic DNA, and

it is also popular because of its ability to remove polysaccharides from

bacterial and plant preparations (Ausbel et al., 1998). Published

methods to isolate DNA from insects are not always effective, because

they have high concentrations of phenolics and other secondary plant

compounds in their digestive tracts. Phenolics, as powerful oxidizing

agents, can reduce the yield and purity of DNA by binding covalently

with the extracted DNA, thereby inhibiting further enzymatic processes

of the DNA such as restriction digestion and polymerase chain reaction

(PCR) (Juen and Traugott 2006: Serrano et al., 1999).

The present investigation emphasized to know the effect of

proteinase-K on extracted genomic DNA of the whitefly populations

found that significant effect where as CTAB and Nonidet-40 method

did not show any major impact on total DNA concentration. The

combination of SDS and Proteinase-K was better at separating DNA

from almost all the polysaccharides and protein complexes. Residual

proteins and lipids could readily be removed by extraction with

chloroform-isoamyl alcohol (Merante et al., 1998). Proteinase-K is

39

hydrolytic enzyme which acts by hydrolyzing peptide bonds and exhibit

a wide range of cleavage preferences. The Proteinase-K can also be

used as a protective agent during DNA extraction, by inactivating

endogenous nucleases which are responsible for degradation of DNA.

Sodium Dodecyl Sulphate (SDS) with Proteinase-K gave good

quality and quantity of DNA. Whereas, other tried protocols using

different chemicals such as Nonidet NP-40 (Gupta et al., 2010) and

CTAB didn’t produce DNA with enough quantity. The isolated DNA

samples with all protocols were run on 0.8% agarose gel. DNA isolated

by standardized protocol (SDS + Proteinase-K) produce intact band of

high molecular weight whereas, DNA from other protocols produced

smears that was due to low quantity of DNA with contamination of

interfering compounds. Similarly, Helmi (2010) also found good quality

of DNA with SDS method but DNA was not stable for long time.

However DNA isolated from using standardized protocol was of

enough quality 100-150μg/g and good quality. The genomic DNA

isolated by protocol standardized by us was stable for long time.

The biotypes of B. tabaci are important because they act as a

major vector of many plant viruses in many parts of the world.

Therefore, there is a need to understand the prevalence of vector

biotypes under local conditions. For identification of whitefly biotype

used the Mitochondrial Cytochrome Oxidase I (mtCOI) molecular

marker, we used the PCR condition as mentioned by Rocha et al.

(2011). The PCR products which derived from all samples of DNA

were of expected size, ~880bp. Our result was in accordance with

Rocha et al. (2011). They also found ~880bp amplified product in B

biotype when they used mtCOI primers during their study on whitefly.

This suggested that the primer pair used was specific to COI region of

B. tabaci and could be used to amplify COI region for further analysis.

Which indicate the presence of B biotype population in East Madhya

Pradesh.

During this study, RAPD markers were used for diversity

analysis among identified B biotypes. Random amplified polymorphic

40

DNA polymerase chain reaction (RADP-PCR) is a relatively simple,

inexpensive and rapid technique, revealing polymorphisms which are

useful as genetic and taxonomic markers (Welsh and McClelland,

1990). RAPD has been applied to study of insects (Haymer, 1994) and

to differentiate whiteflies, including the identification of different

biotypes of B. tabaci (Guirao et al., 1997; De Barro and Driver, 1997;

Cervera et al., 2000; Moya et al., 2001).

During present investigation, five reported RAPD markers

(Calvert et al., 2001) were screened for PCR amplification, out of

these, 3 RAPD primers were selected, based upon their sharp and

multiple banding pattern using two accessions of whitefly. These three

markers amplified all samples. One RAPD marker OPH-16 amplified

only five samples (1, 2, 3, 4 and 13). Eight marker loci were amplified

by four decamer primers; Average numbers of bands per primers were

2.00. Good and clear banding profile has been obtained by primers

with 60% GC content. Fritsch et al. (1993) also demonstrated the

importance of the GC contain of primers on the yield of PCR amplified

products. All markers amplified monomorphic bands among all B

biotypes.

In the aspect of genetic variability study due to host plants in B.

tabaci populations no variation was found in our study whereas,

Sharma et al. (2008) detected genetic variability due to host plants in

B. tabaci populations that collected from six different host plants using

RAPD-PCR. Perumal et al. (2009) also found differences among B.

tabaci populations collected from four different host plants.

RAPD markers represent an efficient and inexpensive way to

generated molecular data and thus have been used successfully in

various taxonomic polygenetic studies (Aboelwafa et al., 1995; Sharma

et al., 1995; Friesen et al., 1997; Smelcerovic et al., 2006). RAPD

markers are generated by PCR amplification of random genomic DNA

segments with single primer in an arbitrary sequence. They are usually

dominant markers with polymorphism between individual defined by

41

the presence or absence of a particular RAPD band (Staub et al.,

1993).

Results clearly demonstrated that there was no detectable

genetic variation among whitefly, B. tabaci populations used in this

study. Allele frequency could not be determined among these

populations. Whitefly populations of Eastern part of Madhya Pradesh

may be of low divergence or mtCOI DNA cannot be used as efficient

marker to determine their genetic variation using RAPD-PCR method.

It seems that B. tabaci found in the regions of collection are of

conserved type.

42

SUMMARY, CONCLUSIONS AND SUGGESTIONS FORFUTHER WORK

6.1 Summary

The present study entitles “Molecular Diversity Analysis of

Whitefly (Bemisia tabaci) Collected from Different Regions of Madhya

Pradesh” was carried out with the objectives to standardize genomic

DNA isolation method and analyze the genetic diversity of whitefly

using DNA fingerprinting.

This study aimed to employ DNA based method to clarify the

existing of biotype among whitefly populations in East Madhya

Pradesh, India. The genomic DNA of whitefly collected from different

geographical regions of East Madhya Pradesh was isolated by

standardize protocol (SDS + Proteinase-K) produce intact band with

high molecular weight. The mtCOI primer was used for identification of

B biotype. Amplified products were resolved by electrophoresis on

1.2% agarose gel and photographed under gel documentation system.

Specific mtCOI primer CI-J-2195 and L2-N-3014 showed the presence

of ~880bp bands which confirmed the presence of B biotype in

different geographical regions of East Madhya Pradesh.

All identified B biotypes were used for molecular diversity

analysis. The DNA samples were amplified with 5 RAPD primers in

thermal cycler. Amplified products were resolved by electrophoresis on

1.2% agarose gel and photographed under gel documentation system.

Four decamer primers amplified 8 RAPD marker loci. All 8 bands

scored by RAPD markers found to be monomorphic. Average number

of bands per primer was 2.00. One RAPD primer is not amplified in all

population. No variation was found among whitefly samples collected

from different geographical regions of East Madhya Pradesh.

43

6.2 Conclusion

Whitefly, Bemisia tabaci populations genomic DNA extracted

through standardized protocol (SDS + Proteinase-K) at Biotechnology

Centre, JNKVV, Jabalpur, get a good results for further analysis.

These genomic DNA were analyzed by mtCOI and RAPD molecular

markers. This COI gene fragment is sequence marker used for to

identify B. tabaci variant that exhibit rich biological differences, but lack

in morphological features. It is a variable region that serves as fast

clock of evolution. The COI region of the mt DNA gene was partially

amplified with the CI-J-2195 and L2-N-3014 pair of primers. The

analysis of PCR with mtCOI primers provided amplification of the

expected size of ~880bp. This band size showed the presence of “B”

biotype in 17 different geographical regions of East Madhya Pradesh,

India.

A total four RAPD primers were used to show the genetic

diversity between the whiteflies collected from 17 different

geographical regions of East Madhya Pradesh. A total of 8 bands were

generated by 4 RAPD primers. All of them were monomorphic. The

amplification of monomorphic bands showed 100% genetic similarity

among all “B” biotypes in Eastern part of Madhya Pradesh.

6.3 Suggestion

1) An intensive survey is required for the identification of biotype of

Bemisia tabaci.

2) For more reliable data and for assessing genetic diversity, more

number of primers (RAPD) and more stringent molecular markers

such as SSR and AFLP should be applied.

3) More genotypes can be used for diversity analysis using RAPD

markers.

44

REFERENCES

Abdullahi, I., S. Winter, G.I. Atiri and G. Thottappilly (2013). Molecularcharacterization of whitefly, Bemisia tabaci (Hemiptera:Aleyrodidae) populations infesting cassava. Bull. Entomol. Res.,93(2): 97-106.

Abo-elwafa, A.K. Murai and T. Shimada (1995). Intra and interspecificvariations in Lens revealed by RAPD markers. Theor. Appl.Genet., 90: 335-340.

Ausbel, M., R. Brent, R.E. Kingston, D.D Moore, J.G Seidman and K. Struhl(1998). Curr. prot. Mol. Biol, Wiley and Sons, New York, 561-563.

Banks, G.K., J. Colvin, R.K.C. Reddy, N.M. Maruthi, V. Muniyappa, M.HVenkatesh, M.K. kumar, S.A. Padmaja, J.F. Beitia and F.S.Seal (2001). First report of B. tabaci, B-biotype in India and anassociated tomato leaf curl virus disease epidemic. Plant. Dis.,85: 231.

Bedford, I. D., P.G. Markham, J.K. Brown and R.C. Rosell (1994).Geminiviruses transmission and biological characterization ofBemisia tabaci (Gennadius) from different geographic regions.Ann. Appl. Bio., 125: 311-325.

Bel-Kadhi, M.S., J.C. Onillon and J.L. Cenis (2008). Molecularcharacterization of Bemisia tabaci biotypes in Southern Tunisia.Tunisian J Plant Prot., 3: 79-85.

Bell-Johnson, B.B., G.G. Johnson, J. Meksem and D.A. Lightfoot (1998).Methods for high-throughput marker assisted selection forsoybean. Soybean Genet. News., 25: 115-118.

Bertolani, R., S. Garagna, G.C. Manicardi, L. Rebecchi and C.A. Redi (1994).New data on the nuclear DNA content in some species oftardigrades. In: R. Argano, C. Cirotto, E. Grassi Milano and L.Mastrolia (Eds), Contributions to Animal Biology, HalocynthiaAssociation, Palermo. 103-109.

Bethke, J.K., F.J. Byrne, G.S. Hodges, C.L. Mckenzie and R.G. Shatters Jr.(2009). First record of the Q biotype of the sweetpotato whitefly,Bemisia tabaci, in Guatemala. Phytoparasitica, 37: 61-64.

Bink-Moenen, R.M. (1983). Revision of the African whiteflies (Aleyrodidae)mainly based on collection from Tchad. Monografieen van deNederlandse Entomol. Enw., 10: 273-287.

Bink-Moenen, R.M. (1990). Whiteflies: Diversity, Biosystematics andEvolutionary Patterns: Whiteflies: their Bionomics, Pest Statusand Management (ed. by D Gerling) Intercrop Ltd., Andover,Hants, UK., 1-11.

Bink-Moenen, R.M. and L.A. Mound (1990). Whiteflies: Diversity,biosystematics and evolutionary patterns: Whiteflies: theirbionomics, pest status and management (ed. by D. Gerling)Intercept, Andover, UK.1-11.

45

Bird, J. (1957). A whitefly transmitted mosaic of Jatropha gossypifolia. Univ.Puerto Rico, Agric. Exp. Stn., 22: 35.

Bird, J. and K. Maramorosch (1978). Viruses and virus diseases associatedwith whiteflies. Adv. Virus. Res., 71: 233-260.

Blair, M.W., O. Panaud and S.R. McCouch (1999). Inter-simple sequencerepeats (ISSR) amplification for analysis of microsatellite motiffrequency and fingerprinting in rice (Oryza sativa L.). Theor.Appl. Genet., 98: 780-792.

Bosco, D., A. Loria, C. Sartor and J.L. Cenis (2006). PCR-RFLP Identificationof Bemisia tabaci Biotypes in the Mediterranean Basin.Phytoparasitica, 34(3): 243-251.

Boykin, L.M., R.G. Shatters Jr, R.C. Rosell, C.L. Mckenzie, R.A. Bagnall,P.D. Barro and D.R. Frohlich (2007). Global relationships ofBemisia tabaci (Hemiptera: Aleyrodidae) revealed usingBayesian analysis of mitochondrial COI DNA sequences. Mol.Phylogenet. Evol., 44: 1306-1319.

Brown, J.K. (2000). Molecular markers for the identification and globaltracking of whitefly vector-begomovirus complexes. Virus Res.,71: 233-260.

Brown, J.K., D.R. Frohlich and R.C. Rosell (1995). The sweetpotato orsilverleaf whiteflies: biotypes of Bemisia tabaci or a speciescomplex? Ann. Rev. Entomol., 40: 511-534.

Buckner, J.S., D.R. Nelson and M.C. Mardaus (1994). The lipid-compositionof the wax particles from adult whiteflies, Bemisia tabaci andTrialeurodes vaporariorum. Insect. Bioch. Mol. Biol., 24: 977-987.

Burban, C., L.D.C. Fishpool, C. Fauqet, D. Fargette, and J.C. Thouvenel(1992). Host associated biotypes within West Africanpopulations of the whitefly Bemisia tabaci (Genn.), Hom.Aleyrodidae. J. App. Entomol., 113: 416-425.

Butler, G.D. Jr., T.J. Henneberry and W.D. Hutchison (1986). Biology,sampling and population dynamics of Bemisia tabaci., In G.E.Russell, ed. Agric. Zool. Rev., Intercept, UK. 17-28.

Byrne, D.N. and N.F. Hadley (1988). Particulate surface waxes of whitefliesmorphology, composition and waxing behavbiour. Physiol.Entomol., 13: 267-276.

Byrne, D.N. and T.S. Bellows Jr (1991). Whitefly biology. Ann. Rev. Entomol.,36: 431-457.

Byrne, D.N., A.C. Cohen and E.A. Draeger (1990). Water uptake from planttissue by the egg pedicel of the greenhouse whitefly,Trialeurodes vaporariorum (Westwood) (Homopter: Alyrodidae).Can. J. Zool., 68: 1193-1195.

Cahill, M., I. Denholm, G. Rose, K. Gorman and D. Johnston (1996).Relationship between bioassay data and the simulated fieldperformance of insecticides against susceptible and resistantBemisia tabaci. Bull. Entomol. Res., 86: 109-116.

Callejas, C., F.J. Beitia, A. Gobbl, A. Velasco and M.D. Ochando (2005). Theuse of RAPD markers to detect genetic patterns in Aleurodicus

46

disperses (Hemiptera: Aleyrodidae) populations from theCanary Islands. Eur. J. Entomol., 102: 289-291.

Calvert, L.A., M. Cuervo, J.A. Arroyave, L.M. Constantino, A. Bellotti and D.Frohlich (2001). Morphological and mitochondrial DNA markeranalyses of whiteflies (Homoptera: Aleyrodidae) colonizingcassava and beans in Colombia. Ann. Entomol. Soc. Am., 94:512-519.

Cambell, B.C. (1993). Cogurent evolution between whiteflies (Homoptera:Aleyrodidae) and their bacterial endosymbionts based onrespective 18S and 16S rDNAs. Curr. Microbiol., 26: 129-132.

Cambell, B.C., J.D. Seffen-Cambell and R.J. Gill (1994). Evolutionary originof whiteflies (Hemiptera: Sternorrhynchi: Aleyroididae) inferredfrom 18S rDNA sequences. Insect. Mol. Biol., 3(2): 73-88.

Cambell, B.C., J.D. Seffen-Cambell, and R.J. Gill (1996). Origin and radiationof whiteflies: an initial molecular phylogenetic assessment. In D.Gerling and R.T. Mayer, eds. Bemisia: 1995 Taxonomy,Biology, Damage, Control, and Mangement. Intercept Ltd.,Andover, Hants, UK. 29-51.

Cervera, M.T., J.A. Cabezas, B. Simon, J.M.M. Zapater, F. Beitia and J.L.Cenis (2000). Genetic relationships among biotypes of Bemisiatabaci (Hemiptera: Aleyrodidae). Bull. Entomol. Res., 90: 391-396.

Chu, D., C.S. Gao, P.D. Barro, F.H. Wan, Y.J. Zhang (2011). Investigation ofthe genetic diversity of an invasive whitefly (Bemisia tabaci) inChina using both mitochondrial and nuclear DNA markers. Bull.Entomol.Res., 101(4): 467-475.

Chu, D., G. Liu, F. Wan, Y. Tao and R. Gill (2010). Phylogenetic analysis andrapid identification of the whitefly, Bemisia afer, in china. J.Insect. Sci., 10(86): 1-9.

Claridge, M.F., H.A. Dawah and M.R. Wilson (1997). Species in insectherbivores and parasitoids-sibling species, host races andbiotypes. In M.F. Claridge, A. Dawah and M.R. Wilson, eds.Species, The Units of Biodiversity. Chapman and Hall, London.247-272.

Cock, M.J.W. (1986). Bemisia tabaci, a literature survey on the cottonwhitefly with an annotated bibliography. CAB IIBC, SilwoodPark, UK, 121.

Cohen, S. (1990). Epidemiology of Whitefly-Transmitted Viruses: Whiteflies:their Bionomics, Pest Status and Management (ed. by D.Gerling) Intercept Ltd., Andover, Hants, UK., 211-225.

Connoly, A.G., I.D. Godwin, M. Cooper and I.H. Delacy (1994). Interpretationof randomly amplified polymorphic DNA marker data forfingerprinting sweet potato (Ipomoea batatas L.) genotypes.Theor. Appl. Genet., 88: 332-336.

Costa, A.S. and M. Russell (1975). Failure of Bemisia tabaci to breed oncassava plants in Brazil (Homoptera: Aleyrodidae). Ciencia.Cultura., 27: 388-390.

47

Costa, H.S. and J.K. Brown (1990). Variability in biological characteristicisozyme patterns and virus transmission among population ofBemisia tabaci Genn. in Arizona. Phytopathology, 80: 888.

Costa, H.S. and J.K. Brown (1991). Variation in biological characteristics andesterase patterns among populations of Bemisia tabaci, and theassociation of one population with silverleaf symptom induction.Entomol. Exp. Appl., 61: 211-219.

Costa, H.S., J.K. Brown and D.N. Byrne (1991). Life history traits of thewhitefly, Bemisia tabaci (Homoptera:Aleyrodidea) on six virus-infected or healthy plant species. Environ. Entomol., 20: 1102-1107.

Dangi, R.S., L. Meena, L.B. Choudhari, P.K Ranjekar and V.S. Gupta (2004).Assessment of genetic diversity in Trigonella foenum-graecumand Trigonella caerulea using ISSR and RAPD markers. BMCPlant Bio., 47: 4-13.

Dawson, I.K., K.J. Chalmers, R. Waugh and W. Powell (1993). Detection andanalysis of genetic variation in Hordeum spontaneumpopulations from Isreal using RAPD markers. Mol. Ecol., 2: 151-159.

De Barro, P.J. and F. Driver (1997). Use of RAPD-PCR to distuinguish the Bbiotype from other biotypes of Bemisia tabaci (Gennadius)(Hemiptera:Aleyrodidae). Aust. J. Entomol., 36: 149-152.

De Barro, P.J., F. Drive, J.W. Trueman and J. Curran (2000). Phylogeneticrelationships of world populations of Bemisia tabaci(Gennadius) using ribosomal ITS1. Mol. Phylogenet. Evol., 16:29-36.

De Barro, P.J., J.W.H. Trueman and D.R. Frohlich (2005). Bemisia argentifoliiis a race of B. tabaci (Hemiptera: Aleyrodidae): the moleculargenetics differentiation of B. tabaci populations around theworld. Bull. Entomol. Res., 95: (3) 193-203.

De Barro, P.J., W. Liebregts and M. Carver (1998). Distribution and identity ofbiotypes of Bemisia tabaci (Gennadius) (Hemiptera:Aleyrodidae) in member countries of the sacretariat of thePacific Community. Aust. J. Entomol., 37: 214-218.

Delatte, H., B. Reynaud, M. Granier, L. Tharnary, J.M. Lett, R. Goldbach andM. Peterschmitt (2005). A silverleaf-inducing biotype Ms of B.tabaci (Hemiptera: Aleyrodidae) indigenous to the islands of theSouth-West Indian Ocean. Bull. Entomol. Res., 95(1): 29-35.

Dennehy, T.J., B.A. DeGain and V.S. Harpold (2008). Biotype designationsand Insecticide susceptibility of south-western Bemisia tabaci.Veg. Rep., 152.

Dinsdale, A., L. Cook, C. Riginos, Y.M. Buckley, P. De Barro (2010). Refinedglobal analysis of Bemisia tabaci (Hemiptera: Sternorrhyncha:Aleyrodoidea: Aleyrodidae) Mitochondrial cytochrome oxidase 1to identify species level genetic boundaries. Ann. Entomol. Soc.Am., 103: 196-208.

Dowell, R.V. (1990). Integrating biological control of whiteflies into cropmanagement systems. In D. Gerling, ed. Whiteflies, their

48

Bionomics, Pest Status and Management. Intercept, Andover,UK., 315-335.

Dudley, W., A. Sanghai-Maroof and G.K. Rufner (1992). Molecular markerinformation and selection of parents in corn breeding programs.,Crop Sci., 32: 301-304.

Fontes, F.V.H.M., C.A. Colombo and A.L. Lourencao (2010). Molecularcharacterization and genetic divergence of Bemisia tabaci(Genn.) (Hemiptera: Aleyrodidae) on different crops andgrowing areas. Neotrop. Entomol., 39: 221-226.

Friesen, V.L., B.C. Congdon, H.E. Walsh and T.P. Birt (1997). Intron variationin marbled murrelets detected using analysis of single-strandedconformational polymorphism. Mol. Eco., 6: 1047-1058.

Fritsch, P., M.A. Hanson, C.D. Spore, P.E. Pack and L.H. Risebeg (1993).Consistancy of RAPD primer amplification strength amongdistantly related taxon of flowering plants. Plant Mol. Biol Rep.,11: 10-20.

Frohlich, D.R., I. Torres-Jerez, I.D. Bedford, P.G. Markham and J.K. Brown(1999). A phylogeographical analysis of the Bemisia tabacispecies complex based on mitochondrial DNA markers. Mol.Entomol., 8: 1683-1691.

Fujiie, A., A.M.S. Omar, A.B. Sawas, A. Abbas, M.A. Hadi, E.A. Sawas, A.Barakat, S. Ueda and K.T. Natsuaki (2009). Geographicdistribution of Bemisia tabaci biotypes collected from autumn-cultured potato fields in Syria. J. ISSAAS., 15(2): 12-20.

Garagna, S., L. Rebecchi and A. Guidi (1996). Genome size variation inTardigrada. Zool. J. Linn. Soc., 116: 115-121.

Gawal, N.J. and A.C. Bartlett (1993). Characterization of differences betweenwhiteflies using RAPD-PCR. Insect. Mol. Biol., 2(1): 33 – 38.

Greathead, A.H. (1986). Host plants. In M.J.W. Cock, ed. Bemisia tabaci-Aliterature Survey on the Cotton Whitefly with an AnnotatedBibliography. CAB International Institutes, Biological Control.Silwood Park, UK. 17-26

Guirao, P., F. Beitia and J.L. Cenis (1997). Biotype determination of Spanishpopulations of Bemisia tabaci (Hemiptera: Aleyrodidae). Bull.Entomol. Res., 87: 587-593.

Gupta, V.K., R. Sharma, V. Jindal and V.K. Dilawari (2010). SCAR markersfor identification of host plant specificity in whitefly, Bemisiatabaci (Genn). Indian J. of Biotechnol., 9: 360-366.

Hameed, S., S. Hameed, M. Sadia and S.A. Malik (2012). Genetic diversityanalysis of Bemisia tabaci populations in Pakistan using RAPDmarkers. Mol. Biol. Genet., 15(6): 5.

Hasan, H.S. (2006). Survey of Bemisia tabaci (Gennadius) (Homoptera:Aleyrodidae) Biotypes in Japan using RAPD markers. J.Entomol., USA. 3(4): 290-297.

Haymer, D. (1994). Arbitrary (RAPD) primer sequences used in insectstudies. Insect Mol. Bio., 3(3): 191-194.

Helmi, A. (2010). Host plants-associated population variations of Bemisiatabaci (Genn.) (Hemiptera: Sternorrhyncha: Aleyrodidae)

49

characterized random DNA markers. Mun. Entomol. Zool., 5(2):677-683.

Hoddle, M.S., R.G.V. Driesche and J.P. Sanderson (1998). Biology and useof the whitefly parasitoid Encarsia formosa. Ann. Rev. Entomol.,43: 645-669.

Horowitz, A.R., I. Denholm, K. Garman, J.L. Cenis, S. Kontsedalov and I.Ishaaya (2003). Biotype Q of Bemisia tabaci Identified in Israel.Phytoparasitica, 31(1): 94-98.

Hsieh, C.H., C.H. Wang and C.C. Ko (2007). Evidence from molecularmarkers and population genetics analyses suggests recentinvasion of the western north pacific region by biotype B and Qof Bemisia tabaci (Gennadius). Environ. Entolmol., 36(4): 952-961.

Jena, K.K. (2000). DNA markers, polymorphism and applications in cropimprovement. In: Proc. Of delivered lectures during 2nd markersassisted selection MAS training programme. August 30-Sept.14.

Jones, D.R. (2003). Plant viruses transmitted by whiteflies. Eur. J. PlantPath., 109: 195-219.

Joshi, S.P., P.K. Ranjekar and V.S. Gupta (1999). Molecular markers in plantgenome analysis. Plant Molecular biology Group, Division ofBiochemical Sciences, National Chemical Laboratory, Pune.

Juen, A and M. Traugott (2006). Amplification facilitators and multiplex PCR:tools to overcome PCR-inhibition in DNA-gut-content analysis ofsoil-living invertebrates. Soil Biol. Biochem., 38: 1872-1879.

Kheinmeesook, P. (1997). Insect pests of vegetables. Entomology andZoology Division, Ministry of agriculture, Bangkok.

Lacey, L.A., J.J. Fransen, R. Carruthers (1996). Global distribution ofnaturally occurring fungi of Bemisia, their biologies and use asbiological control agents. In: D. Gerling, R.T Mayer, (Eds.),Bemisia 1995-Taxonomy, Biology, Damage, Control andManagement. Intercept, Andover, UK. 401-433.

Lander, E.S. and D. Botstein (1989). Mapping mendelian factors underlyingQTL using RFLP linkage maps. Genetics, 121: 185-199.

Lee, S.H., M.A. Bailey, M.A.R. Mian, T.E. Carter, D.A. Ashley, D.A. Hussey,W.A. Parrot and H.R. Boerma (1996). Molecular markersassociated with soybean lodging. Crop Sci., 36: 728-735.

Li, Z., D. Hu, Y. Song and Z. Shen (2005). Molecular differentiation of the Bbiotypes of Bemisia tabaci (Hemiptera: Aleyrodidae), based oninternally transcribed spacer 1 sequences. Eur. J. Entomol.,102: 293-297.

Lima, L.H.C., D. Navia, P.W. Inglis and M.R.V. de Oliveira (2000). Survey ofBemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) biotypesin Brazil using RAPD markers. Genet. Mol. Biol., 23(4): 781-785.

Lima, L.H.C., L. Campos, M.C. Moretzsohn, D. Navia and M.R.V. de Oliveira(2002). Genetic diversity of Bemisia tabaci (Genn.) Populations

50

in Brazil revealed RAPD markers. Genet. Mol. Biol., 25(2): 217-223.

Lioyd, L.L. (1922). The control of the greenhouse whitefly (Asterochitonvaporariorum) with notes on its biology. Ann. Appl. Biol., 9: 1-32.

Litt, M. and A. Luty (1989). A hyper variable microsatellite revealed by in vitroamplification of a dinucleotide repeat within the cardiac muscleactin gene. Am. J. Human Genet., 44: 397-401.

Lourencao, A.L. and H. Nagai (1994). Outbreaks of Bemisia tabaci in the SaoPaulo State, Brazil. Bragantia 53: 53-59. (in Portuguese withabstract in English).

Ma, G.C., X. Wu, C.L. Ma, H.L. Wu, H.Y. Hu, L.M. Niu and Y.G. Fu (2011).Isolation and characterization of polymorphic microsatellite lociin Aleurodicus disperses (Hemiptera, Aleyrodidae). Genet. Mol.Res., 10(4): 2523-2526.

Markert, C.L. and F. Moller (1959). Multiple forms of enzymes: tissue,ontogenetic and species-specific patterns. Proc. Natl. Acad Sci.,45: 753-763.

Martin, J.H. (1985). The Whiteflies of New Guinea. Bull. British Mus. Nat.Hist., 50(3): 303-351.

Martin, J.H. (2004). Whiteflies of Belize (Hemiptera: Aleyrodidae). Part 1-Introduction and account of the subfamily AleurodicinaeQuaintance and Baker. Zootaxa., 3: 119.

Martin, J.H., D. Mifsud and C. Rapisarda (2000). The whiteflies (Hemiptera:Aleyrodidae) of Europe and the Mediterranean Basin. Bull.Entomol. Res., 90: 407-448.

Mckenzie, C.L., G. Hodges, L.S. Osborne, F.J. Byrne and R.G. Shatters(2009). Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae)biotypes in Florida-investigating the Q Invasion. J. Econ.Entomol., 102(2): 670-676.

Merante, F., S. Raha and M. Ling (1998). Isolation of total cellular DNA fromtissues and cultured cells. In: Rapley R, Walker J, editors.Molecular biomethods handbook. Totawa: Human Press Inc.; 9-16.

Morgan, T.H. (1911). Random segregation versus coupling in mendelianInheritance. Sci., 34: 384-397.

Mound, L. and S. Halsey (1978). Whitefly of the World: A SystematicCatalogue of the Aleyrodidae (Homoptera) with Host Plant andNatural Enemy Data. British Museum Natural History, London.

Moya, A., P. Guirao, D. Cifuentes, F. Beitia and J.L. Cenis (2001). Geneticdiversity of Iberian populations of Bemisia tabaci (Hemiptera:Aleyrodidae) based on random amplified polymorphic DNA-polymerase chain reaction. Mol, Ecol, 10: 891-897.

Mugerwa, H., M.E.C. Rey, T. Alicai, E. Ateka, H. Atuncha, J. Ndunguru andP. Sseruwagi (2012). Genetic diversity and geographicdistribution of Bemisia tabaci (Gennadius) (Hemiptera:Aleyrodidae) genotypes associated with cassava in East Africa.Ecol. Evol., 2(11): 2749-2762.

51

Negi, M.S., A. Singh and M. Lakshmikumaran (2000). Genetic variation andrelationship among and within Withania species as revealed byAFLP markers. Genome, 43: 975-980.

Paterson, A.H., C.L. Brubaker and F. Wendel (1993). A rapid method forextraction of cotton (Gossypium spp.) genomic DNA suitable forRFLP or PCR analysis. Plant Mol. Res., 11: 122-127.

Perring, T.M. (2001). The Bemisia tabaci species complex. Crop Prot., 20:725-737.

Perring, T.M., R.J. Rodriguez, C.A. Farrar and T.S. Bellows Jr. (1993).Identification of whitefly species by genomic and behaviouralstudies. Sci., 259: 74-77.

Perumal, Y., M. Marimuthu, A.P. Salim and B. Ponnusamy (2009). Host PlantMediated Population Variations of Cotton Whitefly Bemisiatabaci Gennadius (Aleyrodidae: Homoptera) Characterized withRandom DNA Markers. Am. J. Biochem. Biotechnol., 5(1): 40-46.

Qiu, B., Y. Chen, L. Liu, W. Peng, X. Li, M.Z. Ahmed, V. Mathur, Y. Du and S.Ren. (2009). Identification of three major Bemisia tabacibiotypes in China based on morphological and DNApolymorphisms. Prog. Nat. Sci., 19: 713-718.

Rabello, A.R., P.R. Queiroz, K.C.C. Simoes, C.O. Hiragi, L.H.C. Lima, M.R.V.Oliveira and A. Mehta (2008). Diversity analysis of Bemisiatabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1rDNA region. Genet. Mol. Biol., 31(2): 585-590.

Rafalski, A. and S. Tingey (1993). RFLP map of soybean (Glycine max)2N=40. In: O’Brien S. J. (ed.) Genetic maps: Locus maps ofcomplex genomes. Cold Spring Harbor Laboratory Press, NewYork, 6: 149-156.

Redi, C.A. and S. Garagna (1987). Cytochemical evaluation of the nuclearDNA content as a tool for taxonomical studies in eutardigradesIn: R. Bertolani (Ed.), Biology of Tardigrades. SelectedSymposia and Monographs, U.Z.I., 1. Mucchi Editore, Modena,Italy: 73-80.

Rekha, A.R., M.N. Maruthi, V. Muniyappa and J. Colvin (2005). Occurrenceof three genotype clusters of Bemisia tabaci and the rapidspread of the B biotype in South India. Entomol. Exp. Appl.,117: 221-233.

Rocha, K. C.G., J.M. Marubayashi, J.N. Castillo, V.A. Yuki, C.F. Wilcken,M.A. Pavan and R.K. Sakate (2011). Only the B biotype ofBemisia tabaci is present on vegetables in Sao Paulo State,Brazil. Sci. Agric. (Piracicaba, Braz.), 68(1): 120-123.

Rosell, R.C., I.D. Bedford, D.R. Frohlich, R.J. Gill and J.K. Brown (1997).Analysis of morphological variation in distinct populations ofBemisia tabaci (Homoptera: Aleyrodidae). Ann. Entomol. Soc.Am., 90: 575-589.

Sant, V.J., A.G. Patankar, N.D. Sarode, L.B. Mhase, M.N. Sainani, R.B.Deshmukh, P.K. Ranjekar and V.S. Gupta (1999). Potential ofDNA markers in detecting divergence and in analyzing

52

heterosis in Indian elite chickpea cultivars. Theor. Appl. Genet.,98: 1217.

Scott, I.A.W., P.J. Workman, G.M. Drayton, and G.M. Burnip (2007). Firstrecord of bemisia tabaci biotype Q in New Zealand. NewZealand Plant Prot., 60: 264-270.

Secker, A.E., I.A. Bedford, P.G. Markham, and M.E.C. William (1998).Squash, a reliable field indicator for the presence of B biotype oftobacco whitefly, Bemisia tabaci, 837-478.

Serrano, M.G., L.R. Nunes, M. Campaner, G.A. Buck, E.P. Camargo (1999).Trypanosomatidae: Phytomonas detection in plants andphytophagous insects by PCR amplification of a genus-specificsequence of the spliced leader gene. Exp. Parasitol., 91: 268-279.

Sharma, P.C., P. Winter, T. Bunger, B. Huttel, F. Weigand, K. Weising and G.Kahl (1995). Abundance and polymorphism of di-tri- and tetranucleotide tandem repeats in chickpea (Cicer arientinum L.).Theor. Appl. Genet., 90: 90-96.

Sharma, R.K., V.K. Gupta, J. Jindal and V.K. Dilawari (2008). Hostassociation genetic variations in whitefly, Bemisia tabaci(Genn.). Indian J. Biotechnol., 7: 366-370.

Shatters, R.G., C.A. Powell, L.M. Boykin, H. Liansheng and C.L. Mckenzie(2009). Improved DNA Barcoding Method for Bemisia tabaciand Related Aleyrodidae: Development of Universal andBemisia tabaci Biotype-Specific Mitochondrial CytochromeOxidase I Polymerase Chain Reaction Primers. J. Econ.Entomol., 102(2): 750-758.

Smelcerovic, A., V. Verma, M. Spiteller, S.M. Ahad, S.C. Puri, G.N. Qazi(2006). Phytochemical analysis and genetic characterization ofsix Hypericum Species from Serbia, Phytochemistry, 67: 171-178.

Smith, H.A., R. McSorley and J.A.S. Izaguirre (2001). Effect of intercroppingcommon bean with poor hosts and non-hosts on numbers ofimmature whiteflies (Homoptera: Aleyrodidae) in the SalamaValley, Guatemala. Environ. Entomol., 30: 89-100.

Staub, I., C. Lemme, S. Sondur, M.B. Morsidae and R. Manshardt (1993).Using randomly amplified polymorphism DNA for evaluatinggenetic relationship among papaya cultivars. Theor. Appl.Genet., 80: 697-701.

Stiles, J.I., C. Lemme, S. Sondur, M.B. Morsidi and R. Manshardt (1993).Using randomly amplified polymorph DNA for evaluating geneticrelationships among papaya cultivars. Theor. Appl. Genet., 85:697-701.

Tsagkarakoua, A., C.S. Tsigenopoulosa, K. Gormana, J. Lagnela and I.D.Bedforda (2007). Biotype status and genetic polymorphism ofthe whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) in Greece:mitochondrial DNA and microsatellites. Bull. Entomol. Res.,97(1): 29-40.

53

Ueda, S. and J.K. Brown (2006). First report of the Q Biotype of Bemisiatabaci in Japan by Mitochondrial Cytochrome Oxidase Isequence analysis. Phytoparasitica, 34(4): 405-411.

Valley, G.E., A.L. Lourencao, M.I. Zucchi, J.B. Pinheiro and A.G. Abreu(2011). mtDNA variability in whitefly (Bemisia tabaci)populations in Brazil. Genet. Mol. Res., 10(3): 2155-2164.

Welsh and M. McClelland (1990). Fingerprinting genomes using PCR witharbitrary primers. Nucl. Acid Res., 18: 7213-7218.

Williams, J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalski, and S.V. Tingey(1990). DNA polymorphisms amplified by arbitrary primers areuseful as genetic markers. Nucl. Acids Res., 18: 6531-6535.

Xiao-Jun, G., R. Qiong, Z. Fan, L. Chen, Z. Hong-yu and Gao Xi-wu (2012).Diversity and Genetic Differentiation of the Whitefly Bemisiatabaci Species Complex in China Based on mtCOI and cDNA-AFLP Analysis. J. Integ. Agric., 11(2): 206-214.

Zidani, S., A. Ferchichi and M. Chaieb (2005). Genomic DNA extractionmethod from pearl millet (Pennisetum glaucum) Leaves. Afr. J.Biotechnol., 4: 862-866.

Abstract

1. Title of the thesis : “Molecular Diversity Analysis ofWhitefly (Bemisia tabaci)Collected from Different Regionsof Madhya Pradesh”.

2. Student Name : Sumit Prakashrao Kale

3. Postal Address : Hatekar layout, Behind Gadgebaba

Vacchanalya, Near Kastkar Sankul,

Mothi Umeri, Akola-444001 (M.S)

4. Advisor Name : Dr. S. Tiwari

5. Address (Office) : Biotechnology Centre

J.N.K.V.V., Jabalpur (M.P.)

6. Degree awarded : M. Sc. (Ag.) Molecular Biology and

Biotechnology

7. Year of award of degree : 2013

8. Major subject : Molecular Biology and Biotechnology

9. Total number of pages in the thesis :

10. Number of words in the abstract :

Signature Signature Signature

Dr. S. Tiwari Dr. S. Tiwari Sumit Prakashrao Kale

Major Advisor Director Biotechnology Centre Student

ABSRACT

The present study entitles “Molecular diversity analysis of whitefly (Bemisia

tabaci) collected from different regions of Madhya Pradesh” was carried out with the

objectives to standardize genomic DNA isolation method and analyze the genetic

diversity of whitefly using DNA fingerprinting.

This study aimed to employ DNA based method to clarify the existing of biotype

among whitefly populations in East Madhya Pradesh, India. The genomic DNA of

whitefly collected from different geographical regions of East Madhya Pradesh was

isolated by standardize protocol (SDS + Proteinase K) produce intact band with

high molecular weight. The mtCOI primer was used for identification of B biotype.

Amplified products were resolved by electrophoresis on 1.2% agarose gel and

photographed under gel documentation system. Specific mtCOI primer CI-J-2195

and L2-N-3014 showed the presence of ~880bp bands which confirmed the

presence of B biotype in different geographical regions of East Madhya Pradesh.

All identified B biotypes were used for molecular diversity analysis. The DNA

samples were amplified with 5 RAPD primers in thermal cycler. Amplified products

were resolved by electrophoresis on 1.2% agarose gel and photographed under gel

documentation system. Four decamer primers amplified 8 RAPD marker loci. All 8

bands scored by RAPD markers found to be monomorphic. Average number of

bands per primer was 2.00. One RAPD primer is not amplified in all population. No

variation was found among whitefly samples collected from different geographical

regions of East Madhya Pradesh. Its seems that B. tabaci found in there region of

collection are of conserved type.

VITA

The author of this manuscript Sumit Kale S/o Shri Prakashrao Gulabrao Kale was

born on 23rd of March 1987 at Akola district of Akola (M.S). He passed him Higher

Secondary School Certificate Examination with 64.83% marks from Amravati Board.

He joined Shri Shivaji College of Agricultural Biotechnology, Amravati (M.S.) in the

year 2006 and successfully completed him B.Sc. (Ag.) Biotechnology degree in the year

2010 with an OGPA 7.2 out of 10.00 scales.

Subsequent to graduation, he joined M.sc (Ag). Molecular Biology and

Biotechnology at Biotechnology Centre, Jawaharlal Nehru Agriculture University,

Jabalpur (M.P.) in the year 2011. In partial fulfillment of Master’s Degree, he was

allotted a research problem entitled “Molecular Diversity Analysis of Whitefly (Bemisia

tabaci) Collected from Different Regions of Madhya Pradesh”. This was successfully

completed by him and presented in the form of this thesis. He completed M.Sc. (Ag.)

Molecular Biology and Biotechnology, Degree with an OGPA of 7.79 out of 10.00 scale.

Merit scholarship was awarded by university post graduation. He actively participated in

various college activities.

Mr. Sumit Prakashrao Kale

Hatekar Layout, Behind Gadgebaba Vachanalya,

Near Kastkar Sankul, Mothi Umeri,

Akola-444001 (M.S).

Email I.D: kalesumit.19@gmail.com