Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Molecular characterization of GIANT CHLOROPLAST in rice (Oryza sativa L.) involved in chloroplast division
2015, September
Peter Kuria Kamau
Graduate School of Environmental and Life Science (Doctor’s Course)
OKAYAMA UNIVERSITY
Table of contents
Abbreviations ................................................................................................................. 1
Abstract .......................................................................................................................... 2
Preface............................................................................................................................ 3
1 Introduction ................................................................................................................. 6
2 Results ....................................................................................................................... 10
2.1 Phenotypes of gic mutant ............................................................................ 10
2.2 Map-based cloning and identification of gic locus ..................................... 16
2.3 The putative GIC gene structure ................................................................. 21
2.4 Complementation analysis .......................................................................... 26
2.5 Phylogenetic analysis of ARC6 and PARC6 in rice and other species ...... 28
2.6 Characterization of field-grown gic plants ................................................. 31
3 Discussion ................................................................................................................. 40
3.1 Chloroplast division mutants and GIC identification ................................. 40
3.2 PARC6 is central to the chloroplast division process ................................. 40
3.3 Chloroplast division influences seed setting ............................................... 41
4 Material and Methods ............................................................................................... 44
4.1 Plant materials and growth conditions ........................................................ 44
4.2 Agronomical trait measurements ................................................................ 44
4.3 Protoplast isolation and microscopic analysis ............................................ 44
4.4 Map-based cloning of the GIC locus .......................................................... 45
4.5 cDNA cloning, plasmid construction and gic transformation .................... 46
4.6 Chlorophyll fluorescence measurement ...................................................... 47
4.7 Leaf photosynthesis rates and chlorophyll measurements .......................... 47
4.8 Phylogenetic analysis .................................................................................. 48
4.9 Sectioning and staining rice endosperm ..................................................... 48
4.10 Pollen grain observation ........................................................................... 49
4.11 Phytohormone analysis ............................................................................. 49
5 Supplemental figure and table .................................................................................. 50
References .................................................................................................................... 59
Acknowledgement ....................................................................................................... 68
Abbreviations
ARC, Accumulation and replication of chloroplasts
BLAST, Basic Local Alignment Search Tool
CDD, Conserved Domain Database
cv, cultivar
dCAPS, derived Cleaved Amplified polymorphic sequences
EMS, Ethyl methanesulfonate
FtsZ, Filamenting temperature-sensitive Z
Fv/Fm, Maximum quantum yield of PSII
GIC, Giant Chloroplast
JA, Jasmonic acid
JA-IIe, Jasmonoyl-L-isoleucine Np, Nipponbare
NPQ, Non-photochemical quenching
NtFtsZ, Nicotiana tabacum Filamenting temperature-sensitive Z
PARC, Paralog of accumulation and replication of chloroplasts
PDV, Plastid Division
PFD, Photon flux density
RAP, Rice annotation project
TAIR, The Arabidopsis Information Resource
TEM, Transmission electron microscopy
1
Abstract
Chloroplast is a specialized organelle responsible for numerous metabolic
reactions, most notably for photosynthesis. Chloroplasts are not generated de novo but
proliferate from a preexisting population of plastids present in meristematic cells.
Chloroplast division is executed by the coordinated action of at least two molecular
machineries: internal machinery located on the stromal side of the inner envelope
membrane and external machinery located on the cytosolic side of the outer envelope
membrane. To date, molecular studies of chloroplast division in higher plants have
been limited to several species such as Arabidopsis and no mutants have been
characterized in monocotyledonous plants. To elucidate chloroplast division in rice
and to manipulate it for future molecular breeding, I characterized a mutant displaying
large chloroplasts that had previously been isolated through forward genetics from an
ethyl methanesulfonate (EMS) mutagenized Oryza sativa spp japonica Nipponbare
population. Using a map-based approach, this mutation, termed giant chloroplast
(gic), was allocated in a gene that encodes a protein that is homologous to Paralog of
ARC6 (PARC6), which is known to play a role in chloroplast division. GIC is unique
in that it has a long C-terminal extension that is not present in other PARC6
homologues. To confirm the GIC locus, a corresponding full-length cDNA was
cloned and was successfully used to rescue the gic phenotype. Characterization of
phenotypes in a rice field showed that gic exhibited defective growth in seed setting,
suggesting that the gic mutant negatively affects the reproductive stage.
Photosynthetic rate comparison between gic and Nipponbare in the flag leaves
exhibited a slight significance difference at 1000 and 1500 PFD (Photon flux density),
however photosynthetic parameters (quantum yield and NPQ) between Nipponbare
and gic revealed no significant difference. This study is the first describing a
chloroplast division mutant in monocotyledonous plants and its effect on plant
development.
2
Preface
Rice is the second most important food crop in human diet after wheat in the
world. About 670 million metric tons of rice is grown annually worldwide. Due to the
massive increase of the human population, there is an urgent need to continuously
increase rice production. Traditional breeding methods alone cannot tackle this
problem. With the advent of rice functional genomics, new molecular platforms can
be utilized to study various aspects of rice with an aim to improve growth, yield, grain
quality and disease resistance of rice (Liu et al. 2003).
The chloroplast is estimated to have arisen over a billion years ago through an
endosymbiotic event of an ancestral cyanobacterium (Okazaki et al. 2009,
Miyagishima 2011). A majority of the chloroplast division proteins known to date
have cyanobacteria as their source of origin (Glynn et al. 2007). These proteins have
an N-terminal transit peptide that directs them into the chloroplast; the transit peptide
is cleaved upon import (Bruce 2001). Reminiscent of their bacterial ancestors,
chloroplast division takes place through binary fission to produce daughter
chloroplasts of equal size. Ring structures spanning both the inner and outer
chloroplast envelopes are involved in the division of the chloroplasts (Yoshida et al.
2006, Maple and Moller 2007, Yang et al. 2008). In mesophylls of angiosperms,
many chloroplasts exist: the number differs among the species. For example,
Arabidopsis contains 20–100 chloroplasts, lens-shaped with 5–10 µm diameter and 2–
4 µm thickness, in a mesophyll cell (Sakamoto et al. 2008).
The photosynthetic apparatuses in plants reside in the chloroplasts, and their
intracellular distribution mainly depends on the quality of light, environmental factors
and availability of light (Wada et al. 2003). The rate of chloroplast development has
been shown to be a great determinant of the photosynthetic capacity of leaves
(Webber and Baker 1996). Chloroplast photorelocation movements are categorized
into two: avoidance response to describe situations where chloroplasts move away
from light, and accumulation response to denote situations where chloroplasts move
toward light (Wada et al. 2003, Königer et al. 2008).
3
In plant research, ethyl methanesulfonate (EMS) mutagenesis is a tool that
has been explored extensively to reveal the functionality of many genes (Page and
Grossniklaus, 2002). This chemical mutagen induces mainly point mutations, and thus
is ideal for producing missense and nonsense mutations (Talebi et al. 2012). Since
EMS produces a large number (genome-wide) of non-lethal point mutations, a
relatively small mutant population (approximately 10,000) is sufficient to saturate the
genome with mutations (Talebi et al, 2012). In Arabidopsis, point mutation density
can be as high as four mutations per Mb (Comai and Henikoff 2006).
In previous studies of Arabidopsis accumulation and replication of
chloroplasts (arc) mutants and the tobacco Nicotiana tabacum Filamenting
temperature-sensitive Z (NtFtsZ) over expressed mutants with enlarged chloroplasts
(Jeong et al. 2002, Königer et al. 2008), accumulation and avoidance response to
limiting conditions of low and high light was sub-optimal which led to a decrease in
growth (Königer et al. 2008). However under normal growth conditions, the
chloroplast mutants showed normal growth since they compensated for their reduced
chloroplast numbers with an increase in chloroplast size as reported earlier by Pyke
and leech (1994).
Based on these backgrounds, the objectives of this thesis are
I. To identify and characterize an EMS mutagenized gene that engenders giant
chloroplasts in O. sativa spp. japonica variety Nipponbare.
II. To determine the effect of the giant chloroplast mutants on the growth traits of
O. sativa spp. japonica variety Nipponbare.
Most Arabidopsis mutants exhibited no apparent growth defects unless grown
in limiting conditions of either low or high light (Austin and Webber 2005, Königer et
al. 2008). To elucidate the physiological impact of chloroplast division in O. sativa
spp. japonica variety Nipponbare, I characterized a chloroplast division mutant and
analyzed its effect on the overall rice plant growth. Therefore this thesis describes the
characterization of a previously isolated mutant displaying large chloroplasts, among
an EMS-mutagenized Nipponbare population (Sano 2011). Following a map-based
cloning strategy, I was able to identify a rice orthologue of PARC6. To test if the
large mutant chloroplast has an effect on the growth of rice, I analyzed the basic
4
agronomical traits in the mutant compared to the wild type. The rice mutant displayed
indirect effects on the reproductive stage, particularly on seed setting, although this
was viable.
5
1 Introduction
To date, molecular studies of chloroplast division in higher plants have been
limited to several species, such as Arabidopsis and tobacco (Jeong et al. 2002,
Aldridge et al. 2005). Very little is understood about monocotyledonous plants.
Although the division machinery appears to be conserved, the mechanism by which
chloroplast division contributes to plant growth might be different. Reportedly, arc6
grows at a reduced rate and gives low dry weight (Pyke et al. 1994). Whereas, most
Arabidopsis mutants had no apparent growth defects unless grown in limiting
conditions of either low or high light (Austin and Webber 2005, Königer et al. 2008).
Our knowledge related to chloroplast division advanced extensively through
the observation of dividing chloroplasts (Fig. 1A) and also through the
characterization of mutants, such as arc in Arabidopsis (Pyke and Leech, 1994). The
initial event triggering the commencement of chloroplast division is the assembly of
the Filamenting temperature-sensitive Z (FtsZ) ring at the division site, which is
localized on the stromal side of the inner envelope (Fig. 1B) (Bi and Lutkenhaus 1991,
de Boer et al. 1992, Mukherjee et al. 1993, Mukherjee and Lutkenhaus 1994, Vitha et
al. 2001). Two families of non-redundant genes (FtsZ1 and FtsZ2) have been reported
in higher plants (Osteryoung and Vierling 1995, Osteryoung et al. 1998, Stokes and
Osteryoung 2003, Schmitz et al. 2009), both FtsZ1 and FtsZ2 form into FtsZ1-FtsZ2
heteropolymers (Vitha et al. 2001, Olson et al. 2010, TerBush and Osteryoung 2012).
Proper placement of the FtsZ ring is a tightly controlled process; ARC3 has been
suggested to inhibit FtsZ assembly in other areas apart from the division site (Maple
et al. 2007). Reportedly, ARC3 acts on the FtsZ heteropolymer assembly through
direct interaction with FtsZ2 (Zhang et al. 2013).
In Escherichia coli, the Min system is known to control proper FtsZ-ring
positioning at the division site (Bi et al. 1991, Wilson et al. 2011, Zhang et al. 2013).
The Min system comprises MinC, MinD and MinE, which function together in a well-
integrated fashion to regulate FtsZ ring assembly negatively everywhere apart from
the middle of the cell (Raskin and de Boer 1999, Margolin 2005, Lutkenhaus 2007, de
Boer 2010). Proteins similar to the bacterial Min system also appear to play a role in
6
chloroplast division in plants because it is known that chloroplasts originated from
eubacteria (Colletti et al. 2000, Maple et al. 2002, Glynn et al. 2007). A recent study
has also implicated PARC6 in inhibiting FtsZ assembly (Glynn et al. 2009).
Stabilization of the FtsZ ring is then attained through the interaction of the FtsZ ring
with the inner envelope-spanning protein ARC6 (Vitha et al. 2003). Localization of
both PLASTID DIVISION1 (PDV1) and PDV2 at the division site of the outer
envelopes requires ARC6 (Glynn et al. 2008). Results demonstrated that localization
of PDV2 occurs through direct interaction with ARC6 (Glynn et al. 2008). However,
recent studies have revealed that PARC6 acts as an intermediary between ARC6 and
PDV1 in organizing PDV1 at the division site (Glynn et al. 2009). Finally, ARC5, a
dynamin-like protein required in the late stage of the division process, is recruited to
the division site from patches in the cytosol to the outer envelope membrane by PDV1
and PDV2 proteins (Miyagishima et al. 2006). The combined action of the ring
structures encompassing both the inner and outer envelope membranes at mid-
chloroplast results in the generation of two daughter chloroplasts (Yang et al. 2008,
Maple and Møller 2010, Miyagishima 2011, Pyke 2013) (Fig. 1A).
Photosynthetic organisms have evolved different approaches to optimize light
absorption and the photochemical and biochemical machinery necessary to process
the absorbed photons (Königer et al. 2008). One of these adaptations is the capacity
for the intracellular positioning of chloroplasts in leaf mesophyll cells (Wada et al.
2003, Königer et al. 2008). The location of the chloroplasts within a given mesophyll
cell is majorly governed by the species, ambient light environment, and the growth
history of the organism (Trojan and Gabrys 1996, Williams et al. 2003). Generally,
chloroplasts of plants grown under low light minimize self-shading and move to the
intracellular surfaces parallel to the leaf surface (Königer et al. 2008). This is referred
to as the accumulation reaction or face position and is believed to facilitate
photosynthetic light absorption and thus carbon assimilation (Königer et al. 2008).
When leaves are subjected to conditions of higher light intensities, chloroplasts move
to the edges of the mesophyll cells, perpendicular to the leaf surface to maximize self-
shading and to reduce the excess absorption of photons that could lead to
photoinhibition or photooxidation (Kagawa 2003, Königer et al. 2008). This is
referred to as the avoidance reaction or profile position (Kasahara et al. 2002, Wada et
al. 2003).
7
To elucidate the physiological impact of chloroplast division in
monocotyledonous plants. I mapped the locus of a rice ortholog of PARC6 and
characterized the mutant from an already isolated EMS mutagenized Nipponbare
variety. This mutant was termed giant chloroplast (gic) by a former student in the
plant light acclimation laboratory (Sano 2011), at the Institute of Plant Science and
Resource (IPSR) Okayama University that I joined in 2012. To determine the effect
of the mutant on the overall growth of Nipponbare, I analyzed the agronomical traits
of the mutant grown in natural conditions.
8
Fig. 1 Chloroplast division machinery (modified from Glynn et al. 2009 and
Miyagishima 2011).
A, Constriction of a dividing chloroplast to produce two daughter chloroplasts. B,
Arrangement of the chloroplast division rings at mid chloroplast at the inner and outer
membranes.
9
2 Results
2.1 Phenotypes of gic mutant
The gic mutant isolated from the screening was backcrossed with Nipponbare.
The F2 progeny showing enlarged chloroplasts was selfed and used to characterize its
phenotype further. I developed a simple technique for observing chloroplasts in young
seedlings, which involved peeling a thin tissue from the basal inner sheath of young
rice seedlings (Fig. 2A and B). The thin tissue (Fig. 2C) was mounted on a
microscope glass slide and chloroplast auto-fluorescence was observed. This method
was simple and fast compared to protoplast isolation (Fig. 3), which had been
engaged by the original screening and was time consuming. When one-week-old
seedlings were compared, gic was found to be slightly pale and smaller than the wild-
type Nipponbare, possibly because of delay in growth (Fig. 4A). To confirm the
chloroplast size, longitudinal sections from the basal part of these young seedlings
were examined by microscopy (Fig. 4B). In Nipponbare, chloroplasts were observed
typically as spherical or as oval with similar size (Fig. 4B top panels). In fact,
measurements of individual chloroplasts using the image J program (Schneider et al.
2012) suggested that the average total area (μm2) in each focal plane is approximately
9 μm2 (Fig. 4C), and that the chloroplast number is approximately 9 (Fig. 4D). In
contrast, gic had chloroplasts that exhibited variable morphology and which showed
long and sometimes dumbbell-like chloroplasts, which were reminiscent of division
intermediates (Fig. 4B, bottom panels). Measurement in the chloroplast area size
verified that the chloroplast size in gic was significantly larger (estimated as
approximately twice) than that in Nipponbare (Fig. 4C), with a concomitant decrease
of chloroplast number per cell (roughly reduced twice, Fig. 4D). Occasionally, a cell
contained only a few chloroplasts in gic. Based on these results, I inferred that gic is
impaired in chloroplast division such as arc3, arc5, arc6, and pdv mutants in
Arabidopsis (Glynn et al. 2009, Okazaki et al. 2009, Zhang et al. 2009, Zhang et al.
2013).
To examine the chloroplast ultrastructures, Nipponbare and gic mesophyll cells
were observed using transmission electron microscopy (TEM) (Figs. 5A–5D).
Confirming our observation described above, gic mutants had chloroplasts with
10
various sizes, mostly large ones in a mesophyll cell (Fig. 5B). Some of the observed
chloroplasts had incomplete rampant constrictions (Fig. 5B arrows), which indicated
an arrest of chloroplast division similar to Arabidopsis arc5 mutant (Gao et al. 2003,
Miyagishima et al. 2006, Glynn et al. 2009). In contrast to the enlarged and variable
size, TEM analysis showed no apparent differences in the internal structures:
thylakoids formed granal stacks that were spread evenly within the stroma, both in
Nipponbare and gic (Figs. 5C and 5D). These results implied that the defect in gic did
not affect photosynthesis and was likely limited to chloroplast division.
11
Fig. 2 Rapid method to observe rice chloroplasts. A, Eight-day-old Np and gic
seedlings used for sectioning, grown under natural light conditions. B, Peeling of a
thin tissue from the basal inner sheath of a young seedling. C, Thin tissue mounted on
a microscope glass slide to observe chloroplast auto-fluorescence in a fluorescent
microscope.
12
Fig. 3 Microscopic observation of chloroplasts in protoplasts from wild type
Nipponbare (Np, top) and gic (bottom). Left and right panels respectively present
images from chlorophyll autofluorescence and from bright light, respectively.
Bars=20 μm.
13
Fig. 4 Phenotypes of gic mutant. A, An eight-day-old Nipponbare (Np) and gic
seedlings used for chloroplast observation. B, Microscopic observation of chloroplasts
in mesophylls from Np and gic. Left and right panels respectively present images
from chlorophyll autofluorescence and from bright light, respectively. Bars=20 μm. C
and D, Chloroplast sizes and numbers estimated in the same focal planes of Np and
gic chloroplast in mesophyll cells, respectively (n = 30). Data are given as means ±
S.D. Statistical comparison were conducted using Student’s t test (* P < 0.01).
14
Fig. 5 Transmission electron micrographs of mesophyll cells and observation of
chloroplast inner structures in Nipponbare (Np) and gic. Images from Np (A and C)
and gic (B and D) are shown. Red arrows in A denote normal chloroplasts; red arrows
in B denote giant chloroplasts. Bars=5 nm in A and B; 500 nm in C and D.
15
2.2 Map-based cloning and identification of gic locus
To characterize gic genetically, F2 plants from a cross between gic and an
indica variety Kasalath were subjected to microscopic observation. Segregation of the
giant chloroplast phenotype among, 100 F2 and 50 backcrossed FI individuals
suggested strongly that gic is a single recessive gene because it showed a Mendelian
segregation (Table 1 and 2). Subsequently, I attempted to identify the GIC locus
based on map-based cloning in the F2 population. Segregation distortion close to the
mutant locus during chromosome walking using a homozygous gic population,
selected from the F2 population helped narrow down the region of interest (Fig. 6).
Examination of chloroplasts in one-week-old seedlings (approximately 2,000
individuals) was conducted to isolate 110 F2 individuals exhibiting the giant
chloroplast phenotypes. Conventional mapping of these lines with at least three
markers assigned in each chromosome (Fig. 7), a total of 36 markers in rough
mapping and 68 markers for the fine mapping (Supplemental Table S1) (Matsushima
et al. 2010), suggested that the gic mutation is located at the long arm end of
chromosome 4 as had been intimated previously in earlier work (Sano 2011), the
region between the two markers RM17616 and RM17649 (Fig. 8). This region, which
contains 123 genes, is 582-kb long according to the Rice Annotation Project (RAP)
Database (http://rapdb.dna.affrc.go.jp/).
A survey of the gene products that contain possible targeting signals to
chloroplasts failed to detect any candidate gene that was homologous to chloroplastic
proteins. I anticipated that the gene responsible for gic might show similarity to
Arabidopsis ARC genes. Therefore, all the genes included in this region were next
subjected to BLAST search (Blast-p) with a dataset from The Arabidopsis
Information Resources (TAIR) (http://www.arabidopsis.org). Consequently, I found
one candidate gene, Os04g0675800, that showed high similarity with PARC6,
(At3g19180), which has been shown to be involved in chloroplast division (Zhang et
al. 2009).
16
Table 1. Segregation of gic plants in F2 population. These were obtained from a cross
between gic and the indica variety Kasalath.
Wild type gic χ2value (P) for 3:1 segregation
73 27 0.213 (0.644)
Table 2. Segregation of gic plants in a back crossed population. These were obtained from a
cross between F1 (gic and Nipponbare) and gic.
Wild type gic χ2value (P) for 1:1 segregation
25 25 0 (1)
17
Fig. 6 Scheme for gene recombination in a segregating population of a cross between
Kasalath and gic. gic locus segregated in a mendelian fashion and segregation
distortion was observed close to the gic locus during chromosome walking. Red star
denotes recessive gic allele.
18
Fig. 7 Markers assigned in Nipponbare rice chromosomes. Markers assigned in each
chromosome were used during the rough mapping through which gic was identified to
be located in chromosome 4.
19
Fig. 8 Map-based cloning of the gic gene. Fine mapping to identify the gic locus was
done for chromosome 4. In all, 110 F2 progenies (220 chromosomes) with
homozygous gic lines were examined. The gic locus was mapped to a 582-kb region
between molecular markers RM 17616 and RM 17649. This region contained 123
genes.
20
2.3 The putative GIC gene structure
The putative GIC gene (LOC_Os4g57920.1) is a gene model that is predicted
to encompass 7,424 bp with 16 exons and 15 introns (Fig. 9A). It potentially encodes
a protein of 1,228 amino acids, containing a potential N-terminal transit peptide (1–
63) predicted by ChloroP (Emanuelson et al. 1999), DUF4101 domain (677–797), and
F-box domain (820–861) detected using the conserved domain database (CDD)
(Marchier-Bauer et al. 2005) (Fig. 9A). The putative GIC protein is homologous to
PARC6 (47%) and ARC6 (23%) from Arabidopsis in the TAIR database
(http://www.arabidopsis.org). It is also homologous to other ARC6-like proteins in
other plant species (Fig. 9B and Fig. 9C). One unique feature of GIC compared to
other ARC6 and PARC6 homologues is a long C-terminal extension of approximately
400 amino acids (Supplemental Fig. S1). To verify this gene model, I performed
cDNA amplification using total RNA from Nipponbare leaves and specific primers.
However, the presence of highly GC-rich region at the 5' part in the sequence likely
prevented amplification of putative full-length cDNA. Subsequently, I used two sets
of primers to amplify its 5' and 3' parts separately. This experimental design allowed
me to amplify the corresponding cDNAs. Fragments A and B were amplified using
primer pairs CDsIF and RC13R for fragment A and SPL3F and CDs1R for fragment
B, which were then cloned to the pENTR 2B entry vector using the infusion cloning
kit (Fig. 10). Combined cDNA sequences confirmed the presence of long 3' regions
that do not exist in other species. These results suggest that GIC indeed has an
extraordinary C-terminal extension that is not present in the other PARC6 and ARC6
homologues.
Because this C-terminal extension is unique to GIC, I tested the possibility that
some alternative splicing event engender generation of a shorter version of GIC
cDNAs: my attempts to amplify such cDNA species using various primers failed.
Although I cannot rule out the presence of shorter cDNAs completely, I concluded
that the longer version represents the major GIC cDNA. However, a second longer
splice variant (LOC_Os4g57920.1) (Fig. 9A) of Os04g0675800 was represented in
the MIPS Oryza sativa database (http://mips.helmholtz-muenchen.de/plant/rice/). The
shorter splice variant (Os04g0675800) in the RAP database had 13 exons and total
length of 7,282 base pairs and encoded a protein of 1,120 amino acids. The longer
splice variant (LOC_Os4g57920.1) in the MIPS database on the other had 16 exons
21
and total length of 7,424 base pairs (Fig. 9A), which encoded a protein of 1,228
amino acids (Fig. 9A).
22
Fig. 9 Gene structure of PARC6 (LOC_Os4g57920.1). A, Predicted gene structure in
the LOC_Os4g57920.1 where closed boxes indicate exons and joining lines represent
introns. Below the gene structure, the resulting cDNA and translated protein structure
are shown. The positions of nucleotide substitution found in gic gene (TAT to AAT)
23
and in GIC protein (Tyr to Asn) are indicated respectively by red arrows. In the GIC
protein structure, a putative transit peptide (target peptide amino acids 1–63),
predicted putative conserved DUF4101 domain, and predicted putative conserved F-
box domain are also indicated. B, Phylogenetic analysis of PARC6 and ARC6
proteins in higher plants. Numbers at the nodes signify bootstrap values of 1000 trials.
C, Multiple sequence alignment of PARC6 and ARC6 protein of selected higher
plants showing the conserved tyrosine amino acid substituted to asparagine by the
mutation. The alignment was generated using ClustalW using default parameters and
was refined manually. The conserved amino acid in both ARC6 and PARC6 proteins
is highlighted in yellow with a black pointer.
24
Fig. 10 Schematic representation of the GIC locus and amplification of the
corresponding GIC cDNA using different primer sets (upper panels). A and B, The 5'
part and 3' part were amplified, respectively, by the corresponding primer sets
(CDs1F and RC13R, and SPL3F and CDs1R). C, The high GC content of the GIC
fragment at the 5' region inhibited amplification of the whole fragment when the
primer set CDs1F and CDs1R was used. The representative results of the amplified
cDNA characterized by agarose gel electrophoresis are shown at the bottom.
25
2.4 Complementation analysis
The full-length GIC cDNA was used to create a gene construction for
complementation analysis. It was cloned into a binary vector pIPKb002 (Himmelbach
et al. 2007) to express GIC constitutively under the control of Ubi1 promoter and
Adh1 intron. Agrobacterium-mediated transformation of gic was conducted with the
construct. Consequently, I obtained 15 transgenic rice plants. Of these, the chloroplast
size was assessed at T1 generation using microscopy. Among these lines, 7 lines
contained chloroplasts that were apparently smaller than gic chloroplasts.
Additionally, I found that three lines had chloroplasts comparable to Nipponbare (Fig.
11A). These lines were regarded as fully complemented lines. Detailed observation of
chloroplasts in two fully complemented lines at T2 generation confirmed that the
giant chloroplast phenotype was rescued (Fig. 11B). Taken together, I concluded that
GIC corresponds to LOC_Os4g57920.1 in the MIPS Oryza sativa database
(http://mips.helmholtz-muenchen.de/plant/rice/). The gic-complemented transgenic
lines were grown further in the transgenic plant-specific greenhouse and were
compared with Nipponbare and gic plants. Because of the limited growth conditions
for transgenic rice, plants had only a few tillers under the greenhouse conditions,
under which no detectable difference in the vegetative growth was found among
Nipponbare, gic and the complemented line (Fig. 11C).
26
Fig. 11 Complementation analysis of the gic mutation in the transgenic lines
overexpressing GIC under Ubi promoter. A, Sizes of chloroplasts in Nipponbare (Np)
and the complemented lines estimated as the area in the same focal plane (20
chloroplasts of the fully complemented lines and 30 chloroplasts of Np samples were
engaged in the analysis). Data are given as means ± S.D. Statistical comparison was
conducted using Student’s t test; all data were compared with those of Np. B,
Microscopic observation of chloroplast sizes in Np and the complemented lines
(bars= 20 μm). C, Growth comparison of Np, gic and the complemented line in the
growth chamber. Quantification of chloroplast sizes in mesophyll cells from Np and
the complemented line (bar= 10cm).
27
2.5 Phylogenetic analysis of ARC6 and PARC6 in rice and other species
BLAST search was conducted to detect proteins homologous to GIC.
Consequently, I found ARC6 and PARC6 proteins not only from Arabidopsis and O.
sativa but also from other land plants, including Glycine max, Medicago truncatula,
Populus trichocarpa, Vitis vinifera, Fragaria vesca, Solanum lycopersicum, Cucumis
sativus, Brachypodium distachyon, Sorghum bicolor and Zea mays. Multiple
sequence alignment of these homologues and subsequent phylogenetic analysis
revealed that ARC6 and PARC6 clearly comprise a different clade (Fig. 9B). This
confirmed results of earlier studies of the origin of PARC6 as a result of gene
duplication and diversification in primitive vascular plants (Glynn et al. 2009).
However, Z. mays contained only ARC6 but not PARC6, whereas G. max, F. Vesca,
and C. sativus contained only PARC6 but not ARC6. Currently it remains unclear
whether the presence of one PARC6/ARC6 results from incomplete annotation, or not.
Apparently, GIC represents a rice PARC6 homologue: it is included in the
PARC6 cluster and particularly in the clade with PARC6 homologues from B.
distachyon and S. bicolor (Fig. 9B). Additionally, I found that rice contains an ARC6
homologue (Os02t0122400-01) included in the ARC6 cluster. These results suggest
that rice has both ARC6 and PARC6 for chloroplast division like Arabidopsis, and
that these two proteins are not redundant in function. Although my work in this study
specifically examined GIC, I asked if the mutation in ARC6 causes any defect in
chloroplast division. However, my survey of Tos17-inserted knockout lines
(http://irfgc.irri.org/index.php) revealed that no available mutant existed for ARC6. I
also investigated the presence of ARC6 mRNA as predicted in the gene model in RAP
database. The amplification of cDNA corresponding to rice ARC6 (Os02g0122400) in
the RAP database demonstrated that ARC6 gene model matched with cDNA sequence
(Fig. 12). It has a putative N-terminal target peptide of (1–40) amino acids, as
predicted by ChloroP (Emanuelson et al. 1999) and a DUF4101 domain (646–763)
detected by the conserved domain database (CDD) (Marchier-Bauer et al. 2005). The
rice ARC6 locus encodes a predicted protein product of 770 amino acids (Fig. 12),
which shares approximately 47% identity with the Arabidopsis ARC6 (AT5G42480).
Taken together, I concluded that the presence of both ARC6 and PARC6 is conserved
in most land plants, reflecting the divergence of ARC6-like components.
28
Acting along with ARC6 non-redundantly, PARC6 has been shown to be
localized in the inner envelope of chloroplasts in Arabidopsis (Glynn et al. 2009).
PARC6 is hypothesized to interact with ARC3 in the stromal side and with PDV1 in
the intermembrane space, which coordinately constitute the chloroplast division ring
that also includes ARC5 on the cytosolic surface and FtsZ1/FtsZ2 on the stromal side.
Based on the similarity between GIC and PARC6, I assume the same function of GIC
in chloroplast division. A Tyr-to-Asn substitution in gic is located near the N-terminal
end of GIC protein, which does not belong to particular domains, although the
mutated Tyr residue is highly conserved among PARC6 as well as ARC6 homologues
(Fig. 9C), suggesting that it impaired the proper formation of division rings at the
constriction site. Frequent observation of dumbbell-like large chloroplasts supported
the defect in chloroplast division (Fig. 5). Prediction of transmembrane domains in
GIC using the SOSUI program (http://harrier.nagahama-i-
bio.ac.jp/sosui_submit.html) suggested that an N-terminal region may have one
transmembrane domain and a second one at positions (571–593) in the amino acid
sequence: however, the precise topology of GIC remained unclear in this study
because the first domain starts at the beginning of the protein sequence which partly
includes the target peptide sequence.
29
Fig. 12 Schematic representation of the rice ARC6 locus (Os02g0122400). A
predicted gene structure including respective exons and introns (upper panel), cDNA
structure (middle panel), and protein structure (bottom panel) were indicated. In the
protein structure, a putative transit peptide (transit peptide amino acids 1–40) and a
predicted putative conserved DUF4101 domain is shown.
30
2.6 Characterization of field-grown gic plants
To examine whether gic affects growth under natural conditions or not, I
grew gic and Nipponbare plants in the experimental field in 2013 and compared major
agronomical traits, including duration to heading, culm and panicle lengths, number
of panicles, number of spikelets per panicle, number of sterile spikelets per panicle,
total panicle number, and 100–grain weights (Figs. 13A–13H). When mature
Nipponbare and gic plants grown in the experimental paddy field were compared (Fig.
14), gic showed a slight reduction in overall growth in comparison to Nipponbare. A
slight reduction of chlorophyll content in gic was found, but the difference was not
statistically significant (Fig. 15). As such, gic exhibited growth defect in most traits,
among which the duration to heading, culm length, number of sterile spikelets, and
100-grain weight showed significant differences between Nipponbare and gic.
Particularly, the number of sterile spikelets per panicle was remarkable: gic showed
an approximately three-fold increase compared to Nipponbare. These results suggest
the possibility that the impaired chloroplast division has indirect influence on
reproductive development.
To confirm whether the slight growth defect observed in gic was linked to the
gic mutation, I grew an F2 population of gic backcrossed to Nipponbare in the
experimental field in 2014 and compared major agronomical traits (Figs. 16A–16H).
Genotypes for gic were determined based on the polymorphic markers, and 67 plants
were subjected to trait analyses. Results showed that the number of sterile spikelets
showed significant difference again between gic and Nipponbare, although the other
three defective traits (duration to heading, culm length and 100-grain weight) did not.
Together, these results led to the conclusion that gic affects reproduction with reduced
seed settings. Interestingly, there was a significant difference (P<0.05) in the number
of sterile spikelets between Nipponbare and heterozygotes, implying that gic affects
seed setting in a semi-dominant fashion. The increased number of sterile spikelets in
gic does not seem to result from some defect in gametophyte development because I
observed no deviation in F2 segregation (Table 1 and 2). To assess whether a
detectable deficiency exists in pollen development or not, I observed pollen grains
(Figs. 17A–17B). Results showed no significant reduction in pollen viability.
Additionally, I found that the endosperm structure is normal (Figs. 17C–17F) and that
it has little effect on germination. I considered that one possibility to explain defective
31
spikelet formation in gic is reduction in jasmonoyl-L-isoleucine (JA-IIe) levels,
because it has been previously shown that the impairment in JA-IIe synthesis leads to
sterility in many plants and the increased sterility resembled some of these mutants in
rice (Riemann et al. 2003, Acosta et al. 2009, Fukumoto et al. 2013). However
measurements in JA-IIe levels revealed no significant difference in the accumulation
levels of JA-IIe between gic and Nipponbare leaves (Fig. 18).
I also measured the photosynthetic capacity because the chloroplast size might
interfere with chloroplast relocation in response to light, which engenders increased
photoinhibition (Kasahara et al. 2002, Königer et al. 2008). The photosynthetic rates
between Nipponbare and gic showed statistical significance at 1000 and 1500 PFD
(Fig. 14A). However the quantum yields between Nipponbare and gic showed no
significant difference (Fig. 14B). The non-photochemical quenching (NPQ) between
Nipponbare and gic also revealed no significant difference (Fig. 19B). Measurement
of Fv/Fm, maximum photochemical efficiency of Photosystem II, using detached
leaves from Nipponbare and gic under photoinhibitory light revealed no significant
difference between them (Fig. 19A).
32
Fig. 13 Estimation of agricultural traits in Nipponbare (Np) and gic grown under the
paddy field at IPSR in the year 2013. See the text for the details. A, Duration to
heading. B, Culm length. C, Panicle length. D, Number of panicles. E, Number of
spikelets per panicle. F, Number of sterile spikelets per panicle. G, Total panicle
weight. H, 100 grain weight. Data are given as means ± S.D. Statistical comparison
was performed using Student’s t test; all data were compared with Np (*P < 0.01).
33
Fig. 14 Photosynthetic capacity of Nipponbare (Np) and gic and the growth
phenotype in the rice field. A, Effect of light intensity on photosynthesis in flag leaves
at heading stage in Nipponbare (Np) and gic (SD at 1000 and 1500 PFD (µmol m-2 s-
1), P < 0.05, n = 4 from different plants). B, Quantum yields of Np and gic in flag
leaves at heading stage (n = 4 from different plants). C and D, Comparison of Np and
gic plants grown in an experimental paddy field (scale bars= 10cm in C and D).
34
Fig. 15 Chlorophyll contents of Nipponbare (Np) and gic. Concentrations of
chlorophyll a, chlorophyll b, and chlorophyll a+b were measured and compared
between Np and gic (n=3 each). Data are given as means ± S.D. Statistical
comparison was conducted using Student’s t test; all data were compared with those
of Np. Statistical significance was not observed at P < 0.05.
35
Fig. 16 Estimation of gic backcrossed population agricultural traits in Nipponbare
(Np), gic and heterozygous plants grown under the paddy field at IPSR in the year
2014. See the text for the details. A, Duration to heading. B, Culm length. C, Panicle
length. D, Number of panicles. E, Number of spikelets per panicle. F, Number of
sterile spikelets per panicle. G, Total panicle weight. H, 100-grain weight. Data are
given as means ± S.D. Statistical comparison was performed using Student’s t test; all
data were compared with those of Np (*P < 0.05, **P < 0.01).
36
Fig. 17 Observation of pollen grains and endosperms from rice seeds sections. Images
of whole-mount pollen grains in Np A and gic B. Images of sections from mature
endosperm in Np C and E and gic D and F. C and D are in low magnification; E and
F are in high magnification Bars=20 μm in A–F.
37
Fig. 18 Levels of Jasmonoyl-L-isoleucine (JA-IIe) measured in Nipponbare (Np) and
gic after mechanically wounding the leaves. Concentrations of JA-Ile were
determined and statistical difference between Np and gic (n=3 each) after wounding
the leaves were tested. Data are given as means ± S.D. Statistical comparison was
performed by Student’s t test; all data were compared with Np. Statistical significance
was not observed at P < 0.05.
38
Fig. 19 High light sensitivity of Photosystem II activity in Nipponbare (Np) and gic
estimated by the pulse-amplitude modified chlorophyll fluorescence. A, Fv/Fm values
measured from detached leaves of Np and gic using the FluorCam 800MF (bars
represent SD; n=3 from different plants). B, Comparison of NPQ between Np and gic
(n=4 from different plants).
39
3 Discussion
3.1 Chloroplast division mutants and GIC identification Chloroplast division has been studied extensively in a model dicotyledonous
plant Arabidopsis. Particularly, characterization of mutants that are defective in
chloroplast division, resulting in large chloroplasts, has enabled us to unravel novel
components in the division machineries that resemble those of ancestral bacterial
components. Some of the proteins are not prokaryotic. They have apparently evolved
after endosymbiosis. In contrast, the lack of similar genetic studies in other plant
species than Arabidopsis and tobacco, questions how chloroplast proliferation affects
plant growth in other species. To date, most of the Arabidopsis arc mutants are
known not to exhibit an apparent growth defect except for arc6 (Pyke et al. 1994).
Although Yun and Kawagoe (2009) reported a rice arc5 knockout mutant based on a
reverse genetic approach, the work focused only on amyloplasts and did not
characterize growth phenotype. To address the physiological effect of chloroplast
division further, I attempted to identify the chloroplast division mutants in rice.
Whereas the available genetic resources and genomic information in rice are ideal for
the study, direct observation of chloroplasts is difficult because of the high silicon
content and small mesophylls. To overcome this difficulty, I established a simple
strategy to observe clear images of chloroplasts in the basal part of young seedlings
(Fig. 2), which enabled me to identify gic. Further map-based cloning and subsequent
characterization identified that GIC encodes an orthologue of PARC6, one of the
division proteins localized in the inner envelope (Glynn et al. 2009).
3.2 PARC6 is central to the chloroplast division process
My findings are in good agreement with a recent review by Osteryoung and
Pyke (2014), in which the same gene as GIC is predicted as an orthologue of PARC6
in rice. PARC6 seems to act non-redundantly with ARC6. Its loss results in the giant
chloroplast phenotype. Additionally, my data show that i) GIC has splice variants
generating alternative C-termini and ii) it has a unique C-terminal extension that does
not exist in any other PARC6 homologues. PARC6 is localized in the inner envelopes.
It plays a central role in forming division rings at the constriction site by interacting
with both PDV1 in the intermembrane space and ARC3 in the stroma. Given the
40
possibility that GIC/PARC6 has one transmembrane domain like ARC6, the long C-
terminal extension might be exposed to the inter-membrane space, where its
interaction with PDV1 occurs. The presence of this C-tail therefore seems to have
little effect on the interaction, although the possibility remains that this extension
undergoes a posttranslational processing to produce GIC having size similar to ARC6.
My findings in GIC might also be relevant to the fact that ARC6 fused to GFP at the
C-terminal region functions in vivo (Vitha et al. 2003). Supporting these results, the
long cDNA complemented gic phenotype when expressed by Ubi1 promoter. Based
on RT-PCR analysis, it was unlikely that a shorter version of GIC cDNA without the
C-tail accumulated, although this cannot be ruled out completely. Why GIC has such
a long C-tail remains unclear: neither rice ARC6 nor ARC6/PARC6 homologues in
the other species have it. These results imply that acquisition of extra amino acids
rarely occurred during evolution without affecting division apparatuses in chloroplasts.
3.3 Chloroplast division influences seed setting
Emphasis is made in this study to examine if a defect in the chloroplast
division (exhibiting large chloroplasts) has any influence in rice growth. At the
seedling stage, gic exhibited slightly retarded growth compared to Nipponbare (Fig.
4). However, my evaluation in the natural field conditions using F2 population (Fig.
16) showed that gic exhibited no significant difference in the vegetative growth,
compared with the wild type. A previous study in tobacco FtsZ1-2 overexpressing
lines exhibited retarded growth when they were grown in high or low light conditions
(Jeong et al. 2002). Similarly, a change in light transmission was observed in
Arabidopsis arc3, arc5, arc6 (Königer et al. 2008). It has been proposed that the
decrease in growth of these mutants was attributable to the retarded movement of
enlarged chloroplasts, consequently resulting in impaired adaptability to limiting high
or low light conditions. Somewhat consistent with these reports, I found in this study
that comparison of photosynthetic rates in flag leaves of Nipponbare and gic showed
significant difference only in high-light conditions at 1000 and 1500 PFD (Fig. 14A).
It is likely that this difference in rice is only marginal and that it might not affect
vegetative growth to any significant extent. The photosynthetic parameters (quantum
yield and NPQ) measured between Nipponbare and gic also did not reveal any
significant difference.
41
In contrast to vegetative growth, however, it is noteworthy that gic affected
the reproductive stage and exhibited an increase in the number of sterile spikelets. No
such defect has been observed in Arabidopsis arc6 or in other mutants. Sterility did
not seem to result from pollen fertility or endosperm development (Fig. 17), as I
observed non-distorted segregation in the gic phenotype. Further analysis is required
to uncover the relation between seed setting and chloroplast division. Many cereal
crops undergo distinct leaf senescence to maximize the redistribution of
macronutrients into reproductive organs. I also measured Jasmonoyl-L-isoleucine (JA-
IIe), which is a conjugate of Jasmonic acid (JA) and Isoleucine that has been reported
to have the strongest biological activity in Arabidopsis (Yan et al. 2009). This JA
conjugate is not only involved in plant defense but also in plant development (Ballare
2011, Erb et al. 2012, Fukumoto et al. 2013). I compared the JA-IIe hormone levels in
Nipponbare and gic after mechanical wounding of the leaves. The levels of this
hormone in Nipponbare revealed no significant difference in comparison to those of
gic (Fig. 18). To verify whether giant chloroplasts affects accumulation levels of JA-
IIe hormone, which would affect seed formation in gic, further studies should be done
on JA production from flowers. Flower and leaf JA production are likely to be
controlled by different mechanisms as JA in the leaf only accumulates after
mechanical damage, while flower JA increases in development-dependent manner
without wounding.
Chloroplasts are the major target of the degradation process during leaf
senescence (Sakamoto and Takami 2014). In this sense, the large chloroplast
phenotype might affect chloroplast degradation negatively through chloroplastic
autophagy. Lower transition of macronutrients from leaves might have some
influence in seed setting. Based on these results, I conclude that chloroplast division is
necessary for the proper growth of rice plants grown in the field, especially during the
seed-setting stage. In contrast to the gic defective phenotype grown in the field, I
observed no apparent phenotypes between Nipponbare, gic, and the gic-
complemented line when they were grown in a controlled green house (Fig. 11C,
growth condition is described in Materials and Methods). These data likely imply that
chloroplast division presents fitness under natural field conditions, although it shows
no defective growth under controlled conditions.
42
My study in gic provides us further insight into the physiological role of
chloroplast division, but it also demonstrates the dispensability of chloroplast division,
thereby enabling us to take advantage of these mutants for studying chloroplast
biogenesis and genetic engineering. For example, large chloroplasts in rice
mesophylls appear to give rise to dense chlorophyll and make them easier to observe
under light microscopy (Fig. 4 and Fig. 11). Concomitant with the large size, the
decrease of chloroplast number per cell may be useful for transforming foreign DNA
into chloroplast genome: large chloroplasts account for better targets for delivering
DNA by particle bombardment (to date, this has been the only practical means of
delivering DNA into chloroplasts). The low copy chloroplast number prevents
heteroplasmy. Actually, gic was isolated by EMS-mutagenized population, which
means that it can be handled easily with no regulation of growing transgenic lines. I
consider that the isolation of large chloroplast mutants such as gic in crops has such
potential, in addition to the study of chloroplast division.
43
4 Materials and Methods
4.1 Plant materials and growth conditions
Rice (Oryza sativa subspecies japonica cv. ‘Nipponbare’ and subspecies indica
cv. ‘Kasalath’) were used as wild-type plants. For investigating agronomical traits,
rice plants were grown in an experimental paddy field and in a greenhouse at the
Institute of Plant Science and Resources, Okayama University in 2013 and 2014.
Germinating seeds were sown on April 10, which involved incubating the seeds in a
petri dish followed by moving the germinating seeds in growing trays in the green
house. The seedlings were then transplanted into the paddy field after 30 days at a
distance of 15 cm between plants and 40 cm between rows. The plants grew
according to the standard practices for the time of year in Japan.
4.2 Agronomic trait measurements
Eight phenotypic traits were measured after harvesting, except for the duration
to heading. The traits included duration to heading, culm length (from the base to the
last node), panicle length (from the last node to the end of the panicle), number of
panicles, number of spikelets per panicle, number of sterile spikelets per panicle, total
panicles weight and 100-grain weight.
4.3 Protoplast isolation and microscopic analysis
Isolation of rice protoplasts was conducted as described by Bart et al. (2006).
Leaves from one-week-old rice seedlings were cut into approximately 0.5 mm strips.
The strips were immediately transferred into 0.6 M mannitol for 10 min in the dark.
After discarding the mannitol, the strips were incubated in an enzyme solution (1.5%
(w/v) cellulose RS (Yakult Co. Ltd), 0.75% macerozyme R10 (Yakult Co. Ltd), 0.6 M
mannitol, 10 mM MES at pH 5.7, 10 mM CaCl2 and 0.1% BSA). After incubation of
4 hr in the dark with gentle shaking (50–70 rpm), an equal volume of W5 solution
(154 mM NaCl, 125 mM CaCl2, 5 mM KCI and 2 mM MES at pH 5.7) was added,
followed by vigorous shaking by hand. Protoplasts were released by filtering through
20 μm nylon mesh into a round bottom tube followed by 3–5 washes of the strips
using W5 solution. The pellet was collected by centrifugation at 1,500 rpm for 3 min
with a swinging bucket. The pellet was then resuspended in MMG solution (0.4
44
mannitol, 1.5 mM MgCl2 and 4 mM MES at pH 5.7) and was used for microscopic
observation using a fluorescence microscope (DSU-BX51; Olympus Corp.).
For observation of chloroplast phenotypes, stems and leaves of one-week-old
O. sativa were trimmed into small sections (approximately 2.5 cm length by 1 mm
width) and were embedded in 6% agar. Using this agar block, thin cross sections
(thickness of 10–150 µm) were prepared using a vibratome (VT1200S; Leica). The
sections were examined using a fluorescence microscope (DSU-BX51; Olympus
Corp.) equipped with a disc-scanning unit. For detection of chlorophyll
autofluorescence, a U-MWIG2 (red chlorophyll) filter was selected.
For transmission electron microscopy, leaves and stems for 2-week-old plants
were cut into 1×1 mm pieces, and were then fixed in 2% paraformaldehyde and 2%
glutaraldehyde in 0.05 M cacodylic acid buffer, pH 7.4, and post fixed in 2% osmium
tetroxide in the same buffer at 4°C for 3 hr. Samples were also dehydrated with a
graded ethanol series (50, 70, 90 and 100%). Infiltration of the samples was then done
using propylene oxide (PO) twice for 30 min each and put into a 70:30 mixture of PO
and resin (Quetol-651; Nisshin EM Corp.) for 1 hr. The samples were then transferred
to fresh 100% resin, and were polymerized at 60°C for 48 hr. The chloroplast
structures were evaluated on ultrathin sections cut using an ultramicrotome
(ULTRACUT UCT; Leica). Sections were stained with 2% uranyl acetate and were
examined using a transmission electron microscope (JEM-1200EX; JEOL) at 80 kV.
Microscopic observations were conducted at Tokai Electron Microscopy Co. Ltd.
4.4 Map-based cloning of the GIC locus
For mapping the gic locus, the F2 population was derived from a cross
between gic and Kasalath. To select gic mutant plants from the F2 population, thin
tissues of the lower inner sheath of the F2 plants were removed using a pin set and
screened under a fluorescence microscope (DSU-BX51; Olympus Corp.). For PCR-
based mapping analysis, genomic DNA was isolated from each of the 110 selected
individuals showing gic phenotypes. Genotypes were estimated based on simple
sequence length polymorphism markers (68 markers) as described previously
(Temnykh et al. 2000, McCouch et al. 2002, Matsushima et al. 2010). The resulting
mapping assigned the gic mutation within the chromosome region enclosed by the
45
two markers RM17616 (5'-TCGTCGTCCTCTTCTCTTCATCG-3' and 5'-
GCTAACACCGAAAGAGGCAAAGC-3'), RM17649 (5'-
GCATACCGTAATGTTGGTGAAGC-3' and 5'-
AATAGCAACTGGGAGGAGGTAAGG -3') that encompassed a 582 kb region at
the long arm end of chromosome 4. To assess the genes included in this region, I used
the Rice Annotation Program (RAP) database (http://rapdb.dna.affrc.go.jp), in which
123 genes were found. To pick up the candidate GIC gene, the protein sequences of
all the 123 genes in this region were used for BLAST-P search with the dataset
including Arabidopsis protein sequences at the Arabidopsis Information Resource
(TAIR) database (http://www.arabidopsis.org). The resulting search identified
Os04g0675800, which was shown to have high homology to Arabidopsis PARC6.
Based on the gene structure in RAP database, I designed a set of primers for
sequencing the entire regions (Supplemental Table S1). Consequently, a single
nucleotide substitution was found at nucleotide +253 (+1 is A of the initiation codon
ATG in the genomic sequence). In the gene model, I found a different splicing pattern
at the sequences close to the 3' end. The Os04g0675800 splice variant has 13 exons,
whereas the LOC_Os4g57920.1 variant has 16 exons. The LOC_Os4g57920.1 variant
has extra 142 nucleotides in the 3' end, which include the last exon of this splice
variant.
For confirming the gic genotype, I designed a dCAPS marker to distinguish
the mutation from the wild type (primer sequences: dCAPF 5'-
GATGGTGGAGATCCCCGTCACTAGC-3' and dCAPR 5'-
CCAGCCGAGCTAAACTAGAT-3'). The marker enabled the amplification of 125-
bp fragments and the gic genotype was verified by digestion with AluI. This dCAPS
primer was used to perform segregation analysis in the F2 population from the cross
between gic and Nipponbare.
4.5 cDNA cloning, plasmid construction and gic transformation
For gic complementation, the full length GIC cDNA fragment was amplified
initially by PCR with PrimeSTAR® GXL DNA polymerase using the primer pair 5'-
ATGGCGATGCCGACGGTGGCCG-3' and 5'-TTAGTGTTTTTGAAAATTTCCG-
3'. However, due to the presence of the highly GC-rich region at the 5' region (75%
46
GC content for the first 100 nucleotides) in the sequence likely prevented
amplification of the putative full-length cDNA (3,684 bp). I amplified a shorter
fragment of 819-bp in size in the 5' end using the primers (CDs1 F and RC13 R)
(Supplemental Table S1), and a 2,886-bp fragment in the 3' end using the primers
(SPL3 F and CDs1 R) (Supplemental Table S1). The resulting two amplicons (Fig.
10) were cloned into the BamH I and EcoR I sites of pENTR 2B entry vector
(Invitrogen Corp., CA, USA) using the In-Fusion Cloning Kit (Clontech). The
developed construct was then used in the LR recombination reaction with the
destination vector pIPKb002; which is a binary vector for cereal transformation
(Himmelbach et al. 2007), using the gateway system (Invitrogen Corp.). The final
GIC construct was transformed into gic plants as described previously (Hiei et al.
1994, Matsushima et al. 2014). The transgenic lines were grown in a controlled
greenhouse at 30°C.
4.6 Chlorophyll fluorescence measurement
To estimate the photosynthetic activity under high light (1200 mmol/m2/s),
maximum photochemical efficiency of PSII (Fv/Fm) was measured from the detached
leaves of gic and Nipponbare plants (n=3), based on chlorophyll fluorescence using
FluorCam 800MF (Photon Systems Instruments). The values for minimum and
maximum dark-adapted fluorescence (F0, Fm) and Fv/Fm were obtained after dark
adaptation of the leaves for at least 10 min. Measurements were taken three times
after subjecting the leaves to high light treatment for up to 4 hr using a halogen light
source.
4.7 Leaf photosynthesis rates and chlorophyll measurements
Leaf photosynthesis rate was measured in flag leaves at full heading stage
using a portable photosynthesis system (LI-6400; Li-Cor Inc.). For measurements of
the photosynthetic rates between Nipponbare and gic, the temperature of the leaf
chamber was maintained at 30°C whereas the CO2 concentration was maintained at
390 μmol mol−1. The relative humidity was maintained at between 65-75%. Leaf
photosynthesis rates were measured at different light intensity levels between 0 and
2000 μmol m−2 s−1. The chlorophyll parameters measured included the quantum yield
47
and the non-photochemical quenching (NPQ). For these measurements the saturated
light intensity was set at 7500 μmol m−2s−1.
4.8 Phylogenetic analysis
Amino acid sequences of proteins homologous to PARC6 and ARC6 were
obtained through BLAST search using the amino acid sequence of GIC as query. The
obtained homologues from G. max PARC6 (XP_003549173.1), M. truncatula PARC6
(AES76369.1), P. trichocarpa PARC6 (EEF07722.1), V. vinifera PARC6
(CBI35272.3), F. vesca PARC6 (XP_004301221.1), Arabidopsis PARC6
(AT3G19180.1), S. lycopersicum PARC6 (Solyc03g098610.2.1), C. sativus PARC6
(XP_004138549.1), B. distachyon PARC6 (Bradi5g26047.1), O. sativa spp. japonica
Nipponbare PARC6 (LOC_Os4g57920.1), S. bicolor PARC6 (Sb06g032820.1), B.
distachyon ARC6 (Bradi3g02190.1), O. sativa spp. japonica Nipponbare ARC6
(Os02t0122400-01), Z. mays ARC6 (ACG29776.1), S. bicolor ARC6
(Sb04g001860.1) S. lycopersicum ARC6 (Solyc04g081070.2.1), V. vinifera ARC6
(CAN78894.1) Arabidopsis ARC6 (AT5G42480.1), P. trichocarpa ARC6
(EEE94693.1), M. truncatula ARC6 (AES59607.1), were subjected to multiple
alignment using the CLUSTALW program
(http://www.ebi.ac.uk/Tools/msa/clustalw2/ )(Thompson et al. 1994). An unrooted
tree was constructed with the maximum likelihood algorithm using the MEGA 5.2
software program (Tamura et al. 2011) The inferred phylogeny was tested with 1000
bootstrap replicates (Felsenstein 1985).
4.9 Sectioning and staining of rice endosperm
Mature dry seed blocks of about 1-mm3 were cut from the center part of the
endosperm and fixed in FAA solution containing 5% (v/v) formalin, 5% (v/v) acetic
acid and 50% (v/v) ethanol for approximately 12 hr at room temperature. Samples
were subsequently dehydrated through a graded ethanol series [30, 50, 70, 90 and
100% (v/v)] and then embedded in Technovit 7100 resin (Kulzer and Company,
Wehrheim, Germany) as previously described (Matsushima et al. 2010). The
embedded samples were cut in 1-μm sections using an ultramicrotome (EMUC7;
Leica Microsystems) and diamond knives and were then dried on coverslips. Staining
of the thin sections was done with 40× diluted Lugol solution (iodine/potassium
iodine solution; MP Biomedicals) in deionized water for at least 5 sec and was finally
48
examined with a microscope (AX70; Olympus Corp.).
4.10 Pollen grain observation
Acquiring the iodine-stained mature pollen grains involved disrupting the
anthers with a pair of forceps immediately before anthesis in the diluted Lugol
solution on a glass slide. The released pollen grains were subsequently examined
using microscopy (DSU-BX51; Olympus Corp.).
4.11 Phytohormone analysis
Collected detached leaf samples, were immediately quick frozen in liquid
nitrogen and stored in a deep freezer at -80oC until analysis. After grinding in liquid
nitrogen, about 100 mg of each sample was extracted in 1 ml of ethylacetate spiked
with known internal standard (IS) (ng d3-JA-IIe). After homogenizing the samples in
a FastPrep FP120 instrument (Thermo Savant, Thermo Fisher Scientific, Pittsburg,
PA, USA) using five to six zirconia beads (2.3 mm), centrifugation was done for 20
min at 16,100 g, 4 °C, and the supernatants were transferred to new microcentrifuge
tubes. Extraction was repeated with 0.5 mL of ethylacetate without IS, and
supernatants were pooled with the first fraction after centrifugation. Samples were
evaporated under a vacuum and re‐suspended in 250 mL 70% methanol/ water (v/v).
10 mL of extract was subjected to measurement on a triple quadrupole LC‐MS/MS
6410 (Agilent Technologies, Santa Clara, CA, USA) equipped with a Zorbax SB‐C18
column (2.1 mm id 50 mm, (1.8 mm), Agilent Technologies). Solvent A (0.1% formic
acid in water) and solvent B (0.1% formic acid in acetonitrile) were used in time
(min)/B (%) gradient: 0/15, 4.5/98, 12/98, 12.1/15, 18/15, at a constant flow rate of
0.4 mL/min. Mass transitions: hormone/Q1 precursor ion (m/z)/Q3 product ion (m/z)
were monitored for each compound: JA‐Ile/ 322/130, d3‐JA‐Ile/ 325/130. The
fragmentor / collision energy were set to 135/15 for JA‐Ile. Hormone amounts were
calculated from the ratio of endogenous hormone peak and a known amount of IS
spike, and related to the fresh mass of the samples used for extraction.
49
5 Supplemental figure and table
50
51
52
53
54
55
Supplemental Fig. S1 Multiple amino acid sequence alignment of PARC6 and ARC6
from selected higher plants. The alignment was generated using ClustalW with the
default parameters (see Materials and Methods). Protein sequences of the selected
higher plants were obtained from various plant databases.
56
Supplemental Table S1. Primers used for mapping the GIC locus
57
58
References
Acosta, I.F., Laparra, H., Romero, S.P., Schmelz, E., Hamberg, M., Mottinger,
J.P. et al. (2009) Tasselseed1 is a lipoxygenase affecting jasmonic acid signaling
in sex determination of maize. Science 323: 262-265.
Aldridge, C., Maple, J. and Møller, S.G. (2005) The molecular biology of plastid
division in higher plants. J. Exp. Bot. 56: 1061–1077.
Austin, I.I.J. and Webber, A.N. (2005) Photosynthesis in Arabidopsis thaliana
mutants with reduced chloroplast number. Photosynth. Res. 85: 373–384.
Bart, R., Chern, M., Park, C., Bartley, L. and Ronald, P.C. (2006) A novel system
for gene silencing using siRNAs in rice leaf and stem-derived protoplasts. Plant
Methods 2: 1–9.
Bi, E., Dai, K., Subbarao, S., Beall, B. and Lutkenhaus, J. (1991) FtsZ and cell
division. Res. Microbiol. 142: 249–252.
Bi, E.F. and Lutkenhaus J. (1991) FtsZ ring structure associated with division in
Escherichia coli. Nature 354: 161–164.
Bruce, B.D. (2001) The paradox of plastid transit peptides: conservation of function
despite divergence in primary structure. Biochem. Biophys. 1541: 2–21.
Colletti, K.S., Tattersall, E.A., Pyke, K.A., Froelich, J.E., Stokes, K.D. and
Osteryoung, K.W. (2000) A homologue of the bacterial cell division site-
determining factor MinD mediates placement of the chloroplast division
apparatus. Curr. Biol. 10: 507–516.
Comai, L. and Henikoff, S. (2006) TILLING: practical single-nucleotide mutation
discovery. Plant J. 45: 684–694.
59
de Boer, P.A.J. (2010) Advances in understanding E. coli cell fission. Curr. Opin.
Microbiol. 13: 730–737.
de Boer, P., Crossley, R. and Rothfield, L. (1992) The essential bacterial cell
division protein FtsZ is a GTPase. Nature 359: 254–256.
Emanuelsson, O., Nielsen, H. and von Heijne, G. (1999) ChloroP, a neural
network-based method for predicting chloroplast transit peptides and their
cleavage sites. Prot. Sci. 8: 978–984.
Erb, M., Meldau, S., Howe, G.A. (2012) Role of phytohormones in insect‐ specific
plant reactions. Trends Plant Sci. 17: 250-259.
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39: 783–791.
Fukumoto, K., Alamgir, M.K., Yamashita, Y., Mori, C.M., Matsuura, H. and
Galis, I. (2013) Response of rice to insect elicitors and the role of OsJAR1 in
wound and herbivory‐induced JA‐Ile accumulation. J Integr plant Biol. 55: 775-
784.
Gao, H., Kadirjan-Kalbach, D., Froehlich, J.E. and Osteryoung, K.W. (2003)
ARC5, a cytosolic dynamin-like protein from plants, is part of the chloroplast
division machinery. Proc. Natl Acad. Sci. USA 100: 4328–4333.
Glynn, J.M., Froehlich, J.E. and Osteryoung, K.W. (2008) Arabidopsis ARC6
coordinates the division machineries of the inner and outer chloroplast
membranes through interaction with PDV2 in the intermembrane space. Plant
Cell 20: 2460–2470.
Glynn, J.M., Miyagishima, S., Yoder, D.W., Osteryoung, K.W. and Vitha, S.
(2007) Chloroplast division. Traffic 8: 451–461.
60
Glynn, J.M., Yang, Y., Vitha, S., Schmitz, A.J., Hemmes, M., Miyagishima, S. et
al. (2009) PARC6, a novel chloroplast division factor, influences FtsZ assembly
and is required for recruitment of PDV1 during chloroplast division in
Arabidopsis. Plant J. 59: 700–711.
Hiei, Y., Ohta, S., Komari, T. and Kumashiro, T. (1994) Efficient transformation
of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the
boundaries of the T-DNA. Plant J. 6: 271–282.
Himmelbach, A., Zierold, U., Hensel, G., Riechen, J., Douchkov, D., Schweizer
P. et al. (2007) A set of modular binary vectors for transformation of cereals.
Plant Physiol. 145: 1192–1200.
Jeong, W.J., Park, Y., Suh, K.H., Raven, J.A., Yoo, O.J. and Liu, Y.R. (2002) A
large population of small chloroplasts in tobacco leaf cells allows more effective
chloroplast movement than a few enlarged chloroplasts. Plant Physiol. 129:
112–121.
Kagawa, T. and Wada, M. (2004) Velocity of chloroplast avoidance movement is
fluence rate dependent. Photochem. Photobiol. 3: 592–595.
Kasahara, M., Kagawa, T., Oikawa, K., Suetsugu, N., Miyao, M. and Wada, M.
(2002) Chloroplast avoidance movement reduces photodamage in plants. Nature
420: 829–832.
Königer, M., Delamaide, J.A., Marlow, D.E. and Harris, G.C. (2008) Arabidopsis
thaliana leaves with altered chloroplast numbers and chloroplast movement
exhibit impaired adjustments to both low and high light. J. Exp. Bot. 59: 2285–
2297.
Liu, S.P., Li, X., Wang, Z.Y., Li, X.H. and He, Y.Q. (2003) Gene pyramiding to
increase the blast resistance in rice. Mol. Plant Breeding 1: 22–26.
Lutkenhaus, J. (2007) Assembly dynamics of the bacterial MinCDE system and
61
spatial regulation of the Z ring. Annu. Rev. Biochem. 76: 539–562.
Maple, J., Chua, N.H. and Møller, S.G. (2002) The topological specificity factor
AtMinE1 is essential for correct plastid division site placement in Arabidopsis.
Plant J. 31: 269–277.
Maple, J. and Moller, S.G. (2007) Plastid division: Evolution, mechanism and
complexity. Ann. Bot. 99: 565–579.
Maple, J. and Møller, S.G. (2010) The complexity and evolution of the plastid-
division machinery. Biochem. Soc. Trans. 38: 783–788.
Maple, J., Vojta, L., Soll, J. and Møller, S. G. (2007) ARC3 is a stromal plastid
division protein with MinC-like properties. EMBO Rep. 8: 293–299.
Marchler-Bauer, A., Anderson, J.B., Cherukuri, P.F., DeWeese-Scott, C., Geer,
L.Y., Gwadz, M. et al. (2005) CDD: a Conserved Domain Database for protein
classification. Nucleic Acids Res. 33: 192–196.
Margolin, W. (2005) FtsZ and the division of prokaryotic cells and organelles. Nat.
Rev. Mol. Cell Biol. 6: 862–871.
Matsushima, R., Maekawa, M., Fujita, N. and Sakamoto W. (2010) A rapid, direct
observation method to isolate mutants with defects in starch grain morphology in
rice. Plant Cell Physiol. 51: 728–741.
Matsushima, R., Maekawa, M., Kusano, M., Kondo, H., Fujita, N., Kawagoe, Y.
et al. (2014) Amyloplast-localized SUBSTANDARD STARCH GRAIN4 protein
influences the size of starch grains in rice endosperm. Plant Physiol. 164: 623–
636.
McCouch, S.R., Teytelman, L., Xu, Y., Lobos, K.B., Clare, K., Walton, M. et al.
(2002) Development and mapping of 2240 new SSR markers for rice (Oryza
sativa L.). DNA Res. 9: 199–207.
62
Miyagishima, S.Y. (2011) Mechanism of plastid division: from a bacterium to an
organelle. Plant Physiol. 155: 1533–1544.
Miyagishima, S., Froehlich, J.E. and Osteryoung, K.W. (2006) PDV1 and PDV2
mediate recruitment of the dynamin-related protein ARC5 to the plastid division
site. Plant Cell 18: 2517–2530.
Mukherjee, A., Dai, K. and Lutkenhaus, J. (1993) Escherichia coli cell division
protein FtsZ is a guanine nucleotide binding protein. Proc. Natl Acad. Sci. USA
90: 1053–1057.
Mukherjee, A. and Lutkenhaus, J. (1994) Guanine nucleotide-dependent assembly
of FtsZ into filaments. J. Bacteriol. 176: 2754–2758.
Okazaki, K., Kabeya, Y., Suzuki, K., Mori, T., Ichikawa, T., Matsui, M. et al.
(2009) The PLASTID DIVISION 1 and 2 components of the chloroplast division
machinery determine the rate of chloroplast division in land plant cell
differentiation. Plant Cell 21: 1769–1780.
Olson, B.J.S.C., Wang, Q.A. and Osteryoung, K.W. (2010) GTP dependent
heteropolymer formation and bundling of chloroplast FtsZ1 and FtsZ2. J. Biol.
Chem. 285: 20634–20643.
Osteryoung, K.W. and Pyke, K.A. (2014) Division and dynamic morphology of
plastids. Annu. Rev. Plant Biol. 65: 443–472.
Osteryoung, K.W., Stokes, K.D., Rutherford, S.M., Percival, A.L. and Lee, W.Y.
(1998) Chloroplast division in higher plants requires members of two
functionally divergent gene families with homology to bacterial ftsZ. Plant Cell
10: 1991-2004.
Osteryoung, K.W. and Vierling, E. (1995). Conserved cell and organelle division.
Nature 376: 473–474.
63
Page, D.R. and Grossniklaus, U. (2002) The art and design of genetic screens:
Arabidopsis thaliana. Nat. Rev. Genet. 3: 124–136.
Pyke, K.A. (2013) Divide and shape: an endosymbiont in action. Planta 237: 381–
387.
Pyke, K.A. and Leech, R.M. (1994) A genetic analysis of chloroplast division and
expansion in Arabidopsis thaliana. Plant Physiol. 104: 201–207.
Pyke, K.A., Rutherford, S.M., Robertson, E.J. and Leech, R.M. (1994) arc6, a
fertile Arabidopsis mutant with only two mesophyll cell chloroplasts. Plant
Physiol. 106: 1169–1177.
Raskin, D.M. and de Boer, P.A.J. (1999) Rapid pole-to-pole oscillation of a protein
required for directing division to the middle of Escherichia coli. Proc. Natl Acad.
Sci. USA 96: 4971–4976.
Riemann, M., Muller, A., Korte, A., Furuya, M., Weiler, E.W. and Nick, P.
(2003) Impaired induction of the jasmonate pathway in the rice mutant hebiba.
Plant Physiol. 133:1820-1830.
Sakamoto, W., Miyagishima, S.Y. and Jarvis, P. (2008) Chloroplast biogenesis:
control of plastid development, protein import, division and inheritance.
Arabidopsis Book 6: e0110.
Sakamoto, W. and Takami, T. (2014) Nucleases in higher plants and their possible
involvement in DNA degradation during leaf senescence. J. Exp. Bot. 65: 3835–
3843.
Sano, S. (2011) Isolation of chloroplast division mutant of rice and its application for
molecular breeding. Unpublished masters thesis, Okayama University.
64
Schmitz, A.J., Glynn, J.M., Olson, B.J., Stokes, K.D. and Osteryoung, K.W.
(2009) Arabidopsis FtsZ2-1 and FtsZ2-2 are functionally redundant, but FtsZ-
based plastid division is not essential for chloroplast partitioning or plant growth
and development. Mol. Plant 2: 1211–1222.
Schneider, C.A., Rasband, W.S. and Eliceiri, K.W. (2012) "NIH Image to ImageJ:
25 years of image analysis". Nature Methods 9: 671–675.
Stokes, K.D. and Osteryoung, K.W. (2003). Early divergence of the FtsZ1 and
FtsZ2 plastid division gene families in photosynthetic eukaryotes. Gene 320: 97–
108.
Talebi, A.B., Talebi, A.B. and Shahrokhifar, B. (2012) Ethyl methane sulphonate
(EMS) induced mutagenesis in Malaysian rice (cv. MR219) for lethal dose
determination. Am. J. Plant. Sci. 3: 1661–1665.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S.
(2011) MEGA5: molecular evolutionary genetics analysis using maximum
likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol.
Evol. 28: 2731–2739.
Temnykh, S., Park, W.D., Ayres, N., Cartinhour, S., Hauck, N., Lipovich, L. et al.
(2000) Mapping and genome organization of microsatellite sequences in rice
(Oryza sativa L.). Theor. Appl. Genet. 100: 697–712.
TerBush, A.D. and Osteryoung, K.W. (2012) Distinct functions of chloroplast
FtsZ1 and FtsZ2 in Z-ring structure and remodeling. J. Cell Biol. 199: 623–637.
Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: Improving
the sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res. 22: 4673–4680.
Trojan, A. and Gabrys, H. (1996) Chloroplast distribution in Arabidopsis thaliana
65
(L.) depends on light conditions during growth. Plant Physiol. 111: 419–425.
Vitha, S., Froehlich, J.E., Koksharova, O., Pyke, K.A., van Erp, H. and
Osteryoung, K.W. (2003) ARC6 is a J-domain plastid division protein and an
evolutionary descendant of the cyanobacterial cell division protein Ftn2. Plant
Cell 15: 1918–1933.
Vitha, S., McAndrew, R.S. and Osteryoung, K.W. (2001) FtsZ ring formation at
the chloroplast division site in plants. J. Cell Biol. 153: 111–120.
Wada, M., Kagawa, T. and Sato, Y. (2003) Chloroplast movement. Annu. Rev.
Plant Biol. 54: 455–468.
Webber, A.N. and Baker, N.R. (1996) Control of thylakoid membrane development
and assembly. In: Ort DR and Yocum CF (eds) Oxygenic Photosynthesis: the
Light Reactions, pp 41–58. Kluwer Academic Publishers, Dordrecht, The
Netherlands.
Williams, W.E., Gorton, H.L., Witiak, S.M. (2003) Chloroplast movements in the
field. Plant Cell Environ. 26: 2005–2014.
Wilson, M.E., Jensen, G.S. and Haswell, E.S. (2011) Two mechanosensitive
channel homologs influence division ring placement in Arabidopsis chloroplasts.
Plant Cell 23: 2939–2949.
Yan, J.B., Zhang, C., Gu, M., Bai, Z.Y., Zhang, W.G., Qi, T.C. et al. (2009) The
Arabidopsis coronatine insensitive 1 protein is a jasmonate receptor. Plant Cell
21: 2220-2236.
Yang, Y., Glynn, J.M., Olson, B.J., Schmitz, A.J. and Osteryoung, K.W. (2008)
Plastid division: Across time and space. Curr. Opin. Plant Biol. 11: 577–584.
Yoshida, Y., Kuroiwa, H., Misumi, O., Nishida, K., Yagisawa, F., Fujiwara, T. et
al. (2006) Isolated chloroplast division machinery can actively constrict after
66
stretching. Science 313: 1435–1438.
Yun, M.S. and Kawagoe, Y. (2009) Amyloplast division progresses simultaneously
at multiple sites in the endosperm of rice. Plant Cell Physiol. 50: 1617–1626.
Zhang, M., Hu, Y., Jia, J., Li, D., Zhang, R., Gao, H. et al. (2009) CDP1, a novel
component of chloroplast division site positioning system in Arabidopsis. Cell
Res. 19: 877–886.
Zhang, M., Shmitz, A.J., Kadirjan-Kalbach, D.K., Terbush, A.D. and
Osteryoung, K.W. (2013) Chloroplast division protein ARC3 regulates
chloroplast FtsZ- ring assembly and positioning in Arabidopsis through
interaction with FtsZ2. Plant Cell 25: 1787–1802.
67
Acknowledgement
I would first like to acknowledge and sincerely thank my main supervisor, Dr. Wataru
Sakamoto. He has guided and directed me through my doctoral studies. I have gained
useful skills through his tutelage. His invaluable advice and mentorship has moulded
me to be a better scientist able to critically look at problems and strategically solve
them. I would also like to thank Dr. Masahiko Maekawa who was my co-supervisor
for his helpful advice, supervision and guidance in my field studies. I also pass my
gratitude to my other co-supervisor Dr. Jian Fen Ma.
Secondly I would like to kindly thank Dr. Ryo Matsushima for his supervision and his
directions through my studies especially with his invaluable guidance in my practical
experiments. His level of commitment and quality of work has been astonishing.
Thirdly I will sincerely thank my laboratory members Dr. Lingang Zhang, Dr. Yusuke
Kato, Dr. Tsuneaki Takami, Dr. Nishimura Kenji, Dr. Norikazu Ohnishi, Rie Hijya,
Morie Marie and Fiona Wacera. I would not have been able to successfully complete
my PhD without your help at one point or another. All of you in the plant light
acclimation group have been like a family and I am really grateful for that.
Fourthly I would like to thank Dr. Kathrine Osteryoung and Dr. Deena Kadirjan-
Kalbach at the Michigan State University for providing me with Arabidopsis arc
mutant seeds.
I would also like to thank the Japanese government for awarding me the MEXT
scholarship.
Last but not least I thank my family for their support and encouraging words as I took
this journey of pursuing my doctoral studies.
68