Upload
glyn
View
29
Download
1
Tags:
Embed Size (px)
DESCRIPTION
Molecular Biology Background. Schematic view of DNA organization in a cell. Genes and Genomes. - PowerPoint PPT Presentation
Citation preview
Molecular Biology Background
Schematic view of DNA organization in a cell
• A Gene is the fundamental physical and functional unit of heredity. A gene is an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a specific functional product (i.e., a protein or RNA molecule).
• A Genome is all the genetic material (DNA) in the chromosomes of a particular organism; its size is generally given as its total number of base pairs.
Genes and Genomes
genetics.gsk.com/ graphics/dna-big.gif
• Four nucleotides: adenine (A), cytosine
(C), guanine (G), and thymine (T)
• Bindings:
– A with T (weaker), C with G (stronger)
• Forms a double helix – each strand is
linked via sugar-phosphate bonds
(strong), strands are linked via hydrogen
bonds (weak)
• Genome is the part of DNA that
encodes proteins:
– …AACTCGCATCGAACTCTAAGTC…
DNA Structure
Comparisons between DNA and single stranded RNA with the diagram of the bases showing.
The chemical structure of DNA
Why is genomics interesting for the
signal processing person?
Because there are sequences there!
OK, what sort of sequences?
1. Sequences from an alphabet of size four:
…ATTCGAAGATTTCAACGGGAAAA…
DNA
2. Sequences from an alphabet of size twenty:
AACWYDEFGHIKLMNPQRSTVAPPQR
Protein
Size-4 alphabet:
A, C, T, G: bases (also called or nucleotides)
DNA sequences (genomes) are made of these.
Genes are parts of DNA, and are 4-letter sequences.
Adenine Thymine Cytosine Guanine
or Uracil (in RNA)
DNA: deoxyribonucleic acid
RNA:ribonucleic acid
Central Dogma of Molecular Biology
• Flow of information in a cell
• Recent development of high-throughput technologies that study the above flow
– requires interdisciplinary effort
– dealing with a huge amount of information
Details of the information flow
• Replication of DNA
– {A,C,G,T} to {A, C, G,T}
• Transcription of DNA to mRNA
– {A,C,G,T} to {A, C, G,U}
• Translation of mRNA to proteins
– {A,C,G,U} to {20 amino-
acids}
http://www-stat.stanford.edu/~susan/courses/s166/central.gif
Genes can be turned on and off
The twenty natural amino acids
(B,J,O,U,X,Z missing)
11 essential amino acids.
Animals cannot make the eleven
indicated amino acids.
They need to eat them;
Milk provides all of these.
Grains and beans together
provide all of these.
Protein Example
Fibroblast growth factor proteins
Basic bovine
Acidic bovine
length 146
length 140
Example of a Protein: Hemoglobin (oxy, human)
http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm
Sequence of amino acids. Folds into beautiful 3D shapes. Necessary for function.
Example of a protein (an enzyme)
http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm
The mapping from amino acids to codons is many-to-one
Computational Gene-Finding