Molecular and immunological characterisation of Theileria parva stocks which are components of the ‘Muguga cocktail’ used for vaccination against East Coast fever in cattle

Veterinary Parasitology 94 (2001) 227–237

Molecular and immunological characterisation ofTheileria parvastocks which are components of the‘Muguga cocktail’ used for vaccination against East

Coast fever in cattle

Richard Bishopa,∗, Dirk Geysenb, Paul Spoonera, Robert Skiltona,Vishvanath Nenea, Thomas Dolana,1, Subhash Morzariaa

a International Livestock Research Institute (ILRI), P.O. Box 30709, Nairobi, Kenyab Institute of Tropical Medicine, 155 Nationalestraat, 2000 Antwerp, Belgium

Received 14 June 2000; received in revised form 19 September 2000; accepted 27 September 2000

Abstract

The ‘Muguga cocktail’ which is composed of threeTheileria parvastocks Muguga, Kiambu 5and Serengeti-transformed has been used extensively for live vaccination against East Coast feverin cattle in eastern, central and southern Africa. Herein we describe the molecular characterisationof theT. parvavaccine stocks using three techniques, an indirect fluorescent antibody test with apanel of anti-schizont monoclonal antibodies (MAb), Southern blotting with fourT. parvarepet-itive DNA probes and polymerase chain reaction (PCR)-based assays detecting polymorphismwithin four single copy loci encoding antigen genes. The Muguga and Serengeti-transformedstocks exhibited no obvious differences in their reactivity with the panel of MAbs, whereas Ki-ambu 5 differed with several MAbs. Kiambu 5 DNA was very distinct from the Muguga andSerengeti-transformed isolates in the hybridisation pattern with all four nucleic acid probes, whereasMuguga and Serengeti-transformed isolates exhibited minor differences and could not be dis-criminated with one of the probes. PCR amplification in combination with restriction fragmentlength polymorphism analysis indicated that Kiambu 5 was also markedly divergent from theMuguga and Serengeti-transformed stocks within two of the four antigen coding genes. TheT.parvaSerengeti-transformed stock did not contain a 130 base pair insert within the p67 sporozoiteantigen gene, which has been observed previously in mostT. parvaparasites isolated from buf-falo, and could not be discriminated fromT. parvaMuguga at any of the four single copy loci.Collectively the data indicate that two of the cocktail componentsT. parvaSerengeti-transformedand Muguga are genetically closely related, while the third component Kiambu 5 is quite distinct.

∗Corresponding author. Tel.:+254-2-630-743; fax:+254-2-631-499.E-mail address:[email protected] (R. Bishop).

1Present address: Livestock Service, P.O. Box 24437, Nairobi, Kenya.

0304-4017/01/$ – see front matter © 2001 Elsevier Science B.V. All rights reserved.PII: S0304-4017(00)00404-0

228 R. Bishop et al. / Veterinary Parasitology 94 (2001) 227–237

Based on the findings, there may be a need to include only one of theT. parva Muguga andSerengeti-transformed components in the immunising cocktail. The study demonstrates the valueof molecular characterisation data for monitoring of live vaccines. © 2001 Elsevier Science B.V.All rights reserved.

Keywords: Theileria parva; Cattle-protozoa; East Coast fever; Immunisation; DNA probes; Monoclonalantibodies; Polymorphic antigen genes

1. Introduction

Theileriosis, caused by the protozoan parasiteTheileria parva, continues to pose a seriousthreat to cattle productivity in eastern, central and southern Africa and is estimated to costUS$ 169 million annually within the region (Mukhebi et al., 1992). At present, apart fromregular use of acaricides to kill ticks, the only effective means of protecting cattle at risk in thefield is by the “infection and treatment” method of immunisation. This method involves theinoculation of a live, potentially lethal dose of the parasite and simultaneous treatment witha formulation of a long-acting oxytetracycline (Radley, 1981). Since protection engenderedby this method of immunisation is ‘strain’ specific, attempts have been made to identifysingle stocks, or combinations of several parasite stocks that provide broad immunologicalprotection. One such mixture referred to as the ‘Muguga cocktail’, was developed in the early1970s (Radley et al., 1975a,b). This “cocktail” has given significant protection to immunisedcattle in several countries (see Morzaria and Williamson, 1999 for recent summaries).

A battery of monoclonal antibodies, DNA probes and PCR primers forT. parvacharacter-isation has been developed over the last 15 years (Minami et al., 1983; Conrad et al., 1987;Allsopp and Allsopp, 1988; Sohanpal et al., 1995; Bishop et al., 1998) and selectively usedto genotypeT. parvastocks from buffalo and cattle in several previous studies (Allsopp et al.,1989; Conrad et al., 1989; Bishop et al., 1993a, 1994). However, the full range of availableprobes has not so far been applied to the systematic characterisation of theT. parvastockswhich are most widely used for vaccination against East Coast fever. Such characterisationmight be of practical value in defining a more varied cocktail of vaccination stocks, or reduc-ing costs by negating the inclusion of genetically identical isolates. The Muguga “cocktail”comprises three stocks ofT. parva, Muguga, Kiambu 5 and Serengeti-transformed, whichwere selected on the basis of cattle cross-immunity trials (Radley et al., 1975a,b) when thetools for laboratory characterisation of these parasites were not available. We present dataon the in vitro characterisation of the component stocks of the Muguga “cocktail” generatedduring the preparation of a large immunising stabilate intended for field use (Morzaria et al.,1999). In addition to the application of the existing MAbs and multicopy DNA probes wehave developed novel assays based on PCR amplification and RFLP analysis of single copygenes encoding polymorphic antigens, in order to ensure wider coverage of different typesof loci within the genome. The results from the combination of all the characterisation toolsindicate that two of the three stocks comprising the “cocktail” components are geneticallyvery similar.

R. Bishop et al. / Veterinary Parasitology 94 (2001) 227–237 229

2. Materials and methods

2.1. Parasite stocks

TheT. parvastocks used in this study were obtained as stabilates from the FAO Tick-borneDiseases Vaccine Production Centre in Malawi. The Muguga stabilate 73 (CVL, 1.10.91)was derived from a cattle/tick passage of stabilate 57 (CVL, 9.11.84), which in turn wasderived from a tick/cattle passage of stabilate 147 (KARI, 17.9.76). The Kiambu 5 stabilate68 (CVL, 20.9.89) was derived from a tick/cattle passage of an unspecified stabilate obtainedfrom KARI in May 1987. The Serengeti-transformed stabilate 69 (CVL, 14.9.89) wasderived from stabilate 17 (CVL, 23.10.81), which was prepared from ticks obtained fromKARI in October 1980.

2.2. Infection of cattle and parasite isolation

Bos tauruscattle, 6–8 months old, were obtained from the ILRI ECF-free ranch at Kapiti.Each stock was inoculated separately into four cattle, in a 1 ml volume subcutaneouslybelow the right ear. Cattle were monitored daily for pyrexia, and those with a tempera-ture of 39.5◦C and above were examined further for the presence of macroschizonts andpiroplasms in Giemsa-stained lymph-node biopsy and blood smears, respectively. CleanRhipicephalus appendiculatusnymphal ticks were applied on all infected cattle to attemptto isolate the parasites in the ticks, and lymph-node biopsies were taken for culture isola-tion as previously described (Brown, 1979). Infected lymphoblastoid cells from establishedcultures were used as a source of (1) antigen for the indirect immunofluorescence antibodytest (IFAT) used for monoclonal antibody (MAb) characterisation (Minami et al., 1983),and (2) DNA for Southern blotting and PCR analysis using a range of nucleic acid-basedprobes (Bishop et al., 1993a). Reference stabilates of each stock, were made from thedissected salivary glands of pooled ticks, which fed on the four cattle infected with theindividual stocks. These stabilates were used to infect clean bovine lymphocytes from adonor animal and the cell-lines established were then characterised as using the techniquesdescribed below.

2.3. Monoclonal antibody profiles

The MAb profiles were determined for parasite isolations made in culture using a panelof nine monoclonal antibodies (MAbs), most of which recognise epitopes on the the poly-morphic immunodominant molecule (PIM) ofT. parvaschizonts (Toye et al., 1996). Thispanel of MAbs was selected from those used previously to characterise stocks ofT. parva,i.e. MAbs 1–4, 7, 10, 12 and 15 (Minami et al., 1983) and MAb 22 (Conrad et al., 1989).The reference numbers for these MAbs, as reported, have been retained.

Briefly, for the test, the cultured infected lymphoblasts were formalin-fixed and spottedonto microscope slides. The reactions to the panel of MAbs were determined in an indirectfluorescent antibody test and expressed as positive when either all schizont-infected cellsshowed fluorescence, or a percentage of cells reacted.


2.4. Southern blotting using multicopy DNA probes

Isolation of DNA from culturedT. parvaschizont-infected lymphoblasts was performedas described (Conrad et al., 1987). Infected lymphocyte DNA (20mg) was digested tocompletion using restriction enzymeEcoRI, according to the manufacturer’s instructions(New England Biolabs). Digested DNA was electrophoresed through 0.8% agarose gels andtransferred onto Hybond N nylon filters (Amersham). Southern blotting and hybridisationof filters at 60◦C with probes labelled with [a-32P] CTP using a Prime-It kit (Amersham),used standard methods (Sambrook et al., 1989). After hybridisation, filters were washed in2×SSC/0.1% SDS at 60◦C. The four nucleic acid probes used were (1) A 623 bp sequencecloned in pUC8, which forms part of the Tpr multicopy locus (Allsopp and Allsopp, 1988;Allsopp et al., 1989; Baylis et al., 1991); (2) a schizont cDNA, designated LA6, clonedin pCDM8 which hybridises to multiple genomic copies inT. parvaDNA (Bishop et al.,1993b); (3) aT. parvaminisatellite sequence cloned inlgt11,lTpMS 111, which is presentat multiple dispersed loci on allT. parvachromosomes (Bishop et al., 1998)); and (4) aT.parvatelomeric DNA probe, pTpUtel (Sohanpal et al., 1995).

2.5. PCR-based assays for detection of polymorphism at specific loci

PCR-based assays were developed for amplifying four single copy genes encoding im-munogenic proteins. The first locus encodes a polymorphic immunodominant protein (PIM)characterised by Toye et al. (1995). Primers used in these experiments gave different sizedproducts between 700 and 1000 bp long when used on DNA from different isolates. The sec-ond locus encodes a 150 kDa microsphere protein described by Skilton et al. (1998). Primerswere designed to encompass the entire polymorphic region, amplifying a region of approx-imately 940 bp. The third locus codes for a protein p104 which was characterised by Iamset al. (1990). Primers were designed encompassing the polymorphic region, giving a 1000 bpamplification product. The fourth locus encodes p67, a sporozoite surface antigen for whichthe gene has been characterised previously (Nene et al., 1992). Primers were designed toamplify a 320 bp region in the centre of the p67 gene. The protocol described by Conradet al. (1987) was used to extract genomic DNA fromT. parvaschizont-infected lympho-cytes. This DNA (10 ngml−1) was used as the template in the PCR assays in a total volumeof 25ml. Each reaction contained 50 mM KCl, 10 mM Tris–HCl pH 8.3, 1.5 mM MgCl2,200mM of each dNTP, 40 pmol (1.6mM) of each primer and 1.5 UTaqpolymerase. Eachmixture was placed in a programmable thermocycler for PCR amplification (PTC-100, MJResearch, CA). The amplification programme was as follows. Step 1: 94◦C for 4 min; Step2: 94◦C for 1 min; Step 3: annealing temperature for 2 min; Step 4: extension temperature of72◦C for 2 min; repeated for 39 cycles. Five microlitres of each reaction was loaded onto 2%agarose mini gels, stained in ethidium bromide and photographed under UV illumination.

2.6. RFLP-analysis of PCR products

For further typing of the PCR products generated from p104, p150 and PIM, an RFLPbased method was used. Sequence data for the three surveyed loci were available and iden-tification of suitable restriction enzymes was performed using the Gene Jockey II program


(Biosoft, Cambridge). Restriction enzyme digestion according to the manufacturer’s speci-fications (BRL) using 10 unitsmg−1 DNA was performed overnight using 5ml of amplifiedDNA in a 15ml total volume. An aliquot of the sample was subsequently analysed on a10% polyacrylamide gel. The gel was stained using a commercial silver staining kit andmounted for storage. The Primers ILO 759 (5′ TAAGATGCCGACTATTAATGACACC 3′)and ILO 755 (5′ CCGTTTGATCCATCATTCAAGG 3′) were used for p104 amplificationat an annealing temperature of 60◦C. Amplified products were digested withAluI. For thep150 assay, primers Np150nF (5′ CGACTTGAAGAAGAAGATTACAGT 3′) and Np150R(5′ TTACCATCTTCACCGCGAAC 3′) were used with an annealing temperature of 60◦C.Amplified products were digested withSau3AI. For the PIM assay, primers PIMF (5′ AA-CACAAGTTGATACTGAAT 3′) and PIMR (5′ CAACCGTGGAATGGCGTATGTT 3′)were used with an annealing temperature of 58◦C. Amplified products were digested withBclI. For amplification of the central region of p67 primers ILO 6015 (5′ CAGGTGAAAC-TACATCGG 3′) and ILO 6016 (5′ TACTCAAAAAAACAAACC 3 ′) were used with anannealing temperature of 55◦C.

3. Results

3.1. Anti-schizont MAb profiles

The MAb profiles for each individual stock comprising the “cocktail” are given inTable 1. The profiles of the single isolates were consistently similar for each stock. There-fore, for ease of presentation, each MAb profile is a summary of data from four cattleinoculated with one of each seed stock and two culture isolates made from each animal.The profiles are presented also from in vitro infections using the reference stabilates pre-pared from the individual stocks. MAbs 2, 3, and 22 recognised a schizont antigen in theMuguga and Serengeti-transformed isolates, but not in the Kiambu 5 isolates. MAb 15recognised a schizont antigen in the Kiambu 5 isolates, but did not react with the Mugugaand Serengeti-transformed isolates. For all culture isolates examined, the characterisationprofiles of the Muguga and Serengeti-transformed stocks obtained either from cattle inocu-

Table 1Comparison of the IFA profiles of the component stocksa

Stock Isolation from Monoclonal antibody number

1 2 3 4 7 10 12 15 22

Kiambu 5 Seed stabilate in cattle + − − + + + + +% −Reference stabilate + − − + + + + +% −

Muguga Seed stabilate in cattle + + + + + + + − +Reference stabilate + + + + + + + − +

Serengeti transformed Seed stabilate in cattle+ + + + + + + − +Reference stabilate + + + + + + + − +

a +: All cells fluorescing;−: no cells fluorescing;+%: percentage of cells fluorescing.


lated with the seed stocks, or from the in vitro infections using the reference stabilates wereindistinguishable using this MAb panel. This profile was significantly different from thatof the Kiambu 5 isolates, as defined by the reactions of MAbs 2, 3, 15 and 22. The MAbprofiles are the same as those from the identical stabilates of the seed stocks determinedfrom cattle infections 3 years earlier (data not presented).

3.2. RFLPs detected using multicopy nucleic acid probes

Hybridisation of theT. parvaLa6, Tpr, telomeric and minisatellite nucleic acid probes toEcoRI-digested DNAs (Fig. 1, panels A–E, respectively) demonstrated very close similarityin restriction fragment patterns betweenT. parvaMuguga andT. parvaSerengeti-transformedin each case. In contrast the restriction patterns ofT. parva Kiambu 5 were very dis-tinct with all four probes (Fig. 1, A–D, lane 5). The restriction fragment patterns ofMuguga and Serengeti-transformed were not detectably different using the La6 probe(Fig. 1, panel A). Using the Tpr probe a fragment of approximately 5.0 kb was presentin Muguga, but absent from Serengeti-transformed, but the two were otherwise identi-

Fig. 1. Southern blot analysis of Muguga cocktail stocks using fourT. parvanucleotide probes. Autradiographsare shown ofEcoRI-digested schizont-infected lymphocyte DNA, blotted onto nylon membranes, hybridised with[a-32P] CTP-labelled probes and washed in 2×SSC/0.1% SDS at 60◦C. The filters were hybridised withT. parvaDNA probes as follows: an LA6 repeat probe (Panel A); a Tpr repeat probe (Panel B); a telomeric probe (PanelC) and a minisatellite probe (Panels D and E). The lanes in panels A–D are: 1,T. parvaMuguga (ILRAD); 2,T.parvaMuguga (Malawi); 3,T. parvaSerengeti-transformed (ILRI); 4,T. parvaSerengeti-transformed (Malawi);5, T. parvaKiambu V. The lanes in panel E are 1,T. parvaMuguga (ILRI); 2,T. parvaSerengeti-transformed(ILRI). Restriction fragments which are polymorphic between Muguga and Serengeti-transformed are indicatedby arrows.


cal (Fig. 1, panel B). In the case of the telomeric probe and the minisatellite probe therewere either one or two individual restriction fragment length polymorphisms (RFLPs) be-tween the profiles of Muguga and Serengeti-transformed (Fig. 1, panels C and D, respec-tively), but they were similar overall. Differences between the patterns of Muguga andSerengeti-transformed are highlighted by arrows in Fig. 1. The results were completelyconsistent between DNA samples from ILRI reference stabilates and those produced atthe Malawi vaccine production centre (compare lanes 1and 2 for Muguga and 3 and 4for Serengeti-transformed). The results from the four independent DNA probes, indicatethat theT. parvaMuguga and Serengeti-transformed stocks are closely related genetically.These probes collectively sample variation from at least 30 loci, for example the minisatel-lite sequence alone is present at more than 20 widely dispersed sites in the genome (Bishopet al., 1998).

Fig. 2. PCR-RFLP characterisation of Muguga cocktail stocks at three antigen gene loci. Genomic DNA derivedfrom T. parvaschizont-infected lymphocyte cultures was PCR-amplified with specific primers derived from thep104, PIM and p150 loci and digested with the restriction enzymesAluI, BclI andSauIIIA, respectively. Sampleswere resolved by electrophoresis through 10% polyacrylamide gels and visualised by silver staining.


3.3. Analysis of polymorphism within single copy loci encoding antigen genes

The profiles generated by applying PCR-RFLP analysis on the p104, PIM and p150 locito the three component stocks of the Muguga cocktail are presented in Fig. 2. The Mugugaand Serengeti-transformed stocks have the same profiles at all three loci confirming theclose relationship suggested by other criteria. The PCR-RFLP profile of Kiambu 5 differedmarkedly from that of Muguga and Serengeti-transformed at the p104 and PIM loci, butappeared similar at the p150 locus, at least with the limited range of enzymes used in thisstudy. The amplified product sizes correspond to the predicted sizes based on the publishedPIM and p150 sequences ofT. parvaMuguga. Size variations were detected directly byPCR, only in amplified products of the PIM locus. The PCR-RFLP profiles of theT. parvaMuguga stock correspond to the predicted sizes generated from the sequence using the GeneJockey II computer programme (Biosoft, Cambridge). The amplified products generatedfrom all three cocktail stocks with the p67 primers, including the product from theT. parvaSerengeti-transformed stock, were identical in size being approximately 320 bp (Fig. 3,lanes 3–5). A product of this size is typically observed in cattle-derivedT. parvastocks,whereas an 130 bp insert (Fig. 3, lane 2) is, present in most buffalo-derivedT. parvastockswhich have been characterised (Nene et al., 1996, 1999).

Fig. 3. PCR amplification of the central region of the p67 sporozoite antigen gene from the Muguga cocktail stocksand a clonedT. parvaisolate from buffalo 7014. A 320 bp region within the coding sequence of the p67 gene wasPCR-amplified using specific primers. Samples were resolved by electrophoresis through a 1% agarose gel andvisualised by fluorescence under UV light after staining with ethidium bromide.


4. Discussion

The results presented here describe techniques which could form the basis of a for-mal protocol for characterisation of stocks for use in immunization against theileriosiscaused byT. parva. Both the standards committee of the Food and Agriculture Organisa-tion (FAO)/Multidonor Regional Programme on control of ticks and tick-borne diseasesand the Office International des Epizooties (OIE) have highlighted the requirement for suchcharacterisation. Our data represents the first comprehensive characterisation, in vitro, ofthe components of theT. parvaMuguga “cocktail” which has been used extensively inimmunisation programmes in Malawi, Uganda and Tanzania, and represents a first step inattempting to standardise the components of live vaccines against tick-borne diseases. Inthis study, in addition to the application of anti-schizont MAbs and repetitive DNA probeswhich have been used in earlierT. parvastudies (Conrad et al., 1987, 1989; Allsopp et al.,1989; Bishop et al., 1993a), we have also used PCR-RFLP analysis of single copy lociencoding antigen genes. We show that this method discriminates parasite stocks with a res-olution almost equal to that of Southern blotting, but has advantages for application to fieldsamples since only small quantities of material are needed for PCR amplification and thereis no requirement for radioisotopes. The tools for the laboratory characterisation ofT. parvawere not available for use in the early 1970s and cross-immunity experiments were usedin the selection of stocks for the ‘Muguga cocktail’. Therefore, it is difficult to determinewhether there has been a change in the characteristics of the seed stock stabilates used forpreparation of the original and current immunising stabilates. Certainly, the seed stabilatesused for preparation of the current immunising stabilate are no longer the original referencestabilates and have been derived by passage of the seed stocks between ticks and cattle.

Our results demonstrate significant differences between theT. parvaKiambu 5 compo-nent and theT. parvaMuguga and Serengeti-transformed components, using both MAbprofiles, RFLPs detected by multicopy DNA probes and analysis of single copy loci byPCR-RFLP. However, a remarkable similarity was shown between theT. parvaMugugaand Serengeti-transformed components. This contrasts with the wide range of genotypicand phenotypic variation observed whenT. parvaisolates from cattle and buffalo are anal-ysed using these characterisation tools (Conrad et al., 1987, 1989; Allsopp et al., 1989;Bishop et al., 1993a). Prior to the original development of the “cocktail”, cross-immunityexperiments were performed using the component stocks (Radley et al., 1975b). Groups offive cattle were immunised either with the three “cocktail” stocks, by the standard “infectionand treatment” method, or immunised with the Muguga stock and challenged with eitherthe Kiambu 5 or the Serengeti-transformed stocks. These three groups of cattle were thenchallenged with a Kiambu 1 stabilate. The results indicated that the three stocks gave betterprotection than the Muguga stock combined with either of the other two stocks. However,as discussed in the original publication, some of the variability in immunity to challenge,between the groups, could have resulted from the differences in the methods of inducingimmunity in these cattle. With the high costs involved in preparation and characterisationof an immunising “cocktail” stabilate, it is important that each component is demonstratedto be essential. The similarities between theT. parvaMuguga and Serengeti-transformedcomponents, demonstrated above, suggest that these two stocks should be re-investigated


in cattle cross-immunity studies. If these cattle studies support the laboratory findings, thenthere may be a need to include only one of theT. parvaMuguga and Serengeti-transformedcomponents. In conclusion, our results clearly indicate the potential utility of molecularcharacterisation of the component stocks of immunizing stabilates as a tool for qualitycontrol of live vaccines against theileriosis in eastern, central and southern Africa.

Acknowledgements

We appreciate the excellent technical assistance of Timothy Njoroge and Luka Juma.This is ILRI publication number 200021. We are grateful to Dr. F.L. Musisi and colleagueson the FAO Regional Tick and Tick-borne diseases project GCP/RAF/291/Den and the staffof the Central Veterinary Laboratory, Lilongwe, Malawi for provision of working stabilates.

References

Allsopp, B.A., Allsopp, M.T.E.P., 1988.Theileria parva: genomic DNA studies reveal intra-specific sequencediversity. Mol. Biochem. Parasitol. 28, 77–84.

Allsopp, B., Carrington, M., Baylis, H., Sohal, S., Dolan, T., Iams, K., 1989. Improved characterisation ofTheileriaparva isolates using the polymerase chain reaction and oligonucleotide probes. Mol. Biochem. Parasitol. 35,137–148.

Baylis, H.A., Sohal, S.K., Carrington, M., Bishop, R.P., Allsopp, B.A., 1991. An unusual repetitive gene familyin Theileria parvawhich is stage-specifically transcribed. Mol. Biochem. Parasitol. 49, 133–142.

Bishop, R.P., Sohanpal, B.K., Allsopp, B.A., Spooner, P.R., Dolan, T.T., Morzaria, S.P., 1993a. Detection ofpolymorphisms amongTheileria parvastocks using repetitive, telomeric and ribosomal DNA probes andanti-schizont monoclonal antibodies. Parasitology 107, 19–31.

Bishop, R., Baylis, H., Allsopp, B., Toye, P., Nene, V., Dolan, T., Spooner, P., Kibe, M., Morzaria, S., 1993b.Genomic polymorphisms inTheileria parva. In: Morzaria, S.P. (Ed.), Genome Analysis of Protozoan Parasites.ILRAD, Nairobi, Kenya, pp. 61–66.

Bishop, R.P., Spooner, P.R., Kanhai, G.K., Kiarie, J., Latif, A.A., Hove, T., Masaka, S., Dolan, T.T., 1994. Molecularcharacterisation ofTheileriaparasites: application to the epidemiology of theileriosis in Zimbabwe. Parasitology109, 573–581.

Bishop, R.P., Morzaria, S.P., Gobright, E.I., 1998. Invariant linkage of two distinct AT rich minisatellites at multipledispersed loci in the genome ofTheileria parva. Gene 216, 245–254.

Brown, C.G.D., 1979. Propagation ofTheileria. In: Maramorosch, K., Hirumi, H. (Eds.), Practical Tissue CultureApplications. Academic Press, New York, pp. 223–245.

Conrad, P.A., Iams, K., Brown, W.C., Sohanpal, B., ole-MoiYoi, O.K., 1987. DNA probes detect genomic diversityin Theileria parvastocks. Mol. Biochem. Parasitol. 25, 213–226.

Conrad, P.A., ole-MoiYoi, O.K., Baldwin, C.L., Dolan, T.T., O’Callaghan, C.J., Njammungeh, R.E.G.,Grootenhuis, J.G., Stagg, D.A., Leitch, B.L., Young, A.S., 1989. Characterisation of buffalo-derived theilerialparasites with monoclonal antibodies and DNA probes. Parasitology 98, 179–188.

Iams, K.P., Young, J.R., Nene, V., Desai, J., Webster, P., ole-MoiYoi, O., Musoke, A.J., 1990. Characterisation ofthe gene encoding a 104 kilodalton microneme-rhoptry protein ofTheileria parva. Mol. Biochem. Parasitol.39, 47–60.

Minami, T., Spooner, P.R., Irvin, A.D., Ocama, J.G.R., Dobbelaere, D.A.E., Fujinaga, T., 1983. Characterizationof stocks ofTheileria parvaby monoclonal antibody profiles. Res. Vet. Sci. 35, 334–340.

Morzaria, S., Williamson, S. (Eds.), 1999. Live vaccines forTheileria parva: deployment in eastern, central andsouthern Africa. In: Proceedings of the Workshop of ILRI, Nairobi, Kenya, 10–12 March 1997. ILRI, Nairobi,Kenya.


Morzaria, S., Spooner, P., Bishop, R., Mwaura, S., 1999. The preparation of a composite stabilate for immunisationagainst East Coast fever. In: Morzaria, S., Williamson, S. (Eds.), Live vaccines forTheileria parva: Deploymentin Eastern, Central and Southern Africa. ILRI, Nairobi, Kenya, pp. 56–61.

Mukhebi, A.W., Perry, B.D., Kruska, R., 1992. Estimated economics of theileriosis control in Africa. Prev. Vet.Med. 12, 73–85.

Nene, V., Iams, K.P., Gobright, E., Musoke, A.J., 1992. Characterisation of the gene encoding a candidate vaccineantigen ofTheileria parva. Mol. Biochem. Parasitol. 51, 17–28.

Nene, V., Musoke, A., Gobright, E., Morzaria, S., 1996. Conservation of the sporozoite p67 vaccine antigen incattle-derivedTheileria parvastocks with different cross-immunity profiles. Infect. Immun. 64, 2056–2061.

Nene, V., Gobright, E., Bishop, R., Morzaria, S., Musoke, A., 1999. Linear peptide specificity of antibody responsesto p67 and sequence diversity of sporozoite neutralising epitopes: implications for aTheileria parvavaccine.Infect. Immun. 67, 1261–1266.

Radley, D.E., 1981. Infection and treatment immunisation against theileriosis. In: Irvin, A.D., Cunningham,M.P., Young, A.S. (Eds.), Proceedings of the International Conference of ILRI on Advances in the controlof Theileriosis, Nairobi, Kenya, 9–13 February, 1981. Martinus Nijhoff, The Hague, pp. 227–236.

Radley, D.E., Brown, C.G.D., Burridge, M.J., Cunningham, M.P., Kirimi, I.M., Purnell, R.E., Young, A.S., 1975a.East Coast fever. 1. Chemoprophylactic immunization of cattle againstTheileria parva(Muguga) and fivetheilerial strains. Vet. Parasitol. 1, 35–41.

Radley, D.E., Brown, C.G.D., Cunningham, M.P., Kimber, C.D., Musisi, F.L., Payne, R.C., Purnell, R.E., Stagg,S.M., Young, A.S., 1975b. East Coast fever. 3. Chemoprophylactic immunization of cattle using oxytetracyclineand a combination of theilerial strains. Vet. Parasitol. 1, 51–60.

Sambrook, J.E., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning a Laboratory Manual, 2nd Edition. ColdSpring Harbor Laboratory, New York.

Skilton, R.A., Bishop, R.P., Wells, C.W., Spooner, P.R., Gobright, E., Nkonge, C., Musoke, A.J., Macklin, M.,Iams, K.P., 1998. Cloning and characterisation of a 150 kDa microsphere antigen ofTheileria parvathat isimmunologically cross-reactive with the polymorphic immunodominant molecule (PIM). Parasitology 117,321–330.

Sohanpal, B.K., Morzaria, S.P., Gobright, E.I., Bishop, R.P., 1995. Characterisation of the telomeres at oppositeends of a 3 MbTheileria parvachromosome. Nucl. Acids Res. 23, 1942–1947.

Toye, P.G., Metzelaar, M.J., Wijngaard, P.J.L., Nene, V., Iams, K., Roose, J., Nyanjui, J.K., Gobright, E., Musoke,A.J., Clevers, H.C., 1995. Characterisation of the gene encoding the polymorphic immunodominant molecule,a neutralizing antigen ofTheileria parva. J. Immunol. 155, 1370–1381.

Toye, P., Nyanjui, J., Goddeeris, B., Musoke, A.J., 1996. Identification of neutralization and diagnostic epitopeson PIM, the polymorphic immunodominant molecule ofTheileria parva. Infect. Immun. 64, 1832–1838.

Documents

Molecular and immunological characterisation of Theileria parva stocks which are components of the ‘Muguga cocktail’ used for vaccination against East Coast fever in cattle