1  

Supporting Data:

Modular Control of Multiple Pathways using Engineered Orthogonal T7 Polymerases

I. Phage RNAP and Promoter Subfamilies .............................................................................. 2 II. Promoter Characterization .................................................................................................... 3

III. Terminator Characterization ................................................................................................. 6 IV. Plasmid Construction and Maps ........................................................................................... 8

V. Part Sequences .................................................................................................................... 11 VI. References ........................................................................................................................... 13

  2  

I. Phage RNAP and Promoter Subfamilies Bioinformatics was applied to guide our design of orthogonal RNAP:promoter interactions. Initially, we searched the NCBI database for homologs of the T7 RNAP via a BLAST search. This resulted in a set of 43 proteins with an E-value lower than 1-100. This was narrowed to 28 by constraining the set to only include phage RNAPs with fully sequenced genomes. These were aligned using ClustalW to identify the specificity loop (T7 G732-P780) of each polymerase (Figure S1) (1). The 28 RNAPs were clustered into 13 subfamilies according to the ClustalW guide tree (family defined as < 0.1 distance between members). Promoters in each phage genome were identified from annotations in the NCBI record. The list of identified promoters was supplemented by scanning each genome using the PHIRE (Phage In silico Regulatory Elements) software package (2). PHIRE performs algorithmic string-based search across a phage genome to identify regulatory elements based on conserved sequence similarity. WebLogo was used to generate sequence logos for each phage from the identified promoters (3), and the regions from -12bp to -7bp in each logo were aligned. Within the 13 identified phage subfamilies, the consensus promoter sequences for each phage are identical (Figure S1). A representative logo sequence is shown for each subfamily.

Figure S1: RNAP subfamilies and associated promoter alignments. T7-like phages are grouped into subfamilies based on sequence similarity of the RNAP specificity loop (G732-P780). Weblogo sequences were generated from identified promoters in each phage genome. Within each phage subfamily, consensus promoter sequences were consistent. A representative weblogo is shown for each subfamily.

  3  

II. Promoter Characterization II.A. Relative Expression Units In this manuscript, the output of promoters is reported as relative expression units (REU). This is simply a linear factor that is multiplied by the arbitrary units measured by the flow cytometer. The objective of normalizing to REU is to standardize measurements between labs and projects. The linear factor is 1.6 × 10-4 and the division by this number back converts to the raw arbitrary units. This number was calculated to be a proxy to the RPU (relative promoter units) reported by Kelly and co-workers (4). Our original standardized measurements involved a different reference promoter, fluorescent protein (mRFP), RBS, and plasmid backbone. Because of these differences, one cannot calculate RPU as defined by Kelly, et al. Instead, a series of plasmids was made (Figure S2) to estimate the relative expression of reporter protein from experimental constructs compared the standard construct in Kelly, et al. Conversion factors between constructs were measured and multiplied to obtain the linear factor above. We renamed the unit to REU (relative expression units) because it is intended to be a simple normalization of fluorescent units (akin to a fluorescent bead) and not a direct measurement of the activity of a promoter (e.g., the polymerase flux). Portions of this methods section have been previously published and reproduced with permission (5).

Figure S2. Promoter Characterization using Relative Expression Units. Conversion of arbitrary units into Relative Expression Units (REU). Promoters were characterized using mRFP1 fluorescent reporter protein in N155 (Measured Promoters). Data were first normalized by the fluorescence of N110 (Internal Standard) and then scaled by the fluorescence of N155(J23100) to account for RBS differences between N155 and N110 (RBS Adjustment). To directly compare our measurements to expression levels of the Kelly et al. standards, we further multiplied by the ratio of N110 fluorescence to the fluorescence of a Kelly standard plasmid expressing mRFP1 (RFP Promoter Standard). A final conversion factor is applied to compare all measurements to the Kelly et al. J23101-EGFP promoter standard based on a strong linear correlation of promoter strength (RPU) between constructs expressing mRFP and EGFP. Solid and dashed boxes were drawn to indicate which plasmids were measured at different facilities. Asterisked and non-asterisked units were measured in different facilities and correspond to the conversion factors directly above.

aumeas. auJ23100.mrfp auN110

MeasuredPromoters

P

terminators

mrfp

J23100

CmRpSC101

N110

Internal Standard

P

terminator

mrfp

J23100

KanR

p15A

J23100.mrfp

RFP Prom.Standard

P

terminator

egfp

J23101

KanR

p15A

J23101.egfp

Kelly et al.Prom. Standard

X = REU

P

terminators

mrfp

J23100

CmRpSC101

N155(J23100)

RBS Adjustment

auN110

1 X XauN155(J23100)

auN110X

0.028 0.18 0.70

RPUJ23101.egfp

RPUJ23100.mrfp

0.045P

terminators

mrfp

T7

CmRpSC101

N155(PT7)

**

**

**

  4  

II.B. Inducible Promoter Characterization and T7 Promoter library

Figure S3. Promoter characterization for Ptac promoter (left) and Ptet promoter (right). The promoter strengths of Ptac promoter (plasmid N149) and Ptet promoter (plasmid N521) were measured under varied concentrations of inducers (IPTG or aTc). Each inducible promoter drives expression of mRFP in these constructs. The strengths of T7 promoters (T7 wild-type and mutants, Figure 3B) are shown as horizontal dotted lines. The strengths of T7 promoter mutants were characterized under 1mM IPTG induction from T7* RNAP (plasmid N249). The measured fluorescence (AU) for each mutant was converted to REU after subtracting the autofluorescence of cells not carrying any plasmid. II.C. Detailed Promoter Orthogonality Measurements Data is shown in Figure S4 corresponding to Figure 2B in the main text. This data provides the comparison of induced and uninduced fluorescence levels as well as error bars.

Figure S4: Orthogonality of all RNAP-promoter pairs. Orthogonal RNAPs were co-transformed with promoter mutants controlling mRFP in the base plasmid N155. The strength of expression under 1mM IPTG induction was measured by flow cytometry (geometric mean) and converted to relative expression units (REU) after subtraction of the autofluorescence of E coli harbouring no plasmid. Error bars represent the standard deviation of three experiments on different days.

Stre

ngth

(REU

)

10-2

100

10-1

0 101 102 103

,37*��ѥ0�100 0 100 101 102

aTc (ng/ml)10-1

Stre

ngth

(REU

)

101

10-2

100

10-1

101

Prom

oter

Act

ivity

(REU

)

10-3

10-1

10-2

100

T7*(N4)T7*(K1F)T7* T7*(T3)

pT3pT7 pK1F pN4 pT3pT7 pK1F pN4 pT3pT7 pK1F pN4 pT3pT7 pK1F pN4

  5  

II.D. Correlation of T7 and T3 Promoter Activity Figure S5 shows the correlation between the T7 and T3 promoters that result from changing the strength-determining region. The strength of the T3 promoter is systematically higher, but the rank order is highly correlated.

Figure S5: Modularity of strength region in the T7 promoter. The strengths of T7 promoters (Figure 3A, top left) are plotted against the strengths of the corresponding T3 promoters (Figure 3A, bottom right). Vertical error bars represent the error in measurement of T7 promoter strength taken from Figure 3A, and horizontal error bars reflect the T3 promoter strength error from Figure 3A. A line with slope of 1 is fit to the data. II.E. Time Courses for of all the Orthogonal RNAPs The timing of induction for each RNAP and its cognate promoter is shown in Figure S6. Briefly, cells were grown as described in the Fluorescence Characterization assay (Materials and Methods) with the following exceptions. Following the initial 14 hour incubation, cells were diluted into 5ml fresh LB (+ antibiotics, - inducers, final OD600 of 0.25, 15 ml Falcon tubes) and were incubated for 2.5 hours (37°C, 250 rpm). After this dilution step, cells were diluted into fresh LB a second time as described in the original assay. Timepoints are measured relative to the second dilution.

Figure S6: Temporal induction of RNAP expression. The expression of T7* RNAPs was measured over time. Orthogonal RNAPs were co-transformed with promoter mutants controlling mRFP in the base plasmid N155, and strength of expression under 1mM IPTG induction was measured by flow cytometry (geometric mean) and

T7*(

T3) S

treng

th (R

EU)

10-1

100

T7* Strength (REU)10-2 10-1 10010-3

10-2

10-3

Stre

ngth

(REU

)

10-2

100

10-1

0

Time (h)4 5 6 7 8 9 10

  6  

converted to relative expression units (REU). Blue: T7*-PT7, Green: T7*(T3)-PT3, Yellow: T7*(K1F)-PK1F, Red: T7*(N4)-PN4. Error bars represent the standard deviation of three experiments on different days. II.F. Representative Cytometry Distributions for the Orthogonal RNAPs Representative population distributions from flow cytometry data for Figures 2, 3 and 4 are shown in Figure S7. Data were gated by forward and side scatter, and each dataset consists of at least 25,000 cells. Histograms correspond to cell counts binned by measured RFP fluorescence.

Figure S7: Representative cytometry distributions. (A) Cell distributions for uninduced (red) and induced (blue) populations carrying each RNAP and cognate promoter. Left to right: T7*-PT7, T7*(T3)-PT3, T7*(K1F)-PK1F, T7*(N4)-PN4. The distributions are representative samples from the data used to generate Figure 2C and Figure S4. (B) Cell distributions from the data used to generate Figure 3B. Colors corresponding to each promoter: 1, red; 2, blue; 3, green; 4, yellow; WT, cyan. (C) Cell distributions corresponding to Figure 4A (top) and Figure 4B (bottom). Colors correspond to inducing conditions as follows: none, red; aTc, blue; IPTG, green; both, yellow.

III. Terminator Characterization

B

A

C

  7  

Terminator strength is measured using the reporter plasmid shown in Figure S8. It contains GFP and mRFP, separated by the terminator to be measured. We eliminated the terminator to produce a control plasmid (N287) to serve as a reference for the calculation of strength. A T7 terminator library was cloned into the reporter plasmid and cotransformed with plasmid N249. Cells were grown under 1mM IPTG induction of T7* RNAP and screened for efficient termination by measuring reduction in mRFP expression via flow cytometry. GFP expression was also measured, and terminators were eliminated that exhibited more than 25% change in GFP expression from the control plasmid. In the screen, a putative strong terminator (T.8) was identified, but this was not included in the final set because there was no detectable hairpin structure. A library of 7 mutant terminators was characterized (Figure S9). From these measurements, normalized fluorescence values are calculated by dividing the mutant terminator fluorescent readings by the control plasmid fluorescent readings, eg. Normalized RFP = Terminator RFP / Control RFP. The strength of the terminator can be calculated as follows,

𝑇𝑒𝑟𝑚𝑖𝑛𝑎𝑡𝑖𝑜𝑛  𝑆𝑡𝑟𝑒𝑛𝑔𝑡ℎ   = 𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑  𝐺𝐹𝑃  (𝐴𝑈)𝑁𝑜𝑟𝑚𝑎𝑙𝑖𝑧𝑒𝑑  𝑅𝐹𝑃  (𝐴𝑈)

Figure S8: Plasmid used to calculate terminator strength. The fluorescent reporters, GFP and mRFP (6), are expressed under control of the T7 promoter and RBSs BBa_B0034 and D103. SBOL graphical notation is used to describe genetic parts: the BioBrick prefix and suffix are open squares, and terminators are in the shape of a T. The vertical arrow indicates location of the T7 terminator. Mutant terminators are cloned in place of the T7 terminator for characterization.

Figure S9. Terminator characterization. Terminator plasmids were co-transformed with plasmid N249 and characterized under 1mM IPTG induction of T7* RNAP. Data reported as fold knockdown and are the results of three experiments performed on multiple days.

pSC101* CmR PT7 mRFP1

BBa_B0034 D103

GFP

Term

inat

ion

Stre

ngth 5

0

4

3

2

1

Terminator

6

7

T.1 T.2 T.3 WT T.4 T.5 T.6 T.7None

  8  

IV. Plasmid Construction and Maps Plasmids were designed in silico and constructed using standard DNA manipulation techniques. Assembly methods followed published protocols and included BioBrick (7), Megawhop (8), Phusion Site-Directed Mutagenesis or Gibson Assembly methods (9). Plasmids and parts located in the SynBERC Registry are referred to by their identification numbers, e.g. SBa_000XYZ. Core Vectors Plasmid pIncW (pSa, SpR) was generated from pEXT21 (pSa, SpR) by deletion of osa, nuc1, the Tn21 integrase gene, and ORF18 (10). Plasmid pSB4C5 (pSC101, CmR) was obtained from the Registry of Standard Biological parts and serves as the base vector T7 promoter plasmids (7). Plasmid pSB3K3 (p15a, KmR) was obtained from the Registry of Standard Biological parts and serves as the base vector for some pigment genes (7). Empty Vectors for Toxicity Characterization Plasmid N23 (pSC101, CmR) contains RBS BBa_B0034 and the nifA gene inserted between the BioBrick prefix and BioBrick suffix of pSB4C5. Plasmid N84 (pIncW, SpR) contains a constitutive promoter (SBa_000565), a strong RBS (SBa_000475), and mRFP (SBa_000484) between the BioBrick prefix and BioBrick suffix of pIncW. Standard Characterization Vectors Plasmid N110 (SBa_000564) was constructed by inserting a constitutive promoter (SBa_000565), a strong RBS (SBa_000475), and mRFP (SBa_000484) between the BioBrick prefix and BioBrick suffix of pSB4C5. Plasmid N292 (SBa_000566) was generated by inserting a terminator characterization cassette between the BioBrick prefix and BrioBrick suffix of pSB4C5. The cassette consists of the PT7 promoter, RBS (SBa_000498), GFP, the wild-type T7 terminator, RBS D103 (SBa_000563) from Salis et. al. (6), and mRFP (SBa_000484). Plasmid N149 (SBa_000516) was constructed by inserting the Ptac promoter cassette (SBa_000563), RBS D103 (SBa_000563) from Salis et. al. (6), and mRFP (SBa_000484) between the BioBrick prefix and BioBrick suffix of pSB4C5. Plasmid N521 (SBa_000567) was constructed by inserting a weak Ptet promoter cassette (SBa_000574), RBS D103 (SBa_000563), and mRFP (SBa_000484) between the BioBrick prefix and BioBrick suffix of pSB4C5. Plasmid N155 (SBa_000568) was constructed by replacing the Ptac promoter cassette in N149 with the consensus T7 promoter sequence. The initially transcribed region from the Ptac promoter was retained (ggtaccaattgtgagcggataacaatt). Plasmid N489 (SBa_000521) was constructed by deleting the initially transcribed region of the Ptac promoter from N155. T7* RNAP Variants Plasmid N77 (SBa_000569) was constructed by inserting the Ptac promoter cassette (SBa_000563) and the wild-type T7 RNAP gene into pIncW. Plasmid N115 (SBa_000570) was constructed by adding an N-terminal degradation tag (SBa_000509, TTGTTTATCAAGCCTGCGGATCTCCGCGAAATTGTGACTTTTCCGCTATTTAGCGATCTTGTTCAGTGTGGCTTTCCTTCACCGGCAGCAGATTACGTTGAACAGCGCATCGATCTGGGTGGC) to the T7 gene in N77.

  9  

Plasmid N219 (SBa_000571) was generated through single bp mutation (C1894A) in the T7 gene in N115. Plasmid N249 (SBa_000520) was generated from N219 by placing the T7 gene under control of a weak RBS (SBa_000507, TATCCAAACCAGTAGCTCAATTGGAGTCGTCTAT), an insulator (SBa_000508), and changing the start codon from ATG to GTG. Orthogonal RNAP Variants Plasmid N616 (SBa_000572) was constructed by placing the K1F* RNAP under control of a weak Ptet promoter cassette (SBa_000574), in plasmid pIncW. Plasmid N636 (SBa_000573) was generated by cloning the region between the BioBrick sites in plasmid N616 into the N249 BioBrick prefix. A DNA region containing bidirectional terminators was inserted between the N616 sourced DNA and the N249 DNA between the BioBrick sites. Pigment Vectors Plasmid N520 (SBa_000575) was derived from pAC-LYC by transferring the crtEBI operon to pSB3K3 (11). Plasmid N537 (SBa_000576) was constructed through combinatorial assembly of 5 gene expression cassettes comprising the genes dxs, idi, crtE, crtB and crtI (12). Each gene expression cassette was created in vitro by joining an insulator sequence, a library of T7 promoters, a synthetic RBS, the gene of interest and a T7 terminator. Plasmid N538 (SBa_000577) consists of the vioABCDE operon from pVIO4 under control of the wild-type T7 promoter in pSB4C5 (13). Plasmid N554 (SBa_000578) was derived from N538 by replacing the T7 promoter with a K1F* promoter. Plasmid N571 (SBa_000579) was derived from N554 by inserting a T7 terminator, insulator and K1F* promoter between vioA and vioB. Plasmid N588 (SBa_000580) was derived from N571 by deleting vioC and vioD. Plasmid N676 (SBa_000581) was derived by cloning the region between the BioBrick sites in N588 into pSB3K3.

  10  

Figure S10: Plasmid sequence maps. Abbreviations: CmR, chloramphenicol resistance gene; SpR, spectinomycin resistance gene; KmR, kanamycin resistance gene; pSa, p15a, and pSC101* are origins. SBOL graphical notation is used to describe genetic parts: the BioBrick prefix and suffix are open squares, MCS refers to a generalized multi-cloning site surrounded by the BioBrick prefix and suffix, RBSs are solid half-circles, and terminators are in the shape of a T.

  11  

V. Part Sequences Table S1. DNA sequences of synthetic parts Part Number Part Type Sequence SBa_000443 WT T7 Promoter taatacgactcactatagggaga SBa_000444 T7 Promoter 1 taatacgactcactacaggcaga SBa_000445 T7 Promoter 2 taatacgactcactagagagaga SBa_000446 T7 Promoter 3 taatacgactcactaatgggaga SBa_000582 T7 Promoter 4 taatacgactcactataggtaga SBa_000450 WT T7 Terminator tagcataaccccttggggcctctaaacgggtcttgaggggttttttgt SBa_000583 T7 Terminator 1 tacctcaaccccttccgccctcatatcgcggggcatgcggttttttgt SBa_000584 T7 Terminator 2 taccctaaccccttccccggtcaatcggggcggatggggttttttgt SBa_000585 T7 Terminator 3 tagaccaaccccttgcggcctcaatcgggggggatggggttttttgt SBa_000452 T7 Terminator 4 tactctaaccccatcggccgtcttaggggttttttgt SBa_000586 T7 Terminator 5 tagcagaaccgctaacgggggcgaaggggttttttgt SBa_000451 T7 Terminator 6 tacatatcgggggggtaggggttttttgt SBa_000587 T7 Terminator 7 tactcgaacccctagcccgctcttatcgggcggctaggggttttttgt SBa_000588 T7 Terminator 8 tataaaacggggggctaggggttttttgt SBa_000589 K1F rbs aattgtgagcggataacaa SBa_000592 dxs rbs aagacgaaggaggccgcta SBa_000594 idi rbs ggttacaaggggaaaacga SBa_000596 crtE rbs gaataatccattaaaaggagggtataa SBa_000598 crtB rbs cacccgagtaaagagggagtaaactt SBa_000600 crtI rbs acccaatttattagaggagaaaactac SBa_000606 vioA rbs attaaagaggagaaattaagc SBa_000593 idi insulator gtctgtagcacgtgcatc SBa_000595 crtE insulator acacaatcttcctgctca SBa_000597 crtB insulator tccacgaacacagggttg SBa_000599 crtI insulator ccagtaacgttcatcagc SBa_000601 dxs insulator ggtcattacaacggttat SBa_000607 vioB insulator ccccagtcgagtcgtctata SBa_000608 vioE insulator ccactgtgtactcgttataacatctggcagtttagcgcatcgtccgcgctggaaggcgaccgcttcgtcggcttggtgctggatcaagacaat

cagttcgaccagaccgaagcgcgcctggcgtcttggcttgaagagatcaaacgcaccgttctgtaataa SBa_000590 terminator gcgccgcagccggatctctccacggtacaggcatggtatctgcgccaccagacgcagtttatgcgcccggaacagcgtctgacccgccat

ttactgctgacggtcgataacgaccgcgaagccgtgcaccagcggatcctcggcctgtatcggcaaatcaacgcctcgcgggacgctttcgcgccgctggcccagcgccattcccactgcccgagcgcgctggaagagggtcgtttaggctggattagccgtggcctgctctatccgcagctcgagaccgcgctgttttcactggcggaaaacgcgctaagccttcccatcgccagcgaactgggctggcatcttttatggtgcgaagcgattcgccccgccgcgcccatggagccgcagcaggcgctggagagcgcgcgcgattatctttggcagcagagccagcagcgccatcagcgcc

SBa_000591 terminator agtggctggaacagatgatttcccgtcagccgggactgtgcgggtagcctcggcggctacccgttaacgcctacagcacggtgcgtttaatctcctcaagccagctcgccagacgcgcttcggtctggtcgaactggttatcctgatccagcaccagcccaacaaagcggtcgccttccagcgccgaggacgcgctgaattcataaccctcatttggccagctgccaatcatctgcgcgccgcgcgcgctcagggcgtcgaacagcgggcgcatcccgctgacgaagttgtccggatagcctctctgatcgccgaggccgaacagcgccacggttttccctttcaggctggcgtcgtcgaggccgctgataaattcgctccatgactcgctttcgcatccggcctccagccccggcagctggccgtcgccgagcgtcggcgtgcccagcagcagcaccggataggccataaagtcgtccagcgtcgtgcggttaatgttgaccggggcatc

SBa_000508 Insulator tgcagttttattctctcgccagcactgtaataggcactaa SBa_000561 Ptac Promoter and

lacI cassette caattcgcgctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttgacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcaccattcgatggtgtcaacgtaaatgcatgccgcttcgccttcgcgcgcgaattggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggcggagcttatcgactgcacggtgcaccaatgcttctggcgtcaggcagccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgagctgttgacaattaatcatcggctcgtataatgtgtggaatt

  12  

gtgagcggataacaatt SBa_000574 Ptet Promoter and

tetR cassette ttaggacccactttcacatttaagttgtttttctaatccgcatatgatcaattcaaggccgaataagaaggctggctctgcaccttggtgatcaaataattcgatagcttgtcgtaataatggcggcatactatcagtagtaggtgtttccctttcttctttagcgacttgatgctcttgatcttccaatacgcaacctaaagtaaaatgccccacagcgctgagtgcatataatgcattctctagtgaaaaaccttgttggcataaaaaggctaattgattttcgagagtttcatactgtttttctgtaggccgtgtacctaaatgtacttttgctccatcgcgatgacttagtaaagcacatctaaaacttttagcgttattacgtaaaaaatcttgccagctttccccttctaaagggcaaaagtgagtatggtgcctatctaacatctcaatggctaaggcgtcgagcaaagcccgcttattttttacatgccaatacaatgtaggctgctctacacctagcttctgggcgagtttacgggttgttaaaccttcgattccgacctcattaagcagctctaatgcgctgttaatcactttacttttatctaatctggacatcgaggcctttcctgtgtgagctagcactgtacctaggactgagctagccgtcaattttttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac

SBa_000484 mRFP Fluorescent Reporter

atgtccagattagataaaagtaaagttgcgagctctgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaa

SBa_000514 T7* RNAP gtgttgtttatcaagcctgcggatctccgcgaaattgtgacttttccgctatttagcgatcttgttcagtgtggctttccttcaccggcagcagattacgttgaacagcgcatcgatctgggtggcaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctggctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccgcaagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactccctaagatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgcaagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgttcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcacttcaagaaaaacgttgaggaacaactcaacaagcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctgacatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgcaggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctattgggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcctgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaatcaccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcgacatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgccgtatcagccttgagttcatgcttgagcaagccaataagtttgctaaccataaggccatctggttcccttacaacatggactggcgcggtcgtgtttacgctgtgtcaatgttcaacccgcaaggtaacgatatgaccaaaggactgcttacgctggcgaaaggtaaaccaatcggtaaggaaggttactactggctgaaaatccacggtgcaaactgtgcgggtgtcgacaaggttccgttccctgagcgcatcaagttcattgaggaaaaccacgagaacatcatggcttgcgctaagtctccactggagaacacttggtgggctgagcaagattctccgttctgcttccttgcgttctgctttgagtacgctggggtacagcaccacggcctgagctataactgctcccttccgctggcgtttgacgggtcttgctctggcatccagcacttctccgcgatgctccgagatgaggtaggtggtcgcgcggttaacttgcttcctagtgaaaccgttcaggacatctacgggattgttgctaagaaagtcaacgagattctacaagcagacgcaatcaatgggaccgataacgaagtagttaccgtgaccgatgagaacactggtgaaatctctgagaaagtcaagctgggcactaaggcactggctggtcaatggctggcttacggtgttactcgcagtgtgactaagagttcagtcatgacgctggcttacgggtccaaagagttcggcttccgtcaacaagtgctggaagataccattcagccagctattgattccggcaagggtctgatgttcactcagccgaatcaggctgctggatacatggctaagctgatttgggaatctgtgagcgtgacggtggtagctgcggttgaagcaatgaactggcttaagtctgctgctaagctgctggctgctgaggtcaaagataagaagactggagagattcttcgcaagcgttgcgctgtgcattgggtaactcctgatggtttccctgtgtggcaggaatacaagaagcctattcagacgcgcttgaacctgatgttcctcggtcagttccgcttacagcctaccattaacaccaacaaagatagcgagattgatgcacacaaacaggagtctggtatcgctcctaactttgtacacagccaagacggtagccaccttcgtaagactgtagtgtgggcacacgagaagtacggaatcgaatcttttgcactgattcacgactccttcggtacgattccggctgacgctgcgaacctgttcaaagcagtgcgcgaaactatggttgacacatatgagtcttgtgatgtactggctgatttctacgaccagttcgctgaccagttgcacgagtctcaattggacaaaatgccagcacttccggctaaaggtaacttgaacctccgtgacatcttagagtcggacttcgcgttcgcgtaa

  13  

VI. References 1. Goujon, M., McWilliam, H., Li, W., Valentin, F., Squizzato, S., Paern, J. and Lopez, R. (2010) A

new bioinformatics analysis tools framework at EMBL-EBI. Nucleic Acids Res, 38, W695-699. 2. Lavigne, R., Sun, W.D. and Volckaert, G. (2004) PHIRE, a deterministic approach to reveal

regulatory elements in bacteriophage genomes. Bioinformatics, 20, 629-635. 3. Crooks, G.E., Hon, G., Chandonia, J.M. and Brenner, S.E. (2004) WebLogo: a sequence logo

generator. Genome Res, 14, 1188-1190. 4. Kelly, J.R., Rubin, A.J., Davis, J.H., Ajo-Franklin, C.M., Cumbers, J., Czar, M.J., de Mora, K.,

Glieberman, A.L., Monie, D.D. and Endy, D. (2009) Measuring the activity of BioBrick promoters using an in vivo reference standard. J Biol Eng, 3, 4.

5. Temme, K., Zhao, D. and Voigt, C.A. (2012) Refactoring the nitrogen fixation gene cluster from Klebsiella oxytoca. Proc Natl Acad Sci U S A, 109, 7085-7090.

6. Salis, H.M., Mirsky, E.A. and Voigt, C.A. (2009) Automated design of synthetic ribosome binding sites to control protein expression. Nat Biotechnol, 27, 946-950.

7. Shetty, R.P., Endy, D. and Knight, T.F., Jr. (2008) Engineering BioBrick vectors from BioBrick parts. J Biol Eng, 2, 5.

8. Miyazaki, K. (2003) Creating random mutagenesis libraries by megaprimer PCR of whole plasmid (MEGAWHOP). Methods Mol Biol, 231, 23-28.

9. Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.A., 3rd and Smith, H.O. (2009) Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods, 6, 343-345.

10. Dykxhoorn, D.M., St Pierre, R. and Linn, T. (1996) A set of compatible tac promoter expression vectors. Gene, 177, 133-136.

11. Cunningham, F.X., Jr., Sun, Z., Chamovitz, D., Hirschberg, J. and Gantt, E. (1994) Molecular structure and enzymatic function of lycopene cyclase from the cyanobacterium Synechococcus sp strain PCC7942. Plant Cell, 6, 1107-1121.

12. Ramon, A. and Smith, H.O. (2011) Single-step linker-based combinatorial assembly of promoter and gene cassettes for pathway engineering. Biotechnol Lett, 33, 549-555.

13. August, P.R., Grossman, T.H., Minor, C., Draper, M.P., MacNeil, I.A., Pemberton, J.M., Call, K.M., Holt, D. and Osburne, M.S. (2000) Sequence analysis and functional characterization of the violacein biosynthetic pathway from Chromobacterium violaceum. J Mol Microbiol Biotechnol, 2, 513-519.