Mobile Element 297 Abd-B of Drosophila melanogaster, Delta 88, … · 2002. 7. 5. · 680 J.A. Mack, R. D. Smith and D. T. Kuhn unique 5' exons and give rise to two distinct ABD-B

Copyright 0 1997 by the Genetics Society of America

Mobile Element 297 in the Abd-B gene of Drosophila melanogaster, Not Delta 88, Is Responsible for the tuh-3 Mutation

Judith A. Mack, Ronald D. Smith and David T. Kuhn

Department of Biology, University of Central Florida, Orlando, Florida 32816 Manuscript received February 17, 1997 Accepted for publication June 25, 1997

ABSTRACT The tumorous-head-3 (tuh-3) mutation has been associated with the insertion of mobile element Delta

88at +200 on the bithorax complex (BX-C) DNA map, 5' of all Abdominal-B (Abd-B) transcripts. Different phenotypes of tuh-3 are regulated by the tumorous-head-l (tuh-1) maternal effect locus. In the presence of the recessive tuh-lh maternal effect, tuh-3 offspring produce homeotic abdominal and genital tissue in the head. In the presence of the dominant tuh-lg maternal effect, tuh-3 offspring have normal heads but now show genital defects. One other mutant, Z127B, produces flies with identical defects to that of tuh-3 in the presence of both maternal effects. Molecular analysis of Z127B revealed the insertion of mobile element 297 in the Abd-B gene, -25 kb downstream of the Delta 88 insertion in tuh-3. No other abnormalities were detected. Reexamination of our tuh-3 strain revealed a 297 insertion in an identical region to that of I127B, in addition to the Delta 88 insertion. Recombinants of tuh-3, carrying 297 only, produced homeotic head defects and genital defects in the presence of the tuh-lh and tuh-lR maternal effects, respectively. Recombinants of tuh-3, carrying Delta 88 only, failed to produce any defects in the presence of either maternal effect. Based upon these results, we propose that it is the 297 insertion in the Abd-B gene, not Delta 88, that is responsible for the tuh-3 mutation.

H OMEOTIC proteins are characterized by a 60- amino acid DNA binding sequence termed the homeodomain (MCGINNIS et al. 1984; SCOTT and WEINER 1984) and function as transcription factors (JAYNES and O'FARRELL 1988; THALI et al. 1988; DRIEVER and N~SSLEIN-VOLHARD 1989; HAN et al. 1989; KRASNOW et al. 1989; WINSLOW et al. 1989) that ultimately act to determine the identity of a cell. The bithorax complex (BX-C) in Drosophila melanogaster contains three lethal complementation groups ( SANCHEZ-HERRERO et al. 1985; TIONG et al. 1985), Ultrabithorax ( ubx) , abdominal- A (abd-A) and Abdominal-B (Abd-B). The genes of the BX-C encode homeotic proteins. Ubx specifies segment identify from the posterior compartment of the second thoracic segment to the anterior compartment of the first abdominal segment (pT2-aAl; PS5-6), abd-A from the posterior compartment of the first abdominal segment to the anterior compartment of the fourth abdominal segment (pAl-aA4; PS7-9), while Abd-B specifies segment identity from the posterior compartment of the fourth abdominal segment to the anterior compartment of the tenth abdominal segment, including genitalia (pA4aAlO; PS7-15) (reviewed in DUNCAN 1987; KUHN et al. 1995). Female genitalia are thought to arise from A8 and male genitalia from A9 (NOTHIGER et al. 1977).

BX-C genes function in repeated units termed para-

Correspondingauthor:Judith A. Mack, Department of Developmental Biology, Beckman Center, Room B300, Stanford University School of Medicine, Stanford, CA 94305. E-mail: [email protected]

Genetics 147: 679-688 (Octoher, 1997)

segments (PS) ; a single unit is comprised of the posterior compartment of one segment and the anterior compartment of the next or adjacent segment (MARTI- NEZ-ARIAS and LAWRENCE 1985). Mutations in homeotic genes in Drosophila transform one part of the body into the likeness of another. For example, a complete lack of Abd-B function transforms PS10-14 into a likeness of PS9 (LEWIS 1978; SANCHEZ-HERRERO et al. 1985; TIONG et al. 1985; CASANOVA et al. 1986) and is thought to be due to the derepression of abd-A in PS10-14. The entire complex, which covers over 300 kb, has been cloned (BENDER et al. 1983; KARCH et al. 1985) and sequenced (MARTIN et al. 1995). The protein coding units comprise only a small portion of the complex, the rest consisting of large and complex regulatory regions (PEIFER et al. 1987; LEWIS et al. 1995).

The Abd-B gene contains two distinct genetic elements: a morphogenetic element ( m ) required in PS10- 13 (pA4aA8) and a regulatory element ( r ) required in PS1415 (PAS-aAl0) (CASANOVA et al. 1986). In addition to determining segment identity in PS14 and 15, ralso appears to repress the expression of m in this region. Mutations within the Abd-B gene can be classified based on which function(s) has been disrupted. Class I mutants affect m function (m-r+), class II mutants affect r function (m'r-), and class I11 mutants affect both m and r function (m-r-). Three overlapping RNAs (class A, B, and C) transcribed from different promoters encode Abd-B function (ZAVORTINK and SAKONJU 1989; BOULET et al. 1991). All three contain common 3' exons, of which the homeobox is included, but have

680 J. A. Mack, R. D. Smith and D. T. Kuhn

unique 5' exons and give rise to two distinct ABD-B homeoproteins (DELORENZI et al. 1988; CELNIKER et al. 1989; DELORENZI and BIENZ 1990). The class A transcript, expressed at low levels in PS10-12 and high levels in PS13 during mid-embryonic development (DELo- RENZI and BIENZ 1990; BOULET et al. 1991), encodes the ABD-BI protein (also referred to as Abd-B m). The class B and C transcripts, confined to PS14 and 15 (BOULET et al. 1991; KUHN et al. 1995), encode the ABD-BII protein (also referred to as Abd-B r). The first three exons of the of class B and class C transcripts are untranslated resulting in a truncated version of ABD-BI that lacks an amino-terminal domain present in the ABD-BI protein (CELNIKER et al. 1989; ZAVORTINK and SAKONJU 1989; DELORENZI and BIENZ 1990).

The infra-abdominal 9 tumorous-head-3 ( i ~ b y " ~ ; hence- forth referred to as tuh-3) mutation has been previously associated with the insertion of a 7-kb mobile element termed Delta 88 at + 200 on the BX-C DNA map ( KARcH et al. 1985), placing it 5' of all of the known Abd-B transcripts. Dramatically different phenotypes are observed for tuh-3 mutants depending upon the presence of one or the other of two alleles of the maternal effect gene, tumorous-head-1 ( tuh - l ) , located at the base of the X chromosome (GARDNER and WOOLF 1949). In the presence of the recessive tuh-1" maternal effect ( h = head defects), tuh-3 behaves as a semi-dominant mutant producing homeotic head defects consisting of sexually dimorphic posterior abdominal and genital tissue in derivatives of the eye/antennal disc (GARDNER and WOOLF 1949; WOOLF and PASSAGE 1980; KUHN and PACKERT 1988). These specific tissues are normally spec- ified by Abd-B, and we have previously identified the presence of ectopic ABD-B protein in eye/antennal discs of third instar tuh-lh; tuh-3 larvae (KUHN et al. 1993). When tuh-1" is replaced by its dominant naturally occurring allele tuh-1" (g = genital defects), tuh-3 acts as a recessive in which case the head defects are not manifested, but male flies now show genital disc defects in the form of sac (bean-shaped) testes in which the testes fail to coil (WOOLF 1966, 1968). In the most ex- treme cases, flies of both sexes lack internal and external genitalia (KUHN et al. 1981; KUHN and PACKERT

We believe that tuh-1R produces a maternal effect product and that tuh-lh is a hypomorph or null of tuh- 1. This is partially based on the observation that flies deficient for the tuh-1 locus produce offspring with homeotic head defects and normal genitalia, just as that seen in tuh-lh; tuh-3 offspring. Both maternal effects require the tuh-3 mutation to produce the mutant phenotypes; in the absence of the tuh-3 mutation, flies carrying either maternal effect are essentially wild type. One other mutant, i ~ b ~ ' ~ ~ ' ' (referred to as Z127B from this point on), responds to the two maternal effect alleles in a similar manner to that of tuh-3 in both the

1988).

nature and expressivity of the head and genital defects (BOWNES et al. 1981; KUHN and PACKERT 1988).

Although the location of the Delta 88 insert at +200 is consistent with disruptions in Abd-B function, there is no direct proof that this lesion is responsible for the tuh-3 mutation. tuh-3 is classified as an m+r- mutant ( ~ ~ S A N O V A et al. 1986). When tuh-3 was tested in trans with Abd-B m+r- mutants (also referred to as iab9 mutants) iabP5, iabPb1, I127B, iab9Tab, and iabY2"' in the presence of the tuh-lh maternal effect, an enhancement of head defects was observed in iabp5, iab9""b1 and I127B, while i ~ b 9 ~ " ~ and iabYz3-' failed to enhance expression of head defects (KUHN et al. 1993). Of note is that lesions in i ~ b 9 ~ " ~ (KARCH et al. 1985) and iabYZ3" (J. A. MACK and D. T. KUHN, unpublished data) map closer to the Delta 88 insertion in tuh-3, while iab9h5,

(KARCH et al. 1985) and Z127B (this publication) map further upstream (see Figure 2A). Based on the assumption that the enhancement of head defects was due to the fact that these mutants disrupt a similar r function, we reexamined our tuh-3 strain to see if we could detect another lesion in the A6d-B gene that may be interfering with r function.

In this study, we offer compelling evidence that it is not Delta 88 that is responsible for the tuh-3 mutation, but an additional insertion in the A6d-B gene, downstream of Delta 88, which we have identified as retrotransposon 297. The Delta 88 insert at +ZOO was thought to be the distal-most lesion identified for the BX-C. Our findings indicate that Delta 88 is probably not influencing Abd-B function and will therefore help to redefine the limits of the BX-C. Finally, we offer explanations as to how 297 might be acting to produce the different phenotypes in the presence of the tuh-I maternal effect alleles.

iab9!"/lI

MATERIALS AND METHODS

Drosophila stock maintenance: All Drosophila strains were raised at room temperature at -23" on a standard medium of cornmeal, agar, brewer's yeast, sucrose and dextrose. A mix of phosphoric and proprionic acid were added before pouring to retard mold growth. The surface of the medium was lightly dusted with Tegosept-M just before use to further inhibit mold growth.

Drosophila stocks: Drosophila stocks were as follows: (1 ) C ( I ) R M , v tuh-I"/Y; sbd2 tuh-3. This stock carries an attached X chromosome with tuh-lh. (2) C ( I ) R M , v tuh-lh/Y; I127B. (3) C(I)RM, v tuh-lh/Y; TM6C/TM6C. TM6C is a third chromosome balancer. (4) tuh-lh; sbd2 tuh-?. This stock carries a free X chromosome with tuh-lh. ( 5 ) ry5nfi/ry5nfi, an X-ray in- duced null mutation. (6) 9- Fub v'ZucZ(P[~y+]). This Dro- sophila strain is homozygous viable and contains a P element with a wild-type 9' gene at +208 on the BX-C DNA map (W. BENDER, personal communication). Fab is a dominant mutation that maps to +124 on the BX-C DNA map and results in the transformation of the sixth abdominal segment to the seventh abdomina1 segment (GYURKOVICS et ul. 1990). (7) Abd-p16/Sb, Dp(?;3)P5. Abd-B"16 (referred to from this point as D l @ is a probable point mutation that is m-r- (KARCH et al. 1985; KUHN et aZ. 1993). Sb, Dp(?;?)P5 (short-

297 Causes tuh-3 Mutation 68 1

ened to DpP5) is a duplication for the entire BX-C (DUNCAN and LEWIS, 1982). (8) Canton-S (CS). This stock was utilized as a wild-type control. Canton-S carries the tuh-lg allele (KUHN and PACKERT 1988) [see LINDSLEY and ZIMM (1992) for chrc- mosome and mutant descriptions].

Whole genome Southern analysis and construction and screening of tub? and 1127B genomic libraries: Southern blotting was carried out according to standard procedures and DNA was probed with Abd-B genomic clones provided by WELCOME BENDER. Genomic libraries were prepared according to SAMBROOK et al. (1989). Genomic DNA was partially digested with Sau3AI, size fractionated, and fractions containing DNA fragments 9-23 kb in length were ligated into BamHI/HindIIIdigested purified arms of the Lambda Dash I1 vector (Stratagene). The phage were packaged using Gigapack I1 Packaging Extract (Stratagene).

A 4.2-kb Hind111 fragment from clone 8094 of the Abd-B gene (+ 175.5 to +179.7 on the DNA map) (KARCH et al. 1985) was used to screen both the tuh-3 and 1127B libraries using a modified method from that of BENTON and DAVIS (1977). Positive clones were restriction enzyme digested with EcoRI, HzndIII, Sa& and BamHI, blotted, and hybridized with Abd-B clone 8094 for verification and analysis.

DNA sequencing and analysis: A 3-kb Hind111 fragment from 1127B and tuh-3 genomic clones containing both fly and 5' 297 DNA was isolated and subcloned into Bluescript phagemids (Stratagene) for partial sequencing. Two 3' prim- ers for sequencing were designed utilizing 297 sequence data from INOUYE et al. (1986). The first primer 5' GCCTCGCTC TTGGGTTC 3' corresponds to nucleotides 198-214 of the 297 5' LTR, the second primer 5' GATGTTTCGAGCACA GGAC 3' corresponds to nucleotides 487-505 encompassing sequence lying between the primer binding site and ORF 1. The sequencing reaction was carried out using the PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit (Perkin Elmer). The program B M T N was used to compare the DNA sequences to the current databases (GenBank and EMBL) .

Establishment and whole genome Southern analysis of recombinant strains from the Abd-B region of tub3 To select for recombinants in the Abd-B region of tuh-3, a Drosophila strain kindly provided by WELCOME BENDER was utilized. This strain is y- and carries the dominant Fab mutation at +124, which lies at the border of the iab-6/iab-7 regulatory regions of the Abd-B gene. In Fab mutant females, the sixth abdominal segment is transformed into a likeness of the seventh abdominal segment, while Fab mutant males display partial to almost complete loss of the sixth abdominal segment (GYURKOVICS et al. 1990). In addition, this strain carries a y+ P element P[y+] at +208 (W. BENDER, personal communication). Be- fore use, the Fab strain was probed with Abd-B clones in the region of interest and was shown to have awild-type restriction pattern (data not shown).

The recombination scheme is outlined in Figure 1. v tuh- lh; y- sbd2 tuh-3 females were crossed to y- Fab y+ males. FI females were mated with y- males, and recombinants between Fab and the y+ insert were balanced over TM6C and established as homozygous stocks. Genomic DNA from homozygous recombinant strains was probed with Abd-Bclones 8094 and 8107 to detect the presence and/or absence of 297 and Delta 88, respectively (data not shown; see the partial Abd-B DNA map in Figure 2 for mutation and insertion sites and Abd-B clone limits).

Assessment of head defects: Head defects were scored among offspring homozygous for both the tuh-lh maternal effect and the various 3R recombinant strains following the procedure of KUHN and PACKERT (1988). The nature of the homeotic tissue present in head defects was determined by

9 v tuh-lh/Y; ry- sbb tuh-3/ry- sbb tuh-3 X &ry- Fab ry+ 1

recornbinanVTM6C X recornbinanVTM6C

I

FIGURE 1.-Outline of crosses used to generate recombinants between Fab and P [ 9'1. See MATERIALS AND METHODS for mutant descriptions and explanation of crosses.

evaluating bristle type, trichome density and pigmentation of tissue.

Assessment of genital defects Male genital disc defects were determined by the method developed by WOOLF (1966). Males were examined for sac testes and/or the lack of external genitalia. Genital defects in females were identified by exam- ining external genitalia for structural abnormalities using a stereoscopic microscope at 60X magnification.

RESULTS

Z127B and tuh3 have similar lesions not associated with Delta 88: Although it had been known for over 10 years that Z127B behaved like an allele of tuh-3, it had yet to be characterized at the molecular level. We carried out Southern analysis, using Abd-B genomic clones as probes, to screen for a mutation in the Abd-B gene of 1127B. Hybridization with all but one of the Abd-B clones to 1127B genomic DNA produced a wild-type banding pattern, including clone 8107, (see Figure 2A for Abd-B clone limits and restriction enzyme sites) which spans the +200 region on the DNA map (+ 193 to +208) (Figure 3B) and uncovers the Delta 88 insertion in tuh-3. Hybridization with clone 8094 (+ 168 to +187) produced an aberrant banding pattern in all restriction enzyme-digested lanes (Figure 3A). Based on the wild-type restriction map for this region, the total number of kb represented in each lane was greater than expected, suggesting that the abnormal banding pattern may be due to an insertion. Analysis of the restriction fragments identified by Abd-B clone 8094 put the breakpoint at - +173 on the DNA map, placing it in the middle of the first intron of the class B and class C transcripts, and greater than 25 kb away from the Delta 88 insertion in tuh-3.

J. A. Mack, R. D. Smith and D. T. Kuhn 682

A

iabgTab

Fab

20 +160 +170 +la0 + I 90 +200 +210 t (45000) ( 3 5 0 0 0 ) (25000) (15000) (5000)

class A

class B

class C

B

Homeobox - - H HRRRR HR Abd-B clone 8094

Transcription

29 7

, , p , , , ,-, -Tg a Transcription

R H R R H

Abd-B +165 +I66 +I68 +170 +172 +I74 +176 +I78 +I80

Transcription

H H RR RH RRR - Abd-B clone 81 07

FIGURE 2.-(A) Partial map of the BX-C Abd-B gene is shown with homeotic mutants cited or used in this study (adapted from KARCH et al. 1985). The location of i ~ b 9 ” ~ ~ ” is inferred from abnormal banding patterns seen after hybridization with Abd-Bclone 8100 that covers from - +184 to +198 on the DNA map. The tri- angles represent inser- tions. The bold numbers in parentheses represent the approximate number of bases with zero corresponding to - +204 on the DNA map (adapted from MARTIN et al. 1995). Directly below the map are Abd-B clones used for Southern analysis (KARCH et al. 1985). 8107 uncovers the Delta 88 insertion and 8094 the 297 insertion. R, EcoRI; H, HzdIII. Below the Abd-B clones are the A b d - B t r a n s c r i p t s (adapted from BOULET et al. 1991). (B) Enzyme restriction map of 297 (adapted from LINDSLEX and ZIMM 1992); note that 297 has inserted in the same transcriptional orientation as Abd-B. R, EcoRI; H, HindIII.

We applied the same strategy to look for an additional lesion in our tuh-3 strain. Hybridization of Abd-B clone 81 07 to tuh-3 genomic DNA produced a banding pattern typical of the Delta 88 insertion at +200 (Figure 3B). In addition, an abnormal banding pattern was also detected after hybridization with Abd-B clone 8094 that had not been detected in the original screen for the tuh-3 mutation (Figure 3A). Moreover, we found the pattern to be identical to that of Z127B, suggesting that our tuh-3 strain possessed a similar lesion in the same location. No other abnormalities were detected after hybridization with other overlapping clones for the Abd-B region.

Partial cloning and identification of the Z127B and tuh3 insertion at +173: A 4.2-kb Hind111 fragment (+ 175.5 to +179.7) from Abd-B clone 8094, which lies just adjacent to and upstream of the suspected insertion site, was used to screen Z127B and tuh-3 genomic libraries. We succeeded in partially cloning the insert from both strains and selected two clones for further analysis, designated Z127B(3A) and tuh-3( 12B). Both clones contained a 3-kb Hind111 fragment that produced a less intense signal when hybridized with Abd-B clone 8094 relative to the other fragments, suggesting that this frag-

ment contained part of the insert, as well as Abd-B DNA. In addition, Il27B(3A) contained additional fragments that did not produce a signal (data not shown) when hybridized with Abd-B clone 8094. Clone I127B(3A) was used to probe Canton-S genomic DNA. Multiple bands were detected including two very intense EcoRI bands of 2.5 and 0.4 kb in size and an intense 2.5-kb Hind111 band. These were thought to represent internal restriction fragments of what appeared to be a moderately repetitive element (data not shown). Comparison of restriction enzyme banding patterns with previously characterized transposable elements suggested the insertion at + 173 in Z127B and tuh-3 was likely to be 297, a moderately repetitive copia-like retrotransposon (POTTER et al. 1979; IKENAGA and %Go 1982; INOWE et al. 1986). To test for this possibility, clones Z127B(3A) and tuh-3( 12B) were hybridized with 297 cDNA (kindly provided by VICTOR CORCES) . Restriction fragments that did not produce a signal when hybridized with 8094 (or resulted in a weaker signal; 3kb Hind111 fragment) produced very intense signals after hybridization with 297 cDNA (data not shown), indicating the insert was likely to be 297.

B 8094 81 07

2 2 w CS 11278 t ~ h - 3 cs 1127B tuh-3

FIGURE 3.-Southern hybridization to whole genomic CS, 1127B and tu//-3 DNA using /\/)(/-I3 clones 8107 and 8094 as probes (see Figure 2A for clone limits and restriction enzyme sites). X, EcoRI; H, IfinclIII. (A) Hybridization of Rdigcsted CS genomic DNA with 8094 produces bands of -13.2 and 4.5 kb. In the 112%‘ and tuh-3 R lanes, the 13.2- and 4.5-kb hands are gone and bands of -10, 8, and 5.5 kb are seen. Hybridization of H-digested CS genomic DNA produces bands of “12, 6, and 4 kb (the lighter bands are not part of the wild-type restriction pattern and presumably are the result of partial digestion). In the 112iB and lzth-3 H lanes, the 12-kb hand is replaced by a slightly higher one; an additional 3-kb band is also apparent. (B) Hybridization of 1127B genomic DNA with clone 81Oi produces a wild-type banding pattern (compare with the 15.5‘ lanes); hybridization of tub-3 genomic DNA with clone 810 i shows an abnormal banding pattern in the R and H lanes indicative of the Dpltrr 88 insertion at +200.

The Skb Hind111 fragment that was detected by both Ahd-13 clone 8094 and 297 was subcloned and partially sequenced. Sequence and data base analysis showed both to contain a full length 5‘ 2971ong terminal repeat (LTR) (Figure 4) and further revealed the 297insertion site in the AM13 gene to be identical in both I12713 and tub-3. Based on BX-C sequence from MARTIN P/ 01. (199.5), 297inserted into a TATATA sequence, specifi- cally between the last T and A corresponding to nucleotides 33,705 and 33,706, respectively. These results are in agreement with the placement of 297 at +173 on the DNA map (Figure 2A). Restriction enzyme pattern and sequence analyses also showed that 297 had inserted in the same transcriptional orientation as the Abd-R transcripts in both I327B and tuh-3 (Figure 2B).

The aberrent restriction enzyme patterns seen in I12713and tuh-3 are consistent with a 297insertion (Fig- ures 2B and SA). The only exception is the presence of the 5.5-kb EmRI fragment in the I12713 and tuh-3 lanes after hybridization with Abd-13 clone 8094 (Figure 3A; in the CS EcoRIRI-digested lane a 4.5-kb band is seen), which should not be disrupted by the 297 insertion. Adjacent (and immediately downstream) to the 4.5-kb EcoRI fragment are a series of four EcoRI restriction sites that yield fragments of -1 kb each (Figure 2A). A likely explanation is that both 1127B and tuh-3 lack an EcoRI site and therefore share the same polymorphism.

Recovery and molecular analysis of recombinant strains in the Abd-B region of tuh-3: The presence of a

297 insertion in both the tuh-3 and I12713 strains along with the lack of a Ddto 88 in the I12713 strain suggested that the 297 insertion is responsible for the phenotypic anomalies seen in the presence of the tuh-I maternal effect alleles in both strains. To test for this possibility i t was necessary to separate 297 from Ddto 88 in our hh-3strain and examine various recombinants for their interactions with the twh-1 maternal effects. The recombination scheme is outlined in 34ATERIAL.S AND METH- ODS. After introducing the 91 mutation into our tuh-3 strain, flies were crossed to a strain carrying a dominant Fob mutation at +124 and a P[T’] at +208. Recombi- nants between F’h and 91+ were identified phenotypically as being either Fob 9- or v+. Homozygous recombinant strains were tested by Southern analysis for the presence and/or absence of 297 and Ddtn 88. They fell into five recombinant categories (Figure 5).

Response of recombinants to the tuh-Zh maternal effect: The penetrance of head defects in males and females in selected recombinants is presented in Table 1. Recombinant females carried the C(I)Rh4, v tuh-I”/ Y compound X chromosome and thus passed on the luh-I” maternal effect. Fah, 297, Drltn 88 males presented with a head defect penetrance of 39.9% (Fl) and 65.9% (F7), while females from the same strains showed a penetrance of 71.5% (Fl) and 97.7% (F7). Strains carrying 297only (297, 9+) also produced head defects. In males, penetrance ranged from a low of 29.0% (R23) to a high 58.6% (R22) and in females


Abd-6 sequence 5’ LTR b

‘ ~ ~ ~ T A ~ A G A G T ~ G T ~ ~ ~ ~ T ~ ~ T ~ T A T A T ’ A G T G A C G T A T ( T ) ~ ~ G G G T G G C T ) C C A G

CCACTECATTACTCAAAGAAATCAGTAATGCACTCTAGTAATTTTCCATAACGTATCC

CAGCTGCGCAGCATTCGTITATC~GGCAGCGCAGCCGTTCT(TJGTAAACATCCl1 :TA

AAGCCTGACCTAAGCAGAmGCCTGCCCTCmCCAACGCTACGCTACCTAATC~AAGAAC

CCAAGAGCGAGGCTCTCCCGAAATACAAATA~GT(T)CAAAT(A)CTGAGGC~CTCCT

CAATCCAACTTGCATTTGAl”rAGTCTTAAGCTGAGA(TJCCAAAGWGTCGTG

AAACTATITCTCCTAAAAACTAmATTTClTGGCGTTGTCCTTAGTCAACTGACGG

GACATTAGlTCGACTCATAAATAAAACAACAAmrAC I JGGCGCAGJCGGJAGGA( J )

5’ LTR

FIGURE 4.-Partial DNA sequence from clones 1127B(3A) and tuh-3( 12B). Abd-B sequence corresponds to nucleotides 33678-33705 (DMU31961; GenBank; MARTIN et al. 1995). Nucleotides in parentheses represent 1127B(3A) sequence that could not be determined; the bold C corresponds to a T in 1127B(3A); the outlined C is not present in 1127B(3A). The double-underlined sequence corresponds to the Hogness box, the single-underlined sequence to the polyadenylation signal, and the italicized sequence to the primer binding site (INOUYE et al. 1986).

from a low of 67.6% (R22) to a high of 76.8% (R21). These values were somewhat lower than those seen in strains carrying both 297and Delta 88. Significantly however, recombinant strains that carried Delta 88only (Fab, Delta 88) failed to produce head defects. One male from a recombinant strain carrying neither 297 nor Delta 88 ( TY+; R27) presented with a head defect. The nature of head defects was evaluated in strains carrylng both 297 and Delta 88 or 297 alone. As with that seen in the nonrecombinant tuh-? strain, microscopic evaluation of head defects from recombinants that carried both 297 and Delta 88 revealed defects consisting of posterior abdominal and genital tissue. In recombinant strains that carried 297only, similar transformations to abdominal and genital tissue were also observed.

Response of recombinants to the tuhlg maternal effect: D l 6 is an Abd-B null and this strain is homozygous for the tuh-1s maternal effect gene. We have previously shown that DI6/tuh-? transheterozygotes, in the presence of the dominant tuh-1s allele, show a high penetrance of genital defects (KUHN et al. 1993). The dominant tuh-Ismaternal effect and the DI6mutant chromosome were introduced into selected recombinant strains by crossing Dl6/Dp P5, Sb females to recombinant males. As controls, tuh-?/D16 and Canton-S/DIb offspring were also examined. Males were evaluated for external genital defects as well as sac testes (males show- ing both types were scored as a single defect); females were not evaluated. The results are shown in Table 2. tuh-?/D16 males showed a genital defect penetrance of 76.3%, while no genital defects were observed in Can- ton-S/Dl6males in the presence of tuh-Ih: Two recombinant strains, F1 and F7, carrying both 297 and Delta 88, were evaluated for genital defects. Strain F1 males showed a low penetrance of genital defects (15.8%) compared to the tuh-? control. Strain F7 males demon-

/ Fab P[ry+l C t

d/ A 4

49 kb 27 kb 0 kb

FIGURE 5.-Schematic diagram of the classes of tuh-3 recombinants obtained. The lower double-headed arrows with numerical values show the approximate number of kilobases between Fab and 297, 297 and Delta 88, Delta 88 and P[ly+]. A, Fab, 297, Delta 88; B, Fab, Delta 88; C, P [ v’]; D, 297, P [ $1 ; E, 297, Delta 88, P[lyy+].

strated a genital defect penetrance of 75%, similar to the levels seen with the tuh-? controls. Genital defect penetrance in males from recombinant strains carrying 297 only, ranged from a low of 82.3% (R21) to a high of 92.2% (R22). These values are higher than that seen with the tuh-? controls and the recombinants carrying 297and Delta 88. Males from three recombinant strains carrying Delta 88 only (F3, F5, F6,) were examined for genital defects. No defects were detected after evaluating 100 males from each strain. Genital defects were not detected in recombinant males carrying neither 297 nor Delta 88 (Rl, R27).

. .

DISCUSSION

For over a decade, the tuh-3 lesion has been associated with the insertion of the transposable element Delta 88 at +200 on the DNA map, 5’ of all of the known Abd-B transcripts. It has been postulated that this lesion is responsible for the differential phenotypes seen in the presence of the tuh-1 maternal effect alleles. Here we offer compelling evidence that it is not Delta 88, but another transposable element, 297, inserted into the first intron of the Abd-B class B and C transcriptional units, that is interacting with the tuh-1 maternal effect alleles to produce the differential phenotypes. We believe that the 297 insertion in the Abd-B gene of tuh-? and I127B is responsible for the defects based on the following findings. (1) II27B and tuh-? respond in an identical manner to the tuh-1 maternal effects; tuh-? carries both 297 and Delta 88, while I127B carries 297 only. (2) Recombinants of tuh-3, carrying 297 but not Delta 88, respond to the maternal effect alleles just as flies carrying both elements. ( 3 ) Recombinants carrying Delta 88 alone were phenotypically normal in the presence of either maternal effect. (4) No other lesions could be detected in the Abd-B gene by Southern analysis in I127B or tuh-3, and (5) the types of defects seen suggest misregulation of Abd-B since the structures affected or ectopically present are associated with Abd-B activity.

Flies carrying 297, but not Delta 88, respond to the tuh-1 maternal effects To determine the roles of 297 and/or Delta 88 in response to the tuh-1 maternal effect alleles with tuh-?, it was necessary to separate the two

685 297 Causes tuh-3 Mutation

TABLE 1

Recombinant head defect analysis

Males Females Totals

Recombinants HD Total % HD HD Total % HD HD Total % HD Abd/Gen tissue

Fab, 297, Delta 88 F1 137 343 39.9 263 368 71.5 400 711 56.3 Y F7 211 320 65.9 298 305 97.7 509 625 81.4 Y

R14 262 593 44.1 395 516 76.5 657 1109 59.2 Y R2 1 224 459 48.8 314 409 76.8 538 868 62.0 Y R22 295 503 58.6 311 460 67.6 606 963 62.9 Y R23 164 564 29.0 392 559 70.1 556 1123 49.5 Y

F3 0 302 0 0 416 0 0 718 0 NA F5 0 427 0 0 404 0 0 831 0 NA F6 0 336 0 0 321 0 0 657 0 NA

R1 0 411 0 0 397 0 0 808 0 NA R27 1 296 0.3 0 310 0 1 606 0.17 NA

All data were collected in the presence of the tuh-lh maternal effect. NA. not available.

297, q+

Fab, Delta 88

9+

elements. Two recombination events produced recombinant strains carrying both 297 and Delta 88: recombination between Fab and 297 (Figure 5A) and recombination between Delta 88 and P[y+] (Figure 5E). Both strains displayed the tuh-3 phenotypes in the presence of both tuh-l maternal effects revealing that the element or elements responsible must be between Fab and P [ 7y+] (from + 124 to +208). This observation was further strengthened by the fact that crossover events producing recombinant strains carrylng neither 297 nor Delta 88 (Figure 5C) failed to respond to the tuh-l maternal effects. The recombinant strains separating 297 from Delta 88 provided the essential data on the roles of 297 and Delta 88 in response to the tuh-1 maternal effects. Recombinant strains carrying 297 only (Figure 5D) produced homeotic head defects in the presence of the tuh-l* maternal effect and genital defects in the presence of the tuh-lg maternal effect. However, when Delta 88 was retained and 297 removed (Figure 5B), neither head nor genital defects were detected in these recombinant strains.

Does the Delta 88 insertion at + 200 in tuh-3 influence BX-C function? In all cases examined, the penetrance of genital defects was greater in recombinants carrying 297 only, when compared to recombinants carrying both Delta 88 and 297, suggesting that Delta 88 may be influencing, to a minor extent, the regulation of Abd- B. MARTIN et al. (1995) reported on the complete sequence of the BX-C and were able to identify open reading frames (ORFs) at the distal end of the complex. It appears that the Delta 88 insertion at +200 flanks two ORFs encoding proteins not thought to be related to BX-C function. Distal to the Delta 88insertion is the start of an ORF that encodes a homologue of the human S- adenosylhomocysteine hydrolase (ACHV gene. In situ

hybridization with a cDNA identified for this transcription unit (DELORENZI et al. 1988) revealed that it is not expressed in abdominal segments affected by Abd- B mutations. Just proximal to the Delta 88 insertion is an ORF that shows homology to a human alpha-actinin protein. The location of the Delta 88 insertion between two regions encoding genes not associated with the BX- C would suggest that Delta 88 is not influencing Abd-B. A more likely explanation has to do with the observation that tuh-3 modifier genes are located throughout the genome (WOOLF and PASSAGE 1980) with many re- siding on the second chromosome (WOOLF 1968). The variation seen between penetrances of genital defects (and head defects) within and between recombinant strains is probably due to a reduction in the number of modifier genes, previously selected for in the tuh-3 strain, as a result of outcrossing to foreign strains to produce the recombinants.

We have tentatively identified the location of a lesion for the Abd-B mutant iabYz3” to - +189 on the DNA map u. A. MACK and D. T. KUHN, unpublished data), just upstream of the first exon for the class C transcript (Figure 2A). iabYz3” is classified as an m+r- mutant as is tuh-3. In m+r- mutants, the A5-A8 denticle belts are normal; however, posterior to the A8 denticle belt is a region of naked cuticle and an extra (ninth) denticle belt both of which are not seen in wild-type embryos. These findings would suggest that i ~ b Y * ~ ” is the distal- most mutation identified in the BX-C thus far (placing itjust upstream of i ~ b 9 ~ “ ~ which maps to +187 to +188; KARCH et al. 1985), and along with the findings of MAR- TIN et al. (1995), may help to redefine the distal limits of the complex.

Site-specilic integration of 297 using (T)ATAT(A) as the target sequence: Most Drosophila copielike ele-


TABLE 2 Recombinant genital defect analysis

Males

GD Total % GD

Controls tuh-3 45 59 76.3 Canton-S 0 100 0

Fab, 297, Delta 88 Recombinants

F1 15 95 15.8 F7 27 36 75.0

R14 44 50 88.0 R2 1 65 79 82.3 R22 47 51 92.2 R23 52 58 89.7

F3 0 100 0 F5 0 100 0 F6 0 100 0

R1 0 100 0 R27 0 100 0

All data were collected in the presence of the tuh-lg mater-

297, T+

Fab, Delta 88

T+

nal effect.

ments thus far examined insert into chromosomes with- out obvious site-specificity. The copidike element 297 appears to be an exception. RUBIN and SPRADLINC (1981) initially reported that 297 preferentially inserts at the sequence ATAT. IKENACA and SAIGO (1982) examined the nucleotide sequences of three independent recombinant clones of the histone genes in D. melano- gastercontaining 297inserts. In two of the three clones, 297 inserted into the same TATA box of the H3 gene, while the remaining 297 inserted into an A + T-rich region between H1 and H3 histone genes; all three insertion sites of 297 contained a common sequence, TATATA. In addition, a 297 insertion in two related Drosophila species, simulans and yakuba, was found to be carried out in a site-specific manner using (T)A- TAT(A) as the target sequence (INOUYE et al. 1986). Our findings further support site-specific integration of 297 with TATATA as the target sequence.

Z127B (originally designated as 1127) was generated in an EMS mutagenesis screen designed to identify tumorous-head-like mutants (BOWNES et al. 1981). Because Z127B is the only Abd-B mutant, other than tuh-3, to produce head defects in the presence of the tuh-lh maternal effect (KUHN et ul. 1993), we were interested in obtaining the background stock used in the EMS screen to test for the presence of 297in the Abd-B gene. Unfor- tunately, that stock has been lost. The possibility exists that at some point in time, a stock was identified as Z127B that is actually tuh-3 that somehow lost Delta 88. This is partially based on the observation that both strains may share the same polymorphism. We also won-

dered about the possibility that the Delta 88 insertion in our tuh-3 stock was a more recent event. A sample of the original tumorous-head strain, obtained from a natural population in Mexico in 1941, was sent to Cal- tech in 1949, almost 50 years ago. We obtained the tuh- 3 strain from the Indiana stock center that had been forwarded to them from Caltech. Southern analysis showed that the Caltech tuh-3 strain was identical to ours, containing both Delta 88 and 297 (data not shown). It is not possible to determine if the 297 inser- tions in 1127B and tuh-3 represent independent inser- tional events.

Model for tuh-1 modulation of 297 in Z127B and tuh-3: We believe that tuh-Fiis likely responsible for a maternal effect product capable of suppressing AM-B activity strongly in the anterior of 1127B and tuh-3 embryos and to a lesser extent in the posterior. We also believe that tuh-I" is acting like a hypomorph or null since females deficient for the tuh-1 locus produce offspring with homeotic head defects and normal genitalia. In situ hybridization studies with Abd-B probes suggest that tuh- lg is acting at the transcriptional level; tuh-F; tuh-3 embryos display reduced levels of class B and C transcripts in PS14 compared to tuh-1"; tuh-3 or Cantons embryos (KUHN et al. 1993). We have also demonstrated the same effects in 1127B embryos (J. A. MACK and D. T. KUHN, unpublished results).

tuh-3 and 1127B require tuh-F for manifestation of the genital defect phenotype. In the absence of tuh- lg, genitalia are normal. This observation suggests an interaction, either direct or indirect, between 297 and the tuh-Fproduct. This could be similar to interactions between suppressor of Haily wing (su(Hw)) and the copia- like element ~ p s y . gypsy is responsible for a number of tissue-specific mutations that are often reversed by mutations in su(Hw) ( MODELELL et al. 1983). The wild- type su(Hw) protein binds to mammalian-like enhancer elements in gypsy. This is thought to interfere with promoter/enhancer interactions in the host gene when ~ p s y has inserted between the enhancer and promoter (GEYER and CORCES 1992). A possible molecular explanation for decreased levels of class B and C transcripts is that tuh-lg, or a downstream effector, could interact directly or indirectly with 297, preventing efficient communication between the class B and C promoters and downstream enhancers. The reduction in class B and C transcripts can account for male genital defects since male genitalia are thought to arise from A9. A likely explanation is that there simply is not enough ABD-BII protein for the proper formation of genitalia. We could not detect decreased levels of class A transcript in PS 13 (KUHN et al. 1993), which gives rise to female genitalia; yet, Z127B and tuh-3 females in the presence of tuh- l g also display genital defects. This suggests that ABD- BI activity is also being affected. Perhaps only a slight decrease in ABD-BI protein is sufficient to produce genital defects in females. Alternatively, if female genitalia

297 Causes tuh-3 Mutation 687

derive from the entire A8, then a reduction of ABD- BII protein in pA8 could affect development of female genitalia.

When tuh-3 and I127B flies are deficient for tuh-lg, derivatives of the eye/antennal disc are transformed into posterior abdominal and genital tissue due to the ectopic expression of Abd-B. Presuming that 297 is lead- ing to the ectopic expression, how may it be acting to do so? The 297 LTR sequence closely matches that of the vertebrate avian leukosis-sarcoma virus (KUGIMIYA et al. 1983). Integration of avian leukosis virus into the chicken c-myc gene can lead to a dramatic increase in c-myc expression resulting in bursal lymphomas. One model for this activity is that the avian leukosis virus LTR can behave as an enhancer (enhancer insertion model) (BANERJI et al. 1981; LEVINSON et al. 1982). Par- tial sequence analysis of the 297insert in the Abd-B gene of tuh-3 and I127B shows that both possess a full length 5’ LTR. It is intriguing to speculate that enhancer activity in the 5’ LTR may be contributing to the ectopic activation of Abd-B. The types of transformations seen in the head are attributable to both ABD-BI and ABD- BII activity. This suggests that both class A and class B and/or class C transcriptional units are being misexpressed. The 297insertion in tuh-3and I127Bis situated upstream of the class A promoter and downstream of the class B and C promoters. It is possible that 297 enhancer activity could lead to the production of both ABD-B protein isoforms. However, it is also possible that ectopic ABD-BII only could account for the defects. Ectopic expression of ABD-BII during embryogenesis results in the appearance of filzkorper and spiracular hairs in the larval thorax and abdomen, structures normally associated with ABD-BI activity in PS13 (LAMKA et al. 1992; KUZIORA 1993). Abdominal cuticle present in the dorsal thorax of iab9”‘”” mutants results from the ectopic expression of ABD-BII, tissues normally associated with ADB-BI activity (CELNIKER and LEWIS 1993). These observations suggest that ectopic expression of ABD-BII alone in the eye-antennal discs of tuh-3 and I127B could give rise to both posterior abdominal and genital tissues. We are currently conducting in situ hybridization experiments to determine which transcripts are being misexpressed in the eye/antennal discs.

Concluding remarks: At this time, we can only speculate on how the tuh-Fproduct might be interactingwith 297 to produce genital defects, and how the absence of a functional tuh-lg product ( i . e , , tuh-lh) leads to the ectopic expression of Abd-B in I127B and tuh-3 flies. Until recently, we have only been able to demonstrate differential phenotypes of the tuh-1 maternal effects in a mutant background. G. PACKERT (unpublished data) has shown that adult flies carrying the tuh-lh maternal effect in an otherwise wild-type background have significantly higher bristle numbers than flies carrying the tuh-lg maternal effect in a wild-type background. There- fore, it is possible that the tuh-lg product may function

as a general attenuator of gene expression at a number of different loci. Cloning and characterization of the tuh-1 locus will undoubtedly provide valuable insight.

If 297 is indeed responsible for the ectopic expression of Abd-B in the presence of tuh-lh, it is interesting to note that we only see evidence of it in derivatives of the eye/antennal disc. Our in situ hybridization studies suggest that 297 is also capable of upregulating Abd-B transcription in the posterior of the fly in the presence of tuh-lh. When 127B and tuh-3 embryos were hybridized with a class B- or class C-specific DNA probe under identical conditions, embryos homozygous for tuh-lh were always the first to show stain and always stained the most intensely, as opposed to I127B and tuh-3 embryos homozygous for tuh-F or CS embryos u. A. MACK and D. T. KUHN, unpublished data). SANCHEZ-HERRERO et al. (1996) demonstrated that ectopic expression of Abd- B using various GAL4 drivers results in homeotic transformations of the wing and first abdominal segment, phenotypes that we do not observe in tuh-lh; I127B and tuh-3 flies. Therefore, it is possible that 297 in the Abd- B gene of I127B and tuh-3 flies, in the absence of a functional tuh-lR product, can only respond to factors produced in, and/or functional in, the head and the tail regions of the fly.

We thank DAWD H. VICKERS and BRUCE J. COCHRANE for their helpful discussions during the course of this investigation, and the reviewers for their insightful comments and suggestions. MIGNON C. FOGERIY is thanked for her thoughtful critique of the manuscript. We also thank WELCOME BENDER for providing us with Abd-Bgenomic clones and for the Fab, P[ly+] fly line, and VICTOR C. CORCES for providing us with 297 cDNA. This work was supported by National Science Foundation research grants RUI DM59023293 and MCB- 9418119 to D.T.K.

LITERATURE CITED

BANERJI, J., S. RIJSCONI and W. SCHAFFNER, 1981 Expression of a p- globin gene is enhanced by remote SV40 DNA sequences. Cell

BENDER, W., M. A K A M , F. KARCH, P. A. BEACHY, M. PEIFFER et al., 1983 Molecular genetics of the bithorax complex in Drosqhila melanogaster. Science 221: 23-29.

BENTON, W. D., and R. W. DAVIS, 1977 Screening A gt recombinant clones by hybridization to single plaques in situ. Science 196: 180-182.

BOUIXT, A. M., A. LI.OUO and S. SAKONJU, 1991 Molecular definition of the morphogenic and the &regulatory elements of the D m sophila Abd-B homeotic gene. Development 111: 393-405.

BOWNES, M., S. ROBERTS, M. DEMPST~R and N. BOURNAI~-VAR~IABASIS, 1981 Characterization of a new tumorous-head mutant ofDrosqh- ila melanagaster. Mol. Gen. Genet. 183: 158-162.

CASARES, F., M. CALLEJA and E. SANCHEZ-HEFXERO, 1996 Functional similarity in appendage specification by Ultrabithorax and abdominal-A Drosophila HOX genes. EMBO J. 15: 3934-3942.

CASSANOVA,J., E. SANCHEZ-HEFXEROandG. MORATO, 1986 Identifica- tion and characterization of a parasgement specific regulatory element of the Abdominal-B gene of Drosophila. Cell 47: 627-636.

CELNIKER, S. E., n. J. KEELAN and E. B. LEWIS, 1989 The molecular genetics of the bithorax complex of Drosophila: characterization of the products of the Abdominal-B domain. Genes Dev. 3: 1424- 1436.

CELNIKER, S. E., and E. B. LEWIS, 1993 Molecular analysis of Trans- abdominal-a sexually dimorphic mutant of the bithorax complex of Drosophila. Proc. Natl. Acad. Sci. USA 90: 1566-1570.

27: 299-308.


DELORENZI, M., N. ALI, G. SAARI, C. HENRY, M. WILCOX et al., 1988 Evidence that the Abdominal-B r element function is conferred by a transregulatory homeoprotein. EMBO J. 7: 3223-3231.

DELORENZI, M., and M. BIENZ, 1990 Expression of Abdominal-B homeoproteins in Drosophila embryos. Development 108: 323-329.

DRIEVER, W., and C. NUSSLEIN-VOLHARD, 1989 The bicoid protein is a positive regulator of hunchback transcription in the early Drosophila embryo. Nature 337: 138-143.

DUNCAN, I., and E. B. LEWIS, 1982 Genetic control of body segment differentiation in Drosophila, pp. 533-554 in Developmental Order: Its &gins and Regulation, edited by S. SUBTELNY. A. R. Liss, New York.

DUNCAN, I . , 1987 The bithorax complex. Annu. Rev. Genet. 21: 285-319.

GARDNER, E. J., and C. M. WOOLF, 1949 Maternal effect involved in the inheritance of abnormal growths in the head region of Drosophila mlanogaster. Genetics 34: 573-585.

GEYERS, P. K, and V. G. CORCES, 1992 DNA position-specific repression of transcription by a Drosophila zinc finger protein. Genes Dev. 6: 1865-1873.

GWRKOVICS, H., J. GAUSZ, J. KUMMER and F. KARCH, 1990 A new homeotic mutation in the Drosophila bithorax complex removes a boundary separating two domains of regulation. EMBO J. 9: 2579-2585.

H A N , K., M. S. LEVINE and J. L. MANLEY, 1989 Synergistic activation and repression of transcription by Drosophila homeohox proteins. Cell 56: 573-583.

IKENAGA, H., and K. SAIGO, 1982 Insertion of a movable genetic element, 297, into the T-A-T-A box for the H3 histone gene in Drosophila melanogaster. Proc. Natl. Acad. Sci. U S A 7 9 4143-4147.

INOWE, S., S. YUM and K. SAICO, 1986 Complete nucleotide sequence and genome organization of a Drosophila transposable element, 297. Eur. J. Biochem. 154: 417-425.

JAYNES, J. B., and P. H. O'FARRELL, 1988 Activation and repression of transcription by homeodomain-containing proteins that hind a common site. Nature 3 3 6 744-749.

KARCH, F., B. WEIFFENBACH, M. PEIFFER, W. BENDER, I. DUNCAN et al., 1985 The abdominal region of the hithorax complex. Cell 4 3 81-96.

KRASNOW, M. A,, E. E. SAFFMAN, K. KORNFELD and D. S. HOGNESS, 1989 Transcriptional activation and repression by Zntrabithorax protein in cultured Drosophila cells. Cell 57: 1031-1043.

KUGIMIYA, W., H. IKENAGA and K SAIGO, 1983 Close relationship between the long terminal repeats of avian leukosis-sarcoma virus and copiu-like movable genetic elements of Drosophila. Proc. Natl. Acad. Sci. USA 80: 3193-3197.

KUHN, D. T., D. T. WOODS and D. J. ANDREwS, 1981 Deletion analysis of the tumorous-head (tuh-3) gene in Drosophila melanogaster. Genetics 9 9 99-107.

KUHN, D. T., and G. PACKERT, 1988 Tumorous-head type mutants of the distal bithorax complex cause dominant gain and recessive loss of function in Drosophila melanogaster. Dev. Biol. 125: 8-18.

KUHN, D. T., J. A. MACK, C. DUAN and G. PACKERT, 1983 Tumorous- head (tuh-I; tuh-3) modulates Abd-B hithorax complex functions in D. melanogaster. Genetics 133: 593-604.

KUHN, D. T., G. TURENCHALK, J. A. MACK, G. PACKERT and T. B. KOR- NBERG, 1995 Analysis of genes involved in organizing the tail segments of the Drosophila melanogaster embryo. Mech. Dev. 53: 3-13.

KUZIORA, M. A,, 1993 Abdominal-B protein isoforms exhibit distinct cuticular transformations and regulatory activities when ectopically expressed in Drosophila embryos. Mech. Deu. 42: 125-137.

LAMKA, M. L., A. M. BOULET and S. SAKONJU, 1992 Ectopic expression of UBX and ABD-B proteins during Drosophila emhryogene- sis: competition, not a functional hierarchy, explains phenotypic suppression. Development 116: 841-854.

LEVINSON,B.,G.KHOURY,G.VANDEWO~DE~~~P.GRUSS,~~~~ Activa- tion of SV40 genome by 72-base pair tandem repeats of Maloney sarcoma virus. Nature 295: 568-572.

LEWIS, E. B., 1978 A gene complex controlling segmentation in Dre sophila. Nature 276: 565-570.

LEWIS, E. B., J. D. KNAFELS, D. R. MATHOC and S. E. CELNIKER, 1995 Sequence analysis of the cis-regulatory regions of the hithorax complex of Drosophila. Proc. Natl. Acad. Sci. USA 92: 8403-8407.

LINDSLEY, D. J., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, New York.

MARTIN, C. H., C. A. MAYEDA, C. A. DAVIS, C. L. ERICSSOK, J. D. KN& FEI.S et al., 1995 Complete sequence of the hithorax complex of Drosophila. Proc. Natl. Acad. Sci. USA 92: 8398-8402.

MARTINEZ-ARIAS, A,, and P. A. LAWRENCE, 1985 Parasegments and compartments of the Drosophila embryo. Nature 3 1 3 639-642.

MCGINNIS, W., R. L. GARBER, J. WIRZ, A. KUROIWA and W. J. GEHRIKG, 1984 A homologous protein-coding sequence in Drosophila homeotic genes and its conservation in other metazoans. Cell 37: 403-408.

MOUEI.EI.I., J., W. BENDER and M. MESEISON, 1983 D. melanogastm mutations suppressible by the suppressor of Haily wing are inser- tions of a 7.3 kh mobile element. Proc. Natl. Acad. Sci. USA 80:

NOTHIGER, R., A. DUBENDORFER and F. EPPER, 1977 Gyandrornorphs reveal two separate primordia for male and female genitalia in Drosophila melanogaster. Roux's Arch. 181: 367-373.

PEIFER, M., F. KARCI-~ and W. BENDER, 1987 The hithorax complex: control of segment identity. Genes Dev. 1: 891-898.

POTTER, S. S., W. J. BROREIN JR., P. DUNSMUIR and G. M. RUBIN, 1979 Transpostion of elements of the 412, copia and 297 dispersed repeated gene families in Drosophila. Cell 17: 415-427.

SAMBROOK, J,, E. G. FRITSCH and T. MANIATIS, 1989 Molecular Clon- ing: A Labwatoly Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SANCHEZ-HERRERO, E., I. VERNOS, R. MARco and G. MORATA, 1985 Genetic organization of the Drosophila hithorax complex. Nature

SCOTT, M. P., and A. J. WEINER, 1984 Structural relationships he- tween genes that control development: sequence homology he- tween the Antennapedia, Ultrabithorax, and fushi tarazu loci of Dre sophila. Proc. Natl. Acad. Sci. USA 81: 4115-4119.

SPRADLING, A. C., and G. M. RUBIN, 1981 Drosophila genome organization: conserved and dynamic aspects. Annu. Rev. Genet. 15:

THAI.I, M., M. M. MULLER, M. DELORENZI, P. MATTHAIS and M. BIENZ, 1988 Drosophila homeotic genes encode transcriptional activa- tors similar to OTF2. Nature 336: 598-601.

TIONG, S., L. M. BONE and R. S. WHITTLE, 1985 Recessive lethal mutations within the bithorax-complex in Drosophila. Mol. Gen. Genet. 200: 335-342.

WINSLOW, G. M., S. HAYMHI, M. KRASNOW, D. S. HOGNESS and M. P. SCOTT, 1989 Transcriptional activation by Antennapedia and fushi tararu proteins in cultured Drosophila cells. Cell 57: 1017- 1030.

WOOLF, C. M., 1966 Maternal effect influencing male genital disc development in Drosophila melanogaster. Genetics 53: 295-302.

WOOLF, C. M., 1968 Male genital disc defect in Drosophila melanogaster. Genetics 60: 111-121.

WOOLF, C. M., and M. B. PASSAGE, 1980 Genetic variability of the tumorous-head maternal effect in Drosophila melanogaster. Mol. Gen. Genet. 178: 423-427.

ZAVORTINK, M., and S. SAKONJU, 1989 The morphogenic and regulatory functions of the Drosophila Abdominal-B gene are encoded in overlapping RNAs transcribed from separate promoters. Genes Dev. 3: 1969-1981.

1678-1682.

313: 108-113.

219-264.

Communicating editor: V. G. FINNERTY

Documents

Mobile Element 297 Abd-B of Drosophila melanogaster, Delta 88, … · 2002. 7. 5. · 680 J.A. Mack, R. D. Smith and D. T. Kuhn unique 5' exons and give rise to two distinct ABD-B