MinIONNanopore sequencing

1 Laboratory of Food Microbiology,

2 Department of Water Technology and environmental engineering

Sabina Purkrtová1, Dana Vejmelková2, Milada Suková1

PIGA projekt C1_VSCHT_2019_066

(Zavedení nanopórového sekvenování MinION do laboratorních prací a přednášek na ÚTVP a ÚBM)

MinION sequencingOxford Nanopore Technologies

https://nanoporetech.com

Basic information• nanopore sequencing

• 2014 launched

• the only portable device for real-time RNA and DNA sequencing

• measurement is performed on a flow cell (array with 512 sensors), which is inserted into the MinION before each sequencing

• Weight: 100 g, Dimensions: 105x23x33 mm

• each flow cell can generate up to 30 Gb of sequencing data

https://nanoporetech.com/products/minion

Principle

• A: library preparation

• B: flow cell loading

• C: passage through the

nanopore

• D: data analysis

A.

D. C.

B.

A. Library preparation

• various sets for library preparation

• DNA concentration measurement

• DNA fragmentation - optional

• repair of ends

• adapters ligation - interact with proteins on the nanopore (facilitate fiber capture), introduction of process enzyme at the 5‘ end of a single fiber

DNA concentration measurement

Qubit Fluorometric Quantification

• touch screen devices

Advantages:

• for low nucleic acid samples

• specificity, sensitivity

• different sample volumes

Disadvantages:

• no information about purity

• time of preparation

• previous sample preparation with compatible reagents - higher costs

https://www.thermofisher.com/order/catalog/product/Q33227#/Q33227

DNA concentration measurement

NanoDrop

• UV spektrophotometer

• slightly bigger than Qubit

• Advantages:

• ability to measure sample purity

• no sample preparation required (no use of standards and other reagents)

• Disadvantages:

• requires 1-2 µL of sample

• insufficient sensitivity

• absorbance measurement does not distinguish DNA, RNA or proteins (values easily influenced by other contaminants-salts, organic compounds)

https://www.selectscience.net/products/nanophotometer----the-complete-solution-for-submicroliter-and-

standard-volume-applications/?prodID=14073

B. Passage through the nanopore

• nanopore (artificial protein) is built into an electrically resistant membrane made of synthetic polymer

• the membrane is immersed in the ionic solution and voltage is applied across

• by decoding the characteristic current changes it is possible to identify the molecule that interrupted the ion current, in this case the individual bases

https://lh3.googleusercontent.com/proxy/XcsbOqOEJDukSpNqjzYQVvDBXpLf9Am0fuMi6fz8lcO2IbmHV9rST9z4UG1PuFpPYwT2ZA8pZM9QLjO_0Ye1xO6zjmrelaI0Dtwdlh0vVO_BW4Xt4AU

(i) open channel

(ii) dsDNA with leading adapter

(blue) coupled to molecular

motor (orange) and hairpin

adapter (red) are captured on

the nanopore

(iii) interception is followed by

translocation of the leading

adapter

(iv) the template fiber

(v) hairpin adapter

(vi) complementary fibers

(vii) end adapter

(viii) open channel

Jain, M., Olsen, H.E., Paten, B. et al. The Oxford Nanopore MinION: delivery of nanopore sequencing to

the genomics community. Genome Biol 17, 239 (2016). https://doi.org/10.1186/s13059-016-1103-0

C. Flow cell loading

Filling

(priming) portWaste port 1

Waste port 2

Waste channel Sensor array

SpotON sample port cover

(SpotON sampling port)

D. Data analysis• Software for data recording and processing: MinION

• Records raw sequencing data from individual nanopores

• Raw data has the format fast5

• Record current measurements in pA in individual nanopores(frequency about a thousand times per second)

• Raw sequencing data are subjected to basecalling• the respective bases are assigned to each current change

• Basecalling can take place in real time and then off-line

• data after basecalling have the format fastq

• fastq format is a text document which, in addition to the fast format document, contains, besides the sequence, the reading quality of each nucleotide (see example below - 4th row)

@SEQ_ID

GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT

+

!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

the lowest quality the lowest quality

Reading accuracy(Tyler et al., 2018)• 94%-1D experiment• 97%-2D

D. Data analysis• Software for data analysis: EPI2ME• Different applications depending on the kits used and evaluation types• E.g. Custom Reference Alignment

Example:• linked to nanoporotech.com - graphical output• often output in bam format• bai format required for various software eg

Genome Workbench• conversion to bai format – e.g. samtools tools -

must be done in Linux• Win10 allows you to install the Ubuntu Linux

subsystem (you can run samtools)

Advantages

• Mobility - Various environments, connect to a PC or laptop with Hi-Speed USB 3.0 cable

• real-time measurement - immediate access to results (pathogen identification, antibiotic resistance determination)

• no PCR amplification required (depending on kit used)

• long reads

• study of native DNA or RNA structure - mutation detection

• cheap - $ 1000 starter package

• flow cells can be reused

https://nanoporetech.com

Application

• portable device - not limited to laboratory environment, used in mountains, jungle, arctic region and international space station

• whole genome sequencing

• targeted sequencing

• RNA sequencing

• metagenomics

• epigenetics

https://www.space.com/34108-nasa-astronaut-sequences-dna-first-time

Oxford Nanopore Offer

Various kits

Flow cells

Device• for insertion of flow cell (cells)• individual types differ in number of flow cells (= number

of parallel sequencing)• possible device + computer

Oxford Nanopore Technologies Ltd.• private company based in Oxford (GB)• in Czechia does not have a commercial representation, all orders must

be communicated directly with the headquarters (registration required - different levels)

• www: https://nanoporetech.com/• The site contains experience sharing community, software, etc.

Oxford Nanopore OfferDevice – to insert a flow cell

MinION-1 flow cell-1000 $ (included in the starter pack)

GridION-5 flow cells- $ 49,955

PromethION-24/48 flow cells- $165 000/$285 000

Flongle-Flow Fongle Cell Adapter (lowerprice)-1860 $ (starterpack)

Flow cells

512 nanopore channels900 $ (48 h of operation and/or as long as the pores are sufficiently permeable)

Flow Fongle Cell126 nanopore channels90 $ (24 h of operation and/or as long as the pores are sufficiently permeable)

MinION and GridION Flow Cell

PromethION Flow Cell

3000 nanopore channels

Oxford Nanopore OfferVolTRAX v2

Automatic sample and librarypreparation

$8,150

Various kits

• kits do not contain reagentsneeded to repair or amplify fragments - must be purchased separately

Laboratory equipment and reagents needed

Hula mixer – for DNA fragmentation

Magnetic separator

Agencourt AMPure XP beads

Covaris g tube-recommended for DNA fragmentation in bead-beater (not necessary)

LoBind plastics (eppendorfs, PCR tubes)

Sequencing kits

Consumables: not included in the kit

DNA fragmentation

DNA repair and ends preparation (35 min)

Adapters ligation and clean-up (30 min)

The protocols for using kits on the Oxford Nanoporewebsite are very well and properly designed, user-friendly

Chemikálie potřebné pro Ligation Sequencing kit

Firma (jméno, adresa, kontakt) Produkt Kat.čísloPočet reakcí

Objem (ml)

Počet ks

Doba užití (h)

Cena za balení (bez

DPH)

Cena 1 sekv. reakce

Poznámka

Výsledná cena

Biotech (New England Biolabs)

NEBNext FFPE DNA Repair Mix M6630S 24 5660 236

1170

NEBNext Ultra II End Repair/dA-Tailing Module

E7546S 24 8560 357

NEBNext Quick Ligation Module

E6056S 20 10000 500

Beckman Coulter Agencourt AMPure XP beads A63880 5 5100 61

ThermoFisher ScientificNuclease-free water (e.g.

ThermoFisher)AM9938 100 1612 2

Merck1.5 ml Eppendorf DNA LoBind

tubesZ666548-

250EA250 466 9

P-LAB 0.2 ml thin-walled PCR tubes U322510 1000 1076 5

Oxford Nanopore Technologies

Ligation Sequencing Kit SQK-LSK109 6 $599.00

4845 6015Při samostatném zakoupení LSK a průtokové cely

Ligation Sequencing Kit SQK-LSK109 6 13667 2278

Single Flow Cell R9.4.1 8 48 $900

Single Flow Cell R9.4.1 8 48 205352567

(pro 6 hodin)Starter Pack - MinION Starter

Pack*Starter Pack 6 $1000

3803 4973Při použití Starter Pack

(obsahuje též 2 flowcell)

Starter Pack - MinION Starter Pack*

Starter Pack 6 22817 3803

Starter Pack - MinION Starter Pack

1x MinION Sequencing Device2x Starter Pack Flow Cell (R9.4.1)

1x Control Expansion 1x Flow Cell Wash Kit 1x Ligation Sequencing Kit (kit dle výběru)

1 x Flow Cell Priming Kit

Oxford Nanopore – ke každé zásilce 50$ poštovné (1141 Kč) 1 $ = 23 Kč

Sequencing kits-price calculation

Sequencing kits-price calculationChemikálie potřebné pro 16S Barcoding Kit/16S Barcoding Kit 1-24

Firma (jméno, adresa, kontakt) Produkt Kat.číslo BaleníCena za balení (bez

DPH)Použití též v:

New England Biolabs LongAmp Hot Start Taq 2X Master Mix M0533S 1 (100 reakcí) 5400PCR Barcoding

kit

Merck 1M Tris-HCl T3038-1L 1 (1l) 2530PCR Barcoding

KitBeckman Coulter Agencourt AMPure XP beads A63880 1 (5 ml) 5100

Lig.-Seq.+ PCR Barcoding Kit

Merck 1.5 ml Eppendorf DNA LoBind tubes Z666548-250EA 2 (5x 50 ks) 466P-LAB 0.2 ml thin-walled PCR tubes U322510 1 (1000 ks) 1076

ThermoFisher Scientific Nuclease-free water (e.g. ThermoFisher) AM9938 1 (1x100 ml) 1612Oxford Nanopore Technologies 16S Barcoding Kit (6 reakcí – každá reakce 12 barcoding) SQK-RAB204 $650.00

Chemikálie potřebné pro PCR Barcoding Kit

Firma (jméno, adresa, kontakt) Produkt Kat.číslo BaleníCena za balení (bez

DPH)Použití též v:

New England BiolabsNEBNext FFPE DNA Repair Mix- 24 rxns M6630S 1 5660

Lig.-Seq.kitNEBNext Ultra II End Repair/dA-Tailing Module E7546S 1 8 560NEBNext Quick Ligation Module E6056S 1 10 000

New England Biolabs LongAmp Hot Start Taq 2X Master Mix M0533S 1 (100 reakcí) 540016S Barcoding

KitNew England Biolabs Exonukleasa I (NEB, M0293) M0293S 1 (3000 U) 2290

Beckman Coulter Agencourt AMPure XP beads A63880 1 (5 ml) 5100 Lig.-Seq.+ PCR Barcoding KitMerck 1.5 ml Eppendorf DNA LoBind tubes Z666548-250EA 1 (5x 50 ks) 466

Merck 1M Tris-HCl T3038-1L 1 (1l) 253016S Barcoding

KitP-LAB 0.2 ml thin-walled PCR tubes U322510 1 (1000 ks) 1076

ThermoFisher Scientific Nuclease-free water (e.g. ThermoFisher) AM9938 1 (1x100 ml) 1612

Oxford Nanopore Technologies PCR Barcoding Kit (6 reakcí – každá reakce 12 barcoding) SQK-PBK004 $650.00

Sequencing kits

According to sample type

Sample: gDNA (or PCR amplicons, cDNA) Sample: RNA

Sequencing includingPCR amplification

Enough DNA

Low DNA-amplification of DNA presentSequencing of only selected region (16S rRNA gene)

According to barcoding use

Purpose: identification of fragments from different samples - these samples are applied together (saving for flow cell) -during sample preparation, a specific sequence is attached to the fragments of a given sample to distinguish individual samples (this barcoding sequence is included in the obtained sequence)

According to time or experimentalconditions

Direct RNA sequencing or cDNA transcription and cDNA sequencing

„Slow“-60 min and more

Transposasecomplex

Direct sequencing without PCR

amplification included

NEBNext FFPE DNA Repair Mix

NEBNext Ultra II End Repair/dA-Tailing Module

NEBNext Quick Ligation Module

„Fast“-10-15 min

Individual steps-fragmentation, ends repair, ligation

All steps in one

Kits without PCR amplification during sequencingLigation

Optimised for throughput

Rapid

Simple and rapid library

preparation

Ligation 1D2

Highest raw read accuracy

Ligation Sequencing Kit Rapid Sequencing Kit Ligation Sequencing Kit 1D2

Preparation time 60 min 10 min 80 min

Input recommendation

1000 ng dsDNA

(1000 ng high molecular weight dsDNA

100+ ng DNA if performing fragmentation or

PCR), gDNA / amplicon / cDNA

400 ng HMW gDNA (>30 kb) 1000 ng dsDNA

FragmentationOptional, recommended for inputs of 100-

500 ngTransposase based Optional

Read Length Equal to fragment lengthRandom distribution, dependent on input

fragment lengthEqual to fragment length

Read type produced 1D 1D 1D2

Typical throughput +++ ++ ++

Compatible with

Premium whole genome amplification

Amplicon sequencing

Size selection using BluePippin

Target enrichment by sequence capture

Rapid whole genome amplification

Amplicon sequencing

Size selection using BluePippin

Target enrichment by sequence capture

Ligation Sequencing Kit SQK-LSK109

$599.00=6 reakcí

Field Sequencing Kit SQK-LRK001

$599.00= x reakcí

Rapid Sequencing Kit SQK-RAD004

$599.00

1D2 Adapter allows the pore to capture

the complement strand immediately

after the template. One strand of the

duplex is sequenced at a time,

producing 1D2 reads.

Multiplexing optionsNative Barcoding Expansion 1-12 (PCR-

free), PCR Barcoding Expansion 1-12Rapid Barcoding kit SQK-RBK004 PCR Barcoding kit

+++ 2-3 Gb in 6 h8+ Gb in 48 h

++ 1-2 Gb in 6 h4+8 Gb in 48 h

+ Less than 1 Gb in 6 h1-4 Gb in 48 h

Usually 6 reactions

Kits without PCR amplification during sequencing

Ligation Sequencing Kit SQK-LSK109

$599.00=6 reactions

gDNA / amplicon / cDNA ≤ 1 µg 60 mins No PCR Throu

ghput

Rapid Barcoding Kit SQK-RBK004

$650.00= 6 reactions

• barcoded

samples are

pooled

gDNA 400 ng 10 mins No PCR Speed / simplicit

y

Kits with PCR amplification during sequencingPCR Sequencing KitControl over read length

Compatible with targeted

amplicon sequencing

Rapid PCR Barcoding KitSimple library preparation

(15 mins hands-on time)

16S BarcodingGenus level bacterial identification

PCR Sequencing Kit Rapid PCR Barcoding Kit 16S Barcoding Kit

Preparation time 60 mins + PCR 15 min + PCR 10 min + PCR

Input

recommendation<100 ng gDNA <10 ng gDNA <10 ng gDNA

Fragmentation Optional Transposase based Not required

Read Length Equal to fragment length post PCR ~2 kb Full-length 16S gene (~1.5 kb)

Read type

produced1D 1D 1D

Typical throughput +++ ++ ++

Compatible withAmplicon sequencing

(Four primer PCR)

PCR Sequencing Kit SQK-PSK004

$599.00

PCR Barcoding Kit SQK-PBK004

$650.00

Rapid PCR Barcoding Kit SQK-RPB004

$650.00

16S Barcoding Kit 1-24 SQK-16S024

$900.00

16S Barcoding Kit SQK-RAB204

$650.00

Multiplexing

optionsPCR Barcoding Kit

This kit offers barcoding for up to twelve

samples

This kit offers barcoding for up to twelve

samples

+++ 2-3 Gb in 6 h8+ Gb in 48 h

++ 1-2 Gb in 6 h4+8 Gb in 48 h

+ Less than 1 Gb in 6 h1-4 Gb in 48 h

Usually 6 reactions

Kits with PCR amplification during sequencing16S Barcoding Kit SQK-RAB204 $650.00

gDNA 10 ng ~10 mins + PCR PCR Bacterial I

D

PCR Sequencing Kit SQK-PSK004 $599.00

gDNA 100 ng 60 mins + PCR PCR Fragment length cont

rol

a method whereby users are able to tag

their own specific amplicons with the

same 5’ group, simplifying downstream

post-PCR processing

Direct RNASequence RNA molecules directly

and preserve base modifications

Up to 1 million reads

Direct cDNANo PCR bias

Up to 10 million reads

PCR cDNAOptimised for throughput

Up to 12+ million reads

Direct RNA Sequencing Kit Direct cDNA Sequencing Kit PCR cDNA Sequencing Kit

Preparation time 105 min 270 min 165 min

Input requirement 500 ng poly-A+ RNA 100 ng poly-A+ RNA 1 ng poly-A+ or 50 ng total RNA

RT Required Optional Yes Yes

PCR Required No No Yes

Read length Equal to RNA length Enriched for full-length cDNA Enriched for full-length cDNA

Typical throughput + ++ +++

Typical number of

reads1 million 5 - 10 million 7 - 12+ million

Direct RNA Sequencing Kit

SQK-RNA002

$599.00

Direct cDNA Sequencing Kit

SQK-DCS109

$599.00

PCR-cDNA Barcoding Kit

SQK-PCB109 $650.00

PCR-cDNA Sequencing Kit

SQK-PCS109 $599.00

Multiplexing

optionsIn development

Native Barcoding Expansion 1-12 and

Native Barcoding Expansion 13-24PCR Barcoding Kit

Kits for RNA sequencing

+++ 2-3 Gb in 6 h8+ Gb in 48 h

++ 1-2 Gb in 6 h4+8 Gb in 48 h

+ Less than 1 Gb in 6 h1-4 Gb in 48 h

Usually 6 reactions

Kits for RNA sequencingDirect RNA Sequencing KitSQK-RNA002 $599.00

Sequence RNA molecules directly and

preserve base modifications

Description

• to prepare any RNA with a 3’ polyA

tail for 1D sequencing

• the kit requires 500 ng of input RNA

• possible input - RNA includes

eukaryotic mRNA, viral RNA with a

polyA tail

• possible input - any RNA prepared

with a polyA-tailing kit

• RNA without a polyA tail - to design

own custom adapter to ligate a

specific terminal 3’ sequence like the

3’ of tRNA or 16S rRNA.

Direct cDNA Sequencing KitSQK-DCS109 $599.00

Identification and quantification of full-length

transcripts without PCR bias

Poly-A+ RNA 100 ng 270 mins No PCR No PCR bias

Poly-

A+ RNA 1 ng 165 mins PCR Throughput

PCR-cDNA Sequencing Kit

SQK-PCS109 $599.00

Identification and quantification of full-lengthtranscripts with highest throughput

Poly-A+ RNA 500 ng 105 mins Direct RNA RNA base mods

References• Jain, M., Olsen, H.E., Paten, B. et al. The Oxford Nanopore MinION: delivery of

nanopore sequencing to the genomics community. Genome Biol 17, 239 (2016). https://doi.org/10.1186/s13059-016-1103-0

• Plesivkova, Diana & Richards, Rebecca & Harbison, Sallyann. (2018). A reviewof the potential of the MinION™ single‐molecule sequencing system for forensicapplications. Wiley Interdisciplinary Reviews: Forensic Science. 10.1002/wfs2.1323.

• Lu H, Giordano F and Ning Z (2016): Oxford Nanopore MinION Sequencing and Genome Assembly. Genomics, proteomics & bioinformatics 14: 265-279.

• Tyler, A.D., Mataseje, L., Urfano, C.J. et al. Evaluation of Oxford Nanopore’sMinION Sequencing Device for Microbial Whole Genome SequencingApplications. Sci Rep 8, 10931 (2018). https://doi.org/10.1038/s41598-018-29334-5

Thank you for your attention.

Sabina.Purkrtova@vscht.cz

Milada.Sukova@vscht.cz

Created thanks to the support of the project: PIGA C1_VSCHT_2019_066