Accepted Manuscript

Title: Metal Ion Activated Lipase from Halotolerant Bacillussp. VITL8 Displays Broader Operational Range

Author: Lavanya Balaji Gurunathan Jayaraman

PII: S0141-8130(14)00222-0DOI: http://dx.doi.org/doi:10.1016/j.ijbiomac.2014.03.050Reference: BIOMAC 4262

To appear in: International Journal of Biological Macromolecules

Received date: 19-10-2013Revised date: 22-1-2014Accepted date: 26-3-2014

Please cite this article as: L. Balaji, G. Jayaraman, Metal Ion ActivatedLipase from Halotolerant Bacillus sp. VITL8 Displays Broader OperationalRange, International Journal of Biological Macromolecules (2014),http://dx.doi.org/10.1016/j.ijbiomac.2014.03.050

This is a PDF file of an unedited manuscript that has been accepted for publication.As a service to our customers we are providing this early version of the manuscript.The manuscript will undergo copyediting, typesetting, and review of the resulting proofbefore it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers thatapply to the journal pertain.

Page 1 of 30

Accep

ted

Man

uscr

ipt

1

Metal Ion Activated Lipase from Halotolerant Bacillus sp. VITL8 Displays Broader

Operational Range

Lavanya Balaji and Gurunathan Jayaraman*

School of Biosciences and Technology, VIT University, Vellore 632014, India

*Corresponding author: Gurunathan Jayaraman

Tel: +91 416 2202573; Fax: +91 416 2243092.

E-mail address: gjayaraman@vit.ac.in

Page 2 of 30

Accep

ted

Man

uscr

ipt

2

Abstract:

Lipase producing halo tolerant Bacillus sp. VITL8 was isolated from oil contaminated areas

of Vellore. The identity of the organism was established by 16S rDNA sequence, in addition

to the morphological and biochemical characterisation. The purified enzyme (22 kDa, 8,680

U/mg) exhibited optimal activity at pH 7.0 and 40˚C and retained more than 50% of its

activity in the NaCl concentration range of 0 - 3.0 M, pH 6.0 – 10.0 and 10 – 60 °C.

Secondary structure analysis, using circular dichroism, revealed that the enzyme is composed

of 38% α-helix and 29% β-turns. The lipase activity significantly increased in the presence

of (1mM) Mn2+ (139%), Ca2+ (134%) and Mg2+ (130%). Organic solvents such as butanol

and acetonitrile (25% v/v) enhanced the activity whereas DMSO (25% v/v) retained the

activity. The Km of enzyme - p-Nitrophenyl palmitate complex was determined to be 191

µM with a Vmax of 68 µM/mg/min. Though halotolerant Bacillus sp. has been explored for

hydrocarbon degradation, to our knowledge this is the first report on the lipase activity of the

isolate. The characteristics of the enzyme presented in this report, imply broader operational

range of the enzyme and therefore could be suitable for many of the industrial chemical

processes.

Keywords: Halotolerance; Bacillus spVITL8; Organic solvent

Page 3 of 30

Accep

ted

Man

uscr

ipt

3

1. Introduction:

Enzymes have emerged as the leading catalysts in the chemical industries as they are

environmental friendly, economical, clean and with proven potential for contributing to

multibillion dollar underexploited bio-industry [1]. Enzyme technology has been given

pivotal importance in many of the today’s modern biotechnology industries and deals with

the screening, production, isolation, purification and commercial use of enzyme for the

benefit of society. Cultivation and identification of new organisms from diverse

environments and screening of the isolated strains for desired catalytic activities are

inevitable to identify novel microbial enzymes [2]. Members of Bacillus genus are ubiquitous

and are known to produce a wide range of enzymes that have potential industrial applications.

Hence they continue to be dominant bacterial workhorses in microbial fermentation processes

[3, 4].

Lipases (triacylglycerol acylhydrolases, EC 3.1.1.3) represent a group of hydrolases

catalyzing the hydrolysis and synthesis of esters of glycerol and long chain fatty acids.

Microbial lipases constitute the most important group of biocatalysts for industrial

applications such as chemical, food, pharmaceutical, detergent, biopolymers, biodiesel and

others [5]. Microbial lipases have received a great deal of attention as biocatalysts due to

their greater yields, high safety in production, ease for genetic manipulation and

characteristics like stability, selectivity and broad substrate specificity [6,7]. Since there is an

increasing demand for lipases under extreme conditions (low or high temperatures, acidic or

alkaline solutions, high salt or organic solvents), the isolation of lipase from extremophiles

has become a challenging task in recent years [8,9,10].

Lipase have been characterized and purified from many Bacillus species such as B. subtilis,

B. pumilus, and few from thermophilic Bacillus [11]. However, the enzyme source is of

major importance in industry and its properties depend on the environmental conditions

surrounding the enzyme along with its producer [12, 13]. Since each application requires

unique enzymatic properties, especially with regard to specificity, stability, temperature and

pH dependence, to catalyse synthetic ester reactions, screening microorganisms with lipolytic

activities, with special reference to non-mesophilic conditions, can facilitate the discovery of

novel lipases for industrial purposes. Halophiles are the group of “salt loving”

microorganisms and can be subdivided as halotolerant if they can grow both in the presence

Page 4 of 30

Accep

ted

Man

uscr

ipt

4

and absence of salt [14]. Therefore, we embarked on screening for lipases produced by salt-

tolerant bacterium with the ability to be active under a wide spectrum of experimental

conditions. Therefore the aim of the study was to purify and investigate the biochemical

characteristics of lipase produced by the halotolerant Bacillus sp VITL8 strain, isolated from

soil contaminated with hydrocarbons.

2. Materials and methods

2.1 Chemicals and software

Medium components were obtained from Hi-Media, Bombay, India. p- Nitrophenyl palmitate

(pNPP) and Sephadex G – 100 were purchased from Sigma. Data analyses were performed

using Graph pad Prism version 5.0.

2.2 Sample collection and isolation of bacterial strain

Samples were collected from oil and hydrocarbon contaminated soils of oil refinery industries

situated in and around Vellore (12.9202° N, 79.1333° E) Tamil Nadu, India. Collected

samples were serially diluted in sterile water and the dilutions were placed on LB agar plates

with 3% sodium chloride and kept for incubation at 37˚C. Colonies were picked based on

their divergence in morphology, size and colour. Pure cultures of the isolates were

maintained on agar slants and were sub-cultured every 15 days.

2.3 Screening of lipase producing bacteria

Production of lipase(s) by the selected halotolerant bacterial strains was screened on LB agar

plates supplemented with 3% NaCl and 1% glyceroltributyrin. The plates were incubated for

48 hrs at 37˚C and the zone of clearance was observed due to the hydrolysis of tributyrin. The

lipase producing strains were selected based on clearance.

2.4 Enzyme assay and total protein determination

Organism was selected on the basis of units of enzyme produced in quantitative assay. The

activity was determined using 0.5 ml enzyme, 1 ml of 100 mM pNPP in 100 mM Tris buffer

(pH 8.0). The hydrolytic reaction was carried out at 37˚C for 10 min, after which 0.5 ml of

200 mM EDTA was added and absorbance was recorded at 410 nm [15]. One unit of lipase

activity is defined as the amount of enzyme which liberates 1 µmol p-nitrophenol from pNPP

as substrate per min under the assay conditions. The amount of protein present in the sample

Page 5 of 30

Accep

ted

Man

uscr

ipt

5

was estimated by the method of Lowry [16] using bovine serum albumin (BSA) as the

standard.

2.5 Identification of the bacterial strain

The identification of the isolate was done by standard procedure of Bergy’s Manual of

Determinative Bacteriology and by 16S rDNA sequence analysis. Genomic DNA was

extracted as per the standard protocol [17] and it was amplified by using universal primers of

16S rRNA gene: FP 5’GAGTTTGATCCTGGCTCAG 3’ (E.coli positions 8-27) and RP

5’ACGGCTACCTTGTTACGACTT3’ (E.coli positions 1494-1513). The PCR product was

amplified and sequenced by Chromous Biotech Pvt Ltd., (Chennai, India). Phylogenetic tree

was constructed with MEGA v5.04 using neighbour joining method with a bootstrap value of

1000 [18]. The gene sequence was submitted to GenBank (Accession no: JX436333.1)

2.6 Enzyme purification

All purification steps were performed at 10˚C. Cultures grown (36 hrs) at stationary phase

were centrifuged (10,000 x g) for 10 min and the cell free supernatant containing

extracellular lipases were further concentrated by using stirred cell (Amicon, MWC: 10 kDa).

The concentrate was further precipitated using different concentrations of ammonium

sulphate (20% - 80% w/v). The precipitate thus obtained was separated by centrifugation

(14000 x g) for 20 min and the supernatant was discarded. The dialyzed enzyme solution was

further purified with Sephadex G-100 (Sigma, USA) and the proteins were eluted (flow rate

0.5 ml/min) with 10 mM Tris buffer (pH 8.0). One ml fractions were collected and were

assayed both for lipase activity as well as total protein content (Absorption at 280 nm). The

fractions determined to be positive for the lipase were pooled, concentrated to a volume of

0.5 ml by using Amicon stirred cell (10 kDa Amicon nitrocellulose membrane) and assayed

for lipase activity to check the purification fold.

Purified lipase was loaded onto a C18 reverse phase column. Prior to loading, the column was

pre-equilibrated with water (containing 0.1% TFA). Protein was eluted from the column

using a linear gradient of 0% to 40% (v/v) acetonitrile with a flow rate of 1 ml/min. The

elution profile was monitored by the absorbance at 280 nm.

The purified protein was ionized and detected in a MS scan from 10kDa – 50kDa m/z on a

Thermo LCQ-Deca XP MAX mass spectrometer (proteomics facility IISc Bangalore).

Page 6 of 30

Accep

ted

Man

uscr

ipt

6

2.7 Native and Denaturing PAGE

Molecular weight of the enzyme was estimated by SDS-PAGE, on a vertical slab 15% (w/v)

polyacrylamide gel, at a constant voltage by comparing the relative mobility with markers

from 205 – 3.5 kDa (HiMedia, India). Native PAGE was performed using the discontinuous

gel system [19]. Native gel was rinsed three times with distilled water and was then

equilibrated in 50 mM Tris buffer (pH 8.0) for 15 min at 37˚C. The gel was then overlaid on

chromogenic substrate plate containing 1% (v/v) tributyrin, 0.01% phenol red, 1.8% agar and

0.1% CaCl2 at pH 8.0. The plate was incubated at 37˚C and the appearance of yellow band

was indicative for the presence of lipase.

2.8 Circular Dichorism (CD) spectroscopy

CD spectra were recorded using Jasco J715 spectropolarimeter. Spectra were recorded

between 190 and 260 nm (with an average of 10 accumulations) with 0.2 mg/ml protein

solution and 1 cm path length cuvette. The spectrum was corrected for buffer base line by

subtracting the blank spectra recorded without the protein. The CD data was expressed as

molar ellipticity in deg cm2 dmol-1. The spectrum was subjected to secondary-structure

analysis using three-component model reference spectra [20].

2.9 Effect of temperature and pH on enzyme activity

The optimum temperature for lipase activity was determined spectrophotometrically over a

temperature range of 20 - 70˚C with an incubation period of 15 min at pH 8.0.

The effect of pH on lipase activity was determined spectrophotometrically using the

following buffers: acetate buffer (pH 4.0 - 5.0), phosphate buffer (pH 6.0 - 7.0), Tris buffer

(pH 8.0 - 9.0) and glycine NaOH (10.0 - 12.0) with an incubation period of 15 min at 37˚C.

2.10 Effect of Organic solvent on enzyme activity

The enzyme activity was determined in the presence of various organic solvents (25% and

50% v/v) at 37˚C with an incubation period of 15 min. The organic solvents used were

methanol, isopropanol, dimethyl sulfoxide, acetonitrile, ethanol, butanol, hexane, and

acetone.

Page 7 of 30

Accep

ted

Man

uscr

ipt

7

2.11 Effect of different natural oils on enzyme activity

The substrate specificity of the enzyme was studied by titrimetry. The reaction was done in

20 ml Erlenmeyer flask. The substrates used were castor oil, coconut oil, groundnut oil, olive

oil, sunflower oil and palm oil. The reaction mixture was composed of 1% v/v of the above

substrate, 100mM Tris buffer pH 8.0 and 0.1 ml enzyme. The mixture was incubated at 37˚C

on rotary shaker at 150 rpm for 30 min. The reaction was terminated by addition of equal

volume of acetone-ethanol (1:1) mixture. The fatty acids liberated were estimated by titration

against 0.05 M NaOH.

2.12 Enzyme kinetics

The purified lipase was incubated with different concentrations of pNPP (0.05 – 1 mM

solution in isopropanol) using tris buffer pH 8.0 at 37˚C. The initial velocity data were

plotted as the function of the concentration of substrate by the linear transformation of the

Michaelis-Menten equation, and the resulting graph (Eadie – Hofstee plot) was used to

calculate the Km and Vmax of the reaction.

3. Results and discussion

3.1 Isolation and identification of lipase producing strains

Among the fifty-seven halotolerant bacterial isolates, 20 isolates were found to be producing

variable clearance in glycerol tributyrin agar plates. These isolates were used for quantitative

assessment for lipase production when supplemented with olive oil. Three strains, designated

as VITL8, VITL9 and VITL6 exhibited lipase activity greater than 100 U/ml at 48 hrs when

cultured in liquid medium (Table 1). Among the two media used for screening, minimal

media was chosen because of the low cost of raw materials for enzyme production. As the

isolate VITL8 was found to produce higher units of activity in both the medium used, it was

taken for further work.

Table 1

3.2 Morphological, biochemical and molecular characterization of isolate VITL8

Strain VITL8 is a Gram-positive, rod-shaped, strict aerobe, motile, endospore former,

predominantly occurring singly with positive catalase and oxidase activity. Growth occurred

with 0 – 10% (w/v) NaCl (optimally with 3%) at pH 8.0 with an optimal growth temperature

Page 8 of 30

Accep

ted

Man

uscr

ipt

8

of 37˚C. On account of morphological and biochemical characteristics, it was identified as

Bacillus sp. The nucleotide sequence (1494 b) of the 16S rDNA was determined and the

same is deposited in Genbank (Accession No: JX436333.1). Phylogenetic analysis (Fig. 1)

revealed that the strain VITL8 belonged to Bacillus sp cluster, involving B. subtilis,

B. vallismortis along with other unidentified species of Bacillus. The nucleotide sequence

was 98% identical with B. vallismortis and 97% with Bacillus subtilis and therefore the

present isolate could represent a new Bacillus species with a closer phylogenetic relation with

B. vallismortis and Bacillus subtilis and consequently the isolate was designated as Bacillus

sp. VITL8.

Figure 1

3.3 Growth Kinetics and Lipase Production by isolate VITL8

The growth (in M9 minimal media) and lipase production by Bacillus sp. VITL8 was

monitored over a period of 52 h. The specific growth rate of the organism was found to be 2.7

g/h with the generation time (Gt) of 22 min/gen. For most known bacteria that can be

cultured, generation time ranges from 15 min to 1 h [21]. It should be mentioned that the

lipase activity was linear during the first ten minutes of the reaction time. The maximum cell

growth of Bacillus sp VITL8 was obtained after 24 h (OD 600 nm = 2.1) of incubation, while

the maximum lipase production (136 U/mg) was observed only after 36 h of growth (Fig. 2).

However, beyond this time period there was a decline in cell growth as well as the enzyme

production. Similar growth behaviour has been reported for Bacillus megaterium AKG-1[22].

Maximal cell growth was observed at 20 h of incubation, and maximum lipase yield was

observed after 27 h of incubation.

Figure 2

3.4 Effect of salt concentration on lipase production and cell growth

The bacteria cultured at different NaCl concentration (0-10%) showed optimal growth in the

absence and in the presence of up to 3% NaCl concentration (Table 2). This characteristic

implies that the bacterial strain is halotolerant. Sufficient gain in the biomass was observed

even in the presence of 10% NaCl. However, there was a significant decrease (50%) in the

lipase activity. Gram positive moderate halophiles are often reported to exhibit reduced

enzyme production at high salt concentration in the range of 1 – 15%. Lipase from

Page 9 of 30

Accep

ted

Man

uscr

ipt

9

halotolerant strains such as Marinobacter, [14] and Burkholderia sp., [23], was found to have

optimal lipase activity in the NaCl concentration of 1.5%, 0.17% and 2% respectively, which

is in accordance with our results. Production of maximal lipase in the absence of NaCl is

reported by halotolerant Staphylococcus sp. [24].

Table 2

3.5 Enzyme purification

The culture supernatant was concentrated by membrane filtration using 10 kDa nitrocellulose

membrane followed by fractional ammonium sulphate precipitation. Maximum lipase was

recovered at 40% fractionation. This shows that the enzyme is highly lipophilic thus enabling

it to precipitate at lower concentrations of ammonium sulphate. The overall purification

process of VITL8 lipase is shown in Table 3. The activity of the enzyme after ammonium

sulphate precipitation was found to be 4,340 U/mg. The protein solution was then purified by

gel filtration chromatography. The purified active fraction obtained through gel filtration

showed a activity of 8,680 U/mg with a final purification fold of 44. Lipase from Bacillus

stearothermophilus HU1 [25], Bacillus pumilus RK31 [26] were also purified through

precipitation by 40% ammonium sulphate.

Table 3

3.6 Determination of homogeneity by electrophoresis and HPLC

The protein thus purified was subjected to SDS-PAGE and HPLC analysis. SDS-PAGE

showed a prominent single band (Fig. 3a) on staining with Coomasie Brilliant blue R250,

indicating homogeneity of the enzyme. The purity of lipase was further checked by using

reverse phase HPLC. Elution of lipase with a linear gradient of 0% to 40% (v/v) acetonitrile

revealed a sharp peak (detected at 280 nm), confirming the purity of the protein sample (data

not shown).

Figure 3

Page 10 of 30

Accep

ted

Man

uscr

ipt

10

The molecular mass of lipase as calculated from the SDS-PAGE was found to be ~ 22 kDa

using the relationship between relative mobility of the markers. The molecular weight of the

enzyme was further confirmed using MALDI – TOF analysis, which revealed a peak at m/z

21.64 kDa (Fig. 3c). Zymography carried out under native conditions using glycerol

tributyrin as substrate revealed a clear pale yellow hydrolytic zone of lipolytic activity against

a pink background (Fig 3b), confirming the presence of lipase in the fraction. The molecular

mass of lipase produced by several bacteria including Bacillus reported earlier ranges from

12 – 76 kDa. The lipase produced by Bacillus thermoleovorans CCR11 and Bacillus

thermoleovorans ID-1 is the smallest published lipase with a molecular mass of 11 kDa and

18 kDa respectively [27, 28].

3.7 CD spectroscopy

Circular dichroic spectra in the far UV region were recorded for Bacillus sp. VITL8 lipase

(Fig. 4). The spectra showed the characteristic double minima at 208 and 222 nm indicating

helix as the predominant secondary structure. Deconvolution of the spectra revealed the

presence of 38% α-helix and 28.5% β-turns in the enzyme. Majority of Bacillus lipases were

found to be predominantly α- helical with double minima at 208 and 222 nm [29, 30].

Bacillus sp., isolated by Fairolniza et al., was determined structurally to be 38.6% α- helix,

2.2% β- sheet and 35.6% random coil [31]. B. cepacia lipase isolated by Sohel Dalal et al.,

was found to have 52% α- helix, 7.7% β- sheet and 12.6% β- turn [32].

Figure 4

3.8 Effect of temperature on enzyme activity

The lipase showed optimum activity at 40˚C in the presence of 3% NaCl and enzyme

exhibited more than 50% of its maximal activity in the temperature range of 10-60˚C (Fig.5),

indicating its thermotolerant nature. The temperature optima for lipases from Bacillus subtilis

EH37 [33] and Bacillus smithii BTMS11 [4] was found to be 60˚C and 50˚C respectively.

VITL8 lipase is found to have temperature optima at 40˚C exhibiting 61% of its relative

activity at 60˚C.

Figure 5

3.9 Effect of pH on enzyme activity

Page 11 of 30

Accep

ted

Man

uscr

ipt

11

In the present study Bacillus sp., VITL8 lipase displayed optimal catalytic activity towards

pNPP in the slight alkaline region of pH 8.0 (Fig.6), although 50% activity was observed in

the pH range of 6.0 – 10.0. The optimum activities of the most of the bacterial lipases were

observed in the pH range of 6-8. VITL8 displayed activity over a wide range of pH values

ranging from 57% relative activity at pH6 to 60% relative activity at pH10. Since tolerance in

the alkaline range is observed this can be considered as a potential candidate for application

in process that are conducted in the alkaline range such as detergent application. These results

are in accordance with earlier reports of alkaline lipases of Bacillus strains, Bacillus smithii

BTMS11 [4] pH 7 – 9. High pH optima for lipase activity have also been reported in Bacillus

alkalophilus [34] pH 10, Bacillus sp., [35] pH of 10.5.

Figure 6

3.10 Effect of different metal ions on enzyme activity

The enzyme activity of Bacillus sp.VITL8 lipase was assayed in the presence of different

metal ions. The metal ions showed differential effects on the enzyme activity. The activity

increased in the presence of Mn2+, Ca2+ and Mg2+ (Fig. 7), of which Mn2+ exhibited the

maximal increase (39%) followed by Ca2+(33%) and Mg2+ (30%). Co2+, at lower

concentration (1mM), did not affect the activity of the enzyme, where as higher concentration

inhibited the enzyme activity. Ni2+, Fe2+, Hg2+ and Cu2+ had inhibitory effects on the enzyme

activity. Metal ion activation of enzymes is important in industrial applications for obtaining

maximal catalytic efficiency. Few of the metal ions are known to play a crucial role in

maintaining the active conformation of the enzyme [36]. Similar pattern of enhancement and

inhibition were reported for lipase purified from B. subtilis Pa2 [37]. Complete inhibition of

lipolytic activity of B. stearothermophilus MC7 lipase was observed with divalent ions of

heavy metals like Cu2+, Fe2+ and Zn2+ [38], B. coagulans BTS3 lipase activity was found to

be enhanced by K+, Fe3+ and Mg2+ and inhibited by Co2+, Mn2+ and Zn2+ [39]. The metal

content present in the enzyme solution was analysed using inductive coupled plasma atomic

emission spectrometry (ICP-ACS); the results obtained confirmed the presence of metal ions

Ca2+, Mn2+ and Mg2+, the enzyme contained 1.1 mol Ca2+, 1.1 mol Mg2+ and 0.025 mol Mn2+

ions per mol of enzyme. Salameh et al., has reported the presence of 1.02 mol Ca2+ and 0.066

mol Mn2+ ions per mol of enzyme from Geobacillus sp., [43].

Page 12 of 30

Accep

ted

Man

uscr

ipt

12

Figure 7

3.11 Effect of organic solvent on enzyme activity

An important characteristic of lipase used in industries, especially in green synthesis of lipids,

is that the enzyme must be stable and active in the presence of organic solvents. The effect of

organic solvents (25 and 50%) on Bacillus sp. VITL8 lipase activity was assayed (Fig. 8)

Treatment of VITL8 lipase with various organic solvents revealed that the enzyme displayed

substantial activity in the presence of a variety of water miscible organic solvents with a low

log P value (>2) tested. Interestingly, 25% acetonitrile and butanol enhanced lipase activity

by 25% and 20% respectively. Whangusuk et al., [40] has suggested that certain solvents

increase the solubility of the lipid substrate, thus facilitating the reaction. Moreover, it has

been reported that the solvent also keeps the active site of the enzyme in an open

conformation, thus maintaining the enzyme in a flexible conformation thereby enhancing its

activity [41]. A similar stimulatory effect of solvents was also observed for lipase isolated

from Proteus sp. Sw1 [40]. Enhancement of Aneurinibacillus HZ lipase activity was observed

in the presence of 25% (v/v) of DMSO (44%) and methanol (46%) respectively [42]. In the

presence of higher concentration (50%) of organic solvents, Bacillus sp. VITL8 lipase was

able to maintain the same activity equal to that of control but there was a decline in the

stability of the enzyme over a period of incubation (data not shown). The enzyme was found

to maintain the activity without any major change in the presence of 25% and 50% DMSO

and isopropanol. In addition, VITL8 lipase retained activities greater than 50% in the

presence of 25% (v/v) methanol, ethanol, hexane and acetone, indicating its tolerance with a

range of organic solvents.

Figure 8

3.12 Substrate specificity

It is observed that the lipase reported in this study is more active towards olive oil (OO) and

sunflower oil (SO), (Fig. 9) which contains large chain aliphatics. Lower hydrolysis was

found with coconut oil (CO) due to its high amount of short-chain fatty acids such as 47% of

lauric acid (C12:0) and 18% of myristic acid (C14:0). This shows that VITL8 lipase could

possibly be specific towards longer chain fatty acids. In addition, the hydrolysis of palm oil

(PO) was low, which contains 50% saturated fatty acids as compared to other natural oils.

The hydrolysis of castor oil (CaO) and groundnut oil (GO) was moderate which could be due

Page 13 of 30

Accep

ted

Man

uscr

ipt

13

to the presence of higher amounts of 85% of ricinoleic acid. Masomian et al [42], Bora et al

[35] and Leow et al [44] have reported significant differences in the catalytic activity in

hydrolysing the natural substrates.

Figure 9 and 10

3.12 Enzyme kinetics

The kinetic parameters, Km and Vmax, were determined for the enzyme with pNPP as the

substrate. Km and Vmax values were calculated from Eadie – Hofstee double reciprocal plot

(Fig.10). The plot is linear and indicate that hydrolysis of pNPP by the tested lipases followed

Michaelis – Menten kinetics. The enzyme was found to have a Km of 191 µM, and a Vmax of

68 µM /ml /min for hydrolysis of pNPP. Kambourova et al [38] has reported a lipase from

B.stearothermophilus that had a Km and Vmax value of 330 µM and 188µM/min/mg,

respectively, using pNPP as substrate. While Massadeh et al [25] has reported a lipase from

B.stearothermophilus HU1 that had a Km and Vmax value of 235 µM and 161.2 µM /min /mg

respectively.

4. Conclusion

For the first time, halotolerant Bacillus sp VITL8, isolated from hydrocarbon contaminated

soil, was found to produce lipase with high specific activity of 8,680 U/mg and to be active

over a range of pH (6.0 – 10.0) and temperature (10 – 60 °C) conditions. The enzyme

activity was found to be enhanced in the presence of the metal ions such as Ca2+, Mg2+ and

Mn2+ and in the presence of organic solvents such as acetonitrile and butanol. These

distinguishing features of the lipase indicate potential use of this enzyme in a variety of

industrial chemical process, including organic synthesis reactions.

5. Acknowledgements

B. Lavanya is a recipient of UGC-CSIR Fellowship (09/844(0010)/2012 EMR-I). The

research facility provided by the VIT University (Vellore, India) is gratefully acknowledged.

6. Reference:

Page 14 of 30

Accep

ted

Man

uscr

ipt

14

[1]. J.F. Lin, Q. Lin, J. Li, Z.A. Fei, X.R. Li, H. Xu, D.R Qiao, Y. Cao, African Journal of

Microbiology Research 16(2012) 3797-3806.

[2]. D. Wahler, J.L. Reymond, Current Opinion in Chemical Biology 5(2001) 152-158.

[3]. A. Heydari, M. Moosazadh Moghaddam, H. Aghamollaei, M. Yakhchali, B.

Bambaee, A. Latifi, New Cellular and Molecular Biotechnology Journal 3(2013) 67-

73.

[4]. V.P. Lailaja, M. Chandrasekaran, World Journal of Microbiology and Biotechnology

(2013)11274-11298.

[5]. K.E. Jaeger, T. Eggert, Current Opinion in Biotechnology 13(2002) 390 – 397.

[6]. F. Cardenas, M.S. Castro, J.M. Sanchez-Montero, J.V. Sinisterra, M. Valmaseda,

S.W. Elson, Enzyme and Microbial Technology 28(2001)145-54.

[7]. F. Hasan, A.A Shah, A. Hameed, Enzyme and Microbial Technology 39(2006) 235-

51.

[8]. M. Hess, M. Katzer, G. Antranikian, Extremophiles 12(2008)351–364.

[9]. L. Rao, X. Zhao, F. Pan, Y. Li, Y. Xue, Y. Ma, J.R. Lu, PLoS ONE 4:e6980 (2009).

[10]. R.A Khudary, R. Venkatachalam, M. Katzer, S. Elleuche, G. Antranikian,

Extremophiles 14(2010) 273–285.

[11]. H. Treichel, D. Oliveira, M. Mazutti, M. Luccio, J.V. Oliveira, Food and Bioprocess

Technology, 3(2010) 182-196.

[12]. P. Ranjitha, E. Karthy, A. Mohankumar, International Journal of Biology 1(2009) 48-

56.

[13]. A. Romdhane, Y. Fendri, A. Gargouri, H. Belghith, Biochemical Engineering Journal

53(2010) 112-120.

[14]. D. Perez, S. Martin, G. Fernandez-Lorente, M. Filice, J.M. Guisan, A. Ventosa, M.T.

Garcia, E. Mellado, PLoS ONE 6 (2011) 23325.

[15]. S. Sigurgisladottir, M. Kanarosdottir, A. Jonsson, J.K. Kristjansson, E. Mathiasson,

Biotechnology Letters 15(1993) 361-366.

[16]. O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, Journal of Biological

Chemistry 193(1951) 265-75.

[17]. T.G. Babu, P. Nithyanand, N.K.C. Babu, S.K. Pandian, World Journal of

Microbiology and Biotechnolgy 25(2009) 901–907.

[18]. P. Nithyanand, S.K. KaruthaPandian, FEMS Microbiology Ecology 69(2009) 384–

394.

Page 15 of 30

Accep

ted

Man

uscr

ipt

15

[19]. L. Ornstein, B.J. Davis, Annals of the New York Academy of sciences 121(1964)

321-349.

[20]. J.T. Yang, C.S. Wu, H.M. Martinez, Methods in Enzymology, 130(1986) 208-269.

[21]. K. Todar, Todar’s textbook of bacteriology, University of Wisconsin, Madison, 2002.

[22]. A.N. Sekhon, R.P. Dahiya, Tewari, G.S. Hoondal, Indian Journal of Biotechnolgy

5(2006) 179-183.

[23]. C.H. Liu, W.B. Lu, J.S. Chang, Process Biochemistry 41(2006) 1940-1944.

[24]. L. Daoud, J. Kamoun, M. Bou Ali, R. Jallouli, R. Bradai, T. Mechichi, Y. Gargouri,

Y. Ben Ali, A. Aloulou, International journal of biological macromolecules 3(2013)

232-237.

[25]. M. Massadeh, F. Sabra, R. Dajani, A. Arafat, International conference on eco-systems

and biological sciences (2012)5.

[26]. K. Rakesh, A. Sharma, A. Kumar, S. Deepak, World Applied Sciences Journal

7(2012)940-948.

[27]. D.W. Lee, H.K. Kim, K.W. Lee, B.C. Kim, A.C. Choe, H.S. Lee, Enzyme and

Microbial Technology 29(2001) 363-371.

[28]. D. Lelie, O. Castro, R.G. Citlali, V.A. Gerardo, O.R. Rosamaria, Enzyme and

Microbial Technology 37(2005) 648-654.

[29]. S. Kanaya, T. Koyanagi, E. Kanaya, Biochemical Journal, 332(1998)75-80.[30]. P. Acharya, N. Madhusudhan Rao, Journal of Protein chemistry, 22(2003)51-60.

[31]. M.S. Fairolniza, N.Z.R. Raja, M. Basri, A.B. Salleh, International Journal of

Molecular Sciences 12 (2011) 2917-2934.

[32]. E.H. Ahmed, T. Raghavendra, D. Madamwar, Applied Biochemistry and

Biotechnology 160(2010) 2102-2113.

[33]. D. Sohel, Pradeep kumar singh, S. Ragava, S. Rawat, Biotechnolgy and Applied

Biochemistry 51(2008) 23-31.

[34]. E.H. Ghanem, H.A. Al-Sayed, K.M. Saleh, World Journal of Microbiolgy and

Biotechnolgy 16(2000) 459-/64.

[35]. L. Bora, M. Bora, Brazilian journal of microbiology (2012) 30-42.

[36]. T. Pan, S. Lin, Journal of Chinese Biochemical Society 20(1991) 49-60.

[37]. K.R. Shah, S.A. Bhatt, Journal of Biochemical Technology 3(2011)292-295.

[38]. M. Kambourova, N. Kirilova, R. Mandeva, Journal of Molecular Catalysis B-

Enzymatic 22(2003) 307–313.

Page 16 of 30

Accep

ted

Man

uscr

ipt

16

[39]. S. Kumar, K. Kikon, A. Upadhyay, S.S. Kanwar, R. Gupta, Protein Expression and

Purification 41(2005) 38–44.

[40]. W. Whangusuk, P. Sungkeeree, S. Thiengmag, J. Kerdwong, R. Sallabhan, S. Mongkolsuk, S. Loprasert, Molecular Biotechnology, 53 (2013)55-62.

[41]. A.M. Klibanov, Nature, 409(2001)241-246.[42]. M. Masomian, R.N.Z.R.A Rahaman, A.B. Salleh, M. Basri, Process Biochemistry

48(2013)169-175.[43]. M. A. Salameh, J. Wiegel, Applied and Environmental Microbiology 73(2007) 7725-

7731.

[44]. T.C. Leow, R.N.Z.R.A. Rahaman, M. Basri, A.B. Salleh, Bioscience Biotechnology and Biochemistry 68(2004)96-103.

Page 17 of 30

Accep

ted

Man

uscr

ipt

17

Table 1 Lipolytic activities of positive lipase producing halotolerant bacteria in M9 minimal media (MM) and Luria Bertani media (LB) isolated from different oil contaminated sites of Tamil Nadu, India.

S. No Strain ID

Activity (U/ml) MM

Activity (U/ml) LB

1 L1 23.4±3.2 79.2± 2.92 L2 67.5±2.5 89.3±2.13 L3 12.3±1.2 34.7±1.34 L4 44.2±1.2 112.4±1.95 L5 23.5±2.1 72.6±2.46 L6 131.9±2.5 166.3 ±3.57 L7 5 .4± 1.2 17.4 ± 1.88 L8 180.3±3.1 210.2±2.99 L9 8.2±1.4 22.8±1.2

10 L10 58.2±2.1 92.7±2.611 L11 43.4±2.3 97.2±2.612 L12 22.6± 2.5 81.3±3.113 L13 37.6±2.1 78.9±2.414 L14 32.7±2.1 94.3±1.915 L15 12.2±1.6 40.1±1.416 L16 15.4±1.3 55.3±1.217 L17 9.7±1.9 41.3±1.618 L18 21.4±1.4 49.8±1.919 L19 36.3±2.4 52.5±2.620 L20 28.5±2.5 47.2±2.7

Page 18 of 30

Accep

ted

Man

uscr

ipt

18

Table 2 Effect of NaCl concentration on growth and lipase activity of Bacillus sp., VIT L8, The inoculum size for all NaCl concentrations was maintained constant as 1ml of 1.0 O.D @ 600 nm. The specific growth rate of the organism was 2.7g/h.

NaCl (%) Biomass @ 600 nm

Activity(U/ml)

0 2.34±0.10 242±3

3 2.31±0.09 218± 2

5 2.12±0.11 191± 1

10 2.0±0.07 111 ±3

12.5 1.54±0.12 64±5

15 1.01±0.14 7±2

Page 19 of 30

Accep

ted

Man

uscr

ipt

19

Table 3 Summary of purification scheme for extracellular lipase enzyme from Bacillus sp. VITL8

S.No Purification steps Totalvolume

(ml)

Activity (U/ml)

Protein conc

(mg/ml)

Specific activity (U/mg)

Purification fold

Recovery (%)

1 Crude enzyme 100 217 1.1 197 1.0 100

2 Ultra filtration (10kDa ) 25 780 3.95 821 4.2 90

3 (NH4)2SO4 (40%) 5 1953 0.45 4340 22.0 45

4 Sephadex G-100 1 1302 0.15 8680 44.0 6

Page 20 of 30

Accep

ted

Man

uscr

ipt

20

Legends to figures

Figure 1: Phylogenetic relationship of strain VITL8 isolated from soil samples of hydrocarbon contaminated sites. The tree is constructed using 16S rDNA gene sequence using Neighbour-joining method.

Figure 2: Growth curve and lipase activity profile of Bacillus sp., VITL8 in M9 minimal media containing 1% glucose and 1% olive oil as carbon source and 3% NaCl. (Temperature-37˚C, pH-8.0)

Figure 3: (a) SDS-PAGE: M - Markers 205 – 3 kDa, Lane 1- Crude (1 mg/ml), Lane 2 –Membrane filtration (3.2 mg/ml), Lane 3 – Ammonium sulphate precipitation (0.6 mg/ml), Lane 4 – Gel filtration chromatography (0.45 mg/ml). The numbers in brackets indicate the amount of total protein loaded. (b) Zymography of purified lipase from Bacillus sp., VITL8, (c) Peak at 21.64 m/z in MALDI- TOF confirming the molecular weight of purified lipase.

Figure 4: Far UV circular dichorism spectra of Bacillus sp., VITL8 lipase in 10mM Tris HCl buffer (pH 8.0) at 30˚C.

Figure 5: Effect of temperature on lipase activity. The optimum temperature was determined at pH 8.0 using pNPP as substrate.

Figure 6: Effect of pH on Bacillus sp., VITL8 lipase activity. The optimum pH was determined using pNPP as substrate (3mg/ml of isopropanol) in the following buffer systems: acetate buffer (pH 4-5), sodium phosphate buffer (pH 6-7), tris buffer (pH 8-9), and glycine-NaOH buffer (pH10-12).

Figure 7: Effect of different metal ions at 1mM and 5mM concentration on Bacillus sp., VITL8 lipase. Enzyme activity in the absence of metal ions was considered as control (100%).

Figure 8: Effect of various organic solvents on activity of purified lipase from Bacillus spVITL8. Samples were taken after incubation of enzyme with 25% (v/v) and 50% (v/v) of organic solvents after 15 min for the determination of lipase activity. ACN: acetone; BUT, butanol; IPA, isopropanol, DMSO, dimethyl sulfoxide; MeOH, methanol; EtOH, ethanol; HA, hexane; AcOH, acetone.

Figure 9: Effect of various natural oils on activity of lipase from Bacillus sp VITL8, PO: palm oil; CO: coconut oil; GO: groundnut oil; CaO: castor oil; OO: olive oil; SO: sunflower oil.

Figure 10: Kinetics of VITL8 lipase (a) - Eadie Hofstee Plot; (b) – Michaelis – Menton Plot: The plot was made from the results of lipase assay using different concentrations of pNPP as substrate.

Page 21 of 30

Accep

ted

Man

uscr

ipt

21

Fig. 1. Phylogenetic relationship of strain VITL8 isolated from soil samples of hydrocarbon contaminated sites. The tree is constructed using 16S rDNA gene sequence using Neighbour-joining method.

Page 22 of 30

Accep

ted

Man

uscr

ipt

22

0 8 16 24 32 40 48 560

50

100

150

200

0

1

2

3

Lipase Activity (U/mg)Biomass (OD@600nm)

Time (Hrs)

Lip

ase

Act

iviy

(U

/mg)

Bio

mas

s

Fig. 2. Growth curve and lipase activity profile of Bacillus sp., VITL8 in M9 minimal media containing 1% glucose and 1% olive oil as carbon source and 3% NaCl. (Temperature - 37˚C, pH-8.0)

Page 23 of 30

Accep

ted

Man

uscr

ipt

23

Fig. 3.(a) - SDS-PAGE Lane 1-Crude, Lane 2-Concentrate, Lane 3-Ammonium sulphate precipitation, Lane 4-Purified lipase. (b) - Zymography of

purified lipase from Bacillus sp., VITL8, (c) – Peak at 21.64 m/z in MALDI- TOF confirming the molecular weight of purified lipase.

c

Page 24 of 30

Accep

ted

Man

uscr

ipt

24

190 200 210 220 230 240-30000

-20000

-10000

0

10000

20000

30000

Wavelength (nm)

[ ](

deg

rees

.Cm

2.d

mol

-1)

Fig. 4. Far UV circular dichorism spectra of Bacillus sp., VITL8 lipase in 10mM Tris buffer (pH 8.0) at 30˚C.

Page 25 of 30

Accep

ted

Man

uscr

ipt

25

10 20 30 40 50 60 700

20

40

60

80

100

Temp (C)

Rel

ativ

e ac

tivi

ty (

%)

Fig. 5. Effect of temperature on lipase activity. The optimum temperature was determined at pH 8.0 using pNPP as substrate.

Page 26 of 30

Accep

ted

Man

uscr

ipt

26

Fig. 6. Effect of pH on Bacillus sp., VITL8 lipase activity, The optimum pH was determined using pNPP as substrate (3mg/ml of isopropanol) in the following buffer systems: acetate buffer (pH 4-5), sodium phosphate buffer (pH 6-7), tris buffer (pH 8-9), and glycine-NaOH buffer (pH 10-12).

5 6 7 8 9 10 11 120

50

100

pH

Rel

ativ

e ac

tivi

ty (

%)

Page 27 of 30

Accep

ted

Man

uscr

ipt

27

Mn2+ Mg2+ Ca2+ Co2+ Ni2+ Cu2+ Hg2+ K+0

50

100

150

1mM 5mMMetal ion conc(mM)

Rel

ativ

e ac

tivi

ty (

%)

Fig. 7. Effect of different metal ions at 1mM and 5mM concentration on Bacillus sp., VITL8 lipase. Enzyme activity in the absence of metal ions was considered as control (100%).

Page 28 of 30

Accep

ted

Man

uscr

ipt

28

ACN BUT IPA DMSO MeOH EtOH HA AcOH0

50

100

150

25% 50%

Organic solvents (%)

Rel

ativ

e ac

tivi

ty (

%)

Fig.8. Effect of various organic solvents on activity of purified lipase from Bacillus sp VITL8, Samples were taken after incubation of enzyme with 25% (v/v) and 50% (v/v) of organic solvents after 15 min for the determination of lipase activity. ACN: acetone; BUT, butanol; IPA, isopropanol, DMSO, dimethyl sulfoxide; MeOH, methanol; EtOH, ethanol; HA, hexane; AcOH, acetone.

Page 29 of 30

Accep

ted

Man

uscr

ipt

29

Fig.9. Effect of various natural oils on activity of lipase from Bacillus sp VITL8, PO: palm oil; CO: coconut oil; GO: groundnut oil; CaO: castor oil; OO: olive oil; SO: sunflower oil.

PO CO GO CaO OO SO0

5

10

15

20

Different natural oils

Lip

ase

Act

iviy

(U

/ml)

Page 30 of 30

Accep

ted

Man

uscr

ipt

30

Eadie-Hofstee Plot

0.0 0.1 0.2 0.30

20

40

60

(b)

V/[S]

V

0 500 10000

20

40

60

Michaelis - Menton Plot

Vmax

Km

Vmax/2

(a)

[S]x10-5 (M/ml)

V

Fig. 10. Kinetics of VITL8 lipase (a) - Michaelis – Menton Plot; (b) – Eadie Hofstee Plot: The plot was made from the results of lipase assay using different concentrations of pNPP as substrate.