Upload
akper-belitung
View
165
Download
5
Tags:
Embed Size (px)
Citation preview
Medical Journal of Indonesia
Vol 20, No 1 (2011): Vol. 20, Number 1, February 2011, pp 1 - 82
ISSN: 0853-1773
Table of Contents
Editorial
Editor’s note
Isnani A.S. Suryono, H.J. Fedi Freisleben 3
Basic Medical Research
Polyclonal VDAC3 antibody decreases human sperm motility: a novel approach to male contraception
Asmarinah ., Muhammad . I Saleh, Septelia I. Wanandi, Vanny Narita, Rita Damayanti, Nukman H.
Moeloek, H. Joachim Freisleben, Elvira Hinsch 5 - 10
Genetic polymorphism of merozoite surface protein-1 (MSP-1) block 2 allelic types in Plasmodium
falciparum fi eld isolates from mountain and coastal area in West Sumatera, Indonesia
Nuzulia Irawati 11 - 14
Effect of adipose tissue processing procedures in culture result: a study preliminary
Jeanne A. Pawitan, Arleni Bustami, Lia Damayanti, Radiana D. Antarianto, Ni M. Swantari 15 - 19
The metabolic effects of di (2-ethyl hexyl) phthalate medium dose on lipid profi les in serum and liver
tissue
Buang Y 20 - 26
Expression of manganese superoxide dismutase in rat blood, heart and brain during induced systemic
hypoxia
Septelia I Wanandi, Syarifah Dewi, Sri W. A. Jusman, Mohamad Sadikin 27 - 33
Pomegranate (Punica granatum L) powder reduced malondialdehyde (MDA) level in cigarette smoke
exposed rats
Francisca A Tjakradidjaja, Anita S Tjakradidjaja 34-39
Clinical Research
Anthropometric profi les of children with congenital heart disease
Damayanti R. Sjarif, Shirley L Anggriawan, Mulyadi M Djer 40 - 45
Dietary iron intake, serum ferritin and haemoglobin levels, and cognitive development scores of
infants aged 6–8 months
Dian Kusumadewi, Saptawati Bardosono, Rini Sekartini 46 - 49
Community Research
Highly active antiretroviral therapy adherence and its determinants in selected regions in Indonesia
Felix F. Widjaja, Caroline G Puspita, Ferdi Daud, Ienag Yudhistrie, Marita R Tiara, Christopher S Suwita,
Ekachaeryanti Zain, Lailatul Husna, Samsuridjal Djauzi 50 - 55
Access to health information may improve behavior in preventing Avian infl uenza among women
Ajeng T Endarti, Shamsul A Shah 56 - 61
Oral health related quality of life in Indonesian middle-aged and elderly women
Lindawati S Kusdhany, Yuliana Sundjaja, Sitti Fardaniah, Raden I Ismail 62-65
The level of Escherichia coli contamination in foods and drinks sold at canteens campus
Dewi Susanna, Tris Eryando, Yvonne M Indrawani 66 - 70
Review Articles
Iron defi ciency anemia in the elderly
Indra Kurniawan 71-77
ISSN: 0853-1773
Vol.20, No.1, Februari 2011
Editor’s note
Dear Colleagues, Greetings for a Happy New Year 2011! This year we are
in our 20th
year of paper version and entering the second
year for our electronic version of the Medical Journal of
Indonesia. Thank you for your collaboration, either as
readers, contributors, reviewers, or donators. We have so
many things to be thankful for. For one, we are happy to
inform you, that we have again gained for the next three
years, the accreditation from the Indonesian Directorate
General of Higher Education which is granted only to a
few prominent journals in every field of science in
Indonesia. To enhance the quality of our journal, internally we
have made several adjustments, we have gained
several young and therefore more energetic personnels
in our board of editors, and also our secretariat. Thus,
hopefully we will be able to better serve our readers
and researchers/writers in general. In this edition of MJI, we want to inform our readers to a
novelty, which is implemented from 2011. The Editorial
Board of MJI and the Faculty of Medicine Universitas
Indonesia as its Publisher on one hand, and the Board of
DIGM e.V. – both the Society’s German and Indonesian
Chapters and the Editorial Board of the Society’s
Scientific Journal on the other hand, have decided to
collaborate and merge DIGM Medical Journal with MJI. Some of our readers may immediately ask, what the heck
is DIGM e.V.? And what does it mean to merge the
Journals? Let us answer the first question first: DIGM
stands for “Deutsch-Indonesische Gesellschaft für
Medizin” or “German-Indonesian Medical Association”,
e.V. means “registered society”. The Society is
registered in Germany as well as in Indonesia, here as
“Perhimpunan Kedokteran Jerman-Indonesia”, and has
thus two Chapters with a total of over 300 members,
both in Indonesia and Germany. The presidents of the
German and the Indonesian Chapters are ex officio
automatically one of the two Vice-Presidents of the other
Chapter. Currently, Dr. med. Henry Naland is the
President of the Indonesian Chapter and Prof.
Dr.rer.med.habil. H.-J. Fedi Freisleben is the President of
the German Chapter. The Society’s goals and tasks are
the exchange and transfer of biomedical and clinical
knowledge and technology
Editor’s note 3 between Germany and Indonesia including the
training and exchange of physicians, clinical
specialists, and biomedical scientists. Secondly, we should clarify what it means for MJI and
for DIGM to cooperate. For MJI, it is advantageous for
its accreditation to cooperate with a professional society,
even better, if it is an International Society. For DIGM
Medical Journal, it is advantageous because it is always
difficult to receive sufficient numbers of scientific
articles from the environment of its own society in order
to appear regularly and periodically. Thirdly, what does it mean to merge the Journals? For
MJI, it means that there will be additional articles from
DIGM members, for the next edition, we have already
two articles, one of them is a case report from Germany
and Indonesia, the other one is from the hospital in Bad
Oeynhausen, which has been wellknown in Indonesia,
because several prominent Indonesians have been
operated there by the former President of the German
Chapter of DIGM, Prof.Dr.med. Rainer Körfer, and
dozens of young Indonesian physicians have been
trained there for their professional specialisation. For
DIGM Medical Journal it is advantageous to merge with
MJI mainly for the above mentioned reasons, and in
addition, articles from DIGM members will be read in
wider-spread distribution. Included into the Scientific Advisory Board of DIGM is
also the Editorial Board of DIGM Medical Journal. The
current Editor-in-Chief, Dr. med. Abraham Simatupang
from Universitas Kristen Indonesia, becomes a member
of the Editorial Board of MJI and Prof. Dr. H.-J. Fedi
Freisleben has already been a member of the Editorial
Advisory Boards of both Journals. Further members of
DIGM e.V. are also in the International Advisory Board
of MJI, Prof. Dr. med. Markus Meyer and Dr. Thomas
Müller. The Vice-President of the German Chapter, Prof.
Dr. med. Ulrike Blum will follow, soon. Last but not least, we do hope that this joint Medical
Journal of Indonesia will be beneficial to the most
important party in the whole scenario: OUR
HONORABLE READERS! Jakarta, February, 2011. Isnani A.S. Suryono H.J. Fedi Freisleben Editor-in-Chief President of DIGM e.V Correspondence email to: [email protected] hj.freisleben@t-
online.de
Vol. 20, No. 1, February 2011 VDAC3 antibody decreases sperm motility 5
Polyclonal VDAC3 antibody decreases human sperm motility: a novel
approach to male contraception Asmarinah,
1 Muhammad I. Saleh,
2 Septelia I. Wanandi,
3 Vanny Narita,
4 Rita Damayanti,
4 Nukman H.
Moeloek,1 H.-Joachim Freisleben,
2 Elvira Hinsch
5 1 Department of Medical Biology, Faculty of Medicine, University of Indonesia
2 Postgraduate Program Biomedical Sciences, Faculty of Medicine, University of Indonesia
3 Department of Biochemistry, Faculty of Medicine, University of Indonesia
4 Center of Pharmaceutical and Medical Technology, Agency for the Advancement and Application of Technology, Jakarta, Indonesia
5 Department of Urology, Pediatric Urology and Andrology, Faculty of Medicine, University of Giessen, Germany
Abstrak
Latar belakang: Voltage dependent anion channel (VDAC) merupakan protein spesifik yang memperantarai
transport anion, kation dan ATP dan berperan penting pada motilitas sperma. Penelitian ini bertujuan
mengevaluasi pengaruh antibody VDAC3 poliklonal terhadap motilitas sperma manusia. Metode: Antibodi VDAC3 poliklonal diproduksi dengan mengimunisasi kelinci dengan peptid sintetik spesifik VDAC3. Serum
kelinci sebelum diimunisasi dikoleksi menjadi preimunserum untuk kontrol percobaan. Pengenalan antiserum VDAC3 yang
diproduksi terhadap antigen VDAC3 pada sperma dilakukan dengan menggunakan metode western blot. Sperma dengan motilitas
baik dari 30 pria fertile dicuci dan diisolasi dengan menggunakan metode Percoll gradient. Evaluasi pengaruh antibody VDAC3
terhadap motilitas sperma dilakukan dengan mengukur kecepatan gerak sperma (detik/0,1 mm) dan menghitung jumlah sperma
tidak bergerak (juta/ml) pada 0 menit, 30 menit, 60 menit setelah penambahan antiserum dan preimunserum. Data kecepatan
sperma dan jumlah sperma tidak bergerak dianalisis dengan mengunakan program statistic SPSS 13.0. Hasil: Antiserum VDAC3 dapat mengenali protein VDAC3 pada sperma dan dapat meningkatkan jumlah sperma tidak
bergerak setelah 60 menit secara bermakna dibandingkan preimunserum. Kecepatan gerak sperma menurun secara
bermakna setelah penambahan antiserum VDAC3 pada menit ke 0, 30 dan 60 dibandingkan dengan preimunserum. Kesimpulan: Antiserum VDAC3 poliklonal dapat menurunkan motilitas sperma manusia, sehingga diharapkan
dapat dikembangan untuk vaksin kontrasepsi pria di masa dating. (Med J Indones 2011; 20:5-10)
Abstract
Background: Voltage dependent anion channels (VDAC) mediate transport of anions, cations and ATP which play an important
role in sperm motility. This study was aimed to examine the effect of polyclonal VDAC3 antiserum to human sperm motility. Methods: Polyclonal VDAC3 antiserum used in this study was produced in rabbits by immunization of VDAC3-specific synthetic peptides. Preimmunserum was collected before immunization and used for control experiment. Recognition of VDAC3 antiserum to antigen in human sperm was performed by western blot. Thirty sperm samples obtained from fertile men which had high quality of sperm motility were washed and collected by Percoll gradient. Sperm motility was assessed by means of evaluation of sperm velocity (seconds per 0.1 mm distance) and the number of unmoved sperm (million per ml) which were observed 0 minute, 30 minutes and 60 minutes after addition of VDAC3 antiserum and preimmunserum as a control. Both data were analyzed by SPSS 13.0 software. Results: VDAC3 antiserum recognized VDAC3 protein in human sperm. Statistical analysis demonstrated that there were
increasing numbers of unmoved spermatozoa after addition of anti-VDAC3 antiserum in vitro for 60 minutes observation
compared with preimmunserum (control). We found also that sperm velocity decreased significantly after giving anti-
VDAC3 antiserum in vitro for 0 minute, 30 minutes, and 60 minutes compared with pre-immunee serum (control). Conclusion: VDAC3 antiserum can decrease motility of human sperm. and may provide a novel principle of male
contraception in the future. (Med J Indones 2011; 20:5-10) Key words: VDAC3 antiserum, sperm, motility, contraception
The rate of world population growth especially in
developing countries is presently still high. Family planning
through use of contraceptive methods for couples is
proposed in many developing countries to suppress growth of the population. Traditionally, most of contraceptive
methods have been targeted to women. The numbers of
contraceptive methods for men are limited to condom
and vasectomy, both of which have their limitations.1
Development of new satisfactory male contraceptive
methods is needed to provide alternatives that might
aim to encourage men to actively participate in
successful family planning. There are several target
approaches to develop male contraceptive methods,
such as hormonal approach, control of epididymal
function as well as nonhormonal and post-testicular
approaches. One of post-testicular approaches for the Correspondence email to: [email protected]
6 Asmarinah et al. Med J Indones
development of male contraception methods is anti-
spermatozoal immunocontraception: antibodies
against sperm-specific protein may be potential
candidates for immunocontraception.2
Voltage Dependent Anion Channels (VDACs) also
known as porins are pore-forming 30-35 kDa proteins
abundant in the outer mitochondrial membrane and also
found in plasma membrane of eukaryotes. There are
three different VDAC genes encoding distinct isoforms
in mammals, i.e. VDAC1, VDAC2 and VDAC3. Each of
these proteins is highly conserved in human, rat and
mouse.3 They mediate transportation of anions, cations
(Ca2+
), ATP, and metabolites between mitochondria and
other intra- and extra-cellular compartments.4-6
A knock-out mouse study with deletion of the last four
exons (i.e. exons 5, 6, 7 and 8) of mouse VDAC3
demonstrated that mutant male mice were healthy, but
infertile. The mutant mice had normal sperm counts, but
low sperm motility compared to that of wild type mice.
In sperm flagella of the knock-out mice, structural
defects were observed.7 Our genetic studies on human
VDAC3 gene of asthenozoospermic patients brought
evidence to raise the hypotheses that about 50% of these
patients exert various mutations in the last 4 exons of
hVDAC3 gene and that these mutations can cause the
observed asthenozoospermia.8,9
It has been reported that VDACs are found in bovine
testis and sperm flagellum as well as in the acrosomal
region of bovine sperm head. VDAC2 was found in the
acrosomal region of the bovine sperm head.10,11
Anti-
VDAC antibodies against VDAC isoforms structurally
and functionally lead to surface alterations of the sperm
head with a loss of the acrosomal cap, to coiled sperm
tails and sperm cell volume disturbances.12
The aim of this study was to examine the effect of
anti-VDAC3 polyclonal antibody produced in our
own lab on human sperm motility. METHODS Production of anti-VDAC3 polyclonal antibody Polyclonal anti-VDAC3 antiserum used in this study was
collected from rabbits after five times every ten days
(AS1R2) sub-cutaneous injection of a VDAC3 synthetic
peptide of ten amino acids (SVFNKGYGFM). This
procedure was followed by 30 days wash out of the
immunization (AS2R2) and four times every ten
days injection after the end of the wash out period
(AS3R2). We also took the serum before the injection
(preimmunserum) as control. Immunization with the
synthetic peptide was carried out after conjugation with
keyhole lemphet hemocyanin (KLH) and glutaraldehyde
using modified Single-Step coupling method.13
The
specificity of anti-VDAC3 antiserum to recognize its
antigen was analyzed by ELISA method using ABTS
peroxide substrate system (KPL, Netherland). Evaluation of the presence of VDAC3 protein in
human sperm Human normozoospermic sperm was isolated by Percoll
gradient (90% and 45%) centrifugation method in
Cramer medium. Sperm pellet residing in 90 % Percoll
solution was collected and subsequently the extraction of
total protein in the sperm was accomplished using 2%
triton-100 solution containing protease inhibitor
cocktail.10
Protein extract from sperm was
electrophorised in SDS polyacrylamide gel
electrophoresis (SDS-PAGE) consisting of 6% stacking
and 12% separation gel. Electrophoresis was carried out
at 200 mV for 45 minutes. Subsequently, the separated
proteins were transferred from the electrophoresis gel to
nitrocellulose membrane at 70 mV in 90 min time. The presence of VDAC3 protein in human sperm was
determined by immune blot method using the produced
VDAC3 antiserum (AS3) and protein A – HRP (Sigma,
USA) as a second antibody. VDAC3 protein was then
detected with ECL chemiluminescence (Amersham,
USA) and exposed to X-ray film (Fuji, Japan).
Evaluation of the effect of VDAC3 antiserum on
the motility of human sperm Sperm samples were obtained from 30 fertile men
with high quality of sperm motility
(normozoospermia). Sperm analysis profile is depicted
in Table 1. Spermatozoa of high quality sperm
motility were isolated by “swim-up” procedure in
Cramer medium. The concentration of sperm samples
was adjusted to 50 million spermatozoa per ml. Sperm motility in this study was assessed blindly by
means of evaluation of sperm velocity (seconds per 0.1
mm distance in improved Neubauer chamber) and the
number of unmoved sperm (million per ml) which were
observed under light microscope at 0, 30 and 60 minutes
after addition of anti-VDAC3 antiserum (AS3R2) and
preimmunserum (S0R2) as a control, respectively,
Vol. 20, No. 1, February 2011 VDAC3 antibody decreases sperm motility 7
with 1:1 of dilution volume between antibody and sperm
solution. Data from sperm velocity and number of
unmoved sperm evaluation both from VDAC3
antiserum-treated samples and preimmunserum-treated Table 1. Assessment of motility parameters of spermatozoa
samples was analyzed statistically with Saphiro-Wilk,
Levene, Mann-Whitney, or T-Test using SPSS 13.0
software (P < 0.05).
No. Total amount of sperm Motility of sperm
Rapid progressive Slow or sluggish progressive No progressive
Samples (million per ejaculate) Immotility (%)
motility (%) motility (%) motility (%)
1 168 5 43 17 35
2 161 5 40 10 45
3 210 17 43 10 30
4 177 11 43 21 25
5 60 8 43 17 32
6 75 5 73 7 15
7 227 5 64 16 15
8 120 10 65 15 10
9 70 10 70 13 7
10 276 5 60 15 20
11 76 10 55 15 20
12 134 8 42 17 33
13 224 8 43 18 31
14 207 7 44 17 32
15 381 9 42 18 31
16 232 9 43 17 31
17 429 6 43 16 35
18 224 7 44 26 23
19 390 12 42 20 26
20 306 10 42 18 30
21 130 8 43 16 33
22 126 9 43 17 31
23 156 14 50 16 20
24 66 10 37 23 30
25 432 10 41 17 32
26 63 7 42 14 37
27 119 8 42 20 30
28 60 8 43 21 28
29 204 6 44 23 27
30 108 10 40 21 29
RESULTS Anti-VDAC3 antiserum produced against the
synthetic 10 amino acid peptide- analogue of VDAC3
protein revealed its antigenic activity by ELISA
method at different dilution levels. The profile of the
antibody ELISA titer is displayed in Figure 1. The
absorbance value of the preimmunserum in the ELISA
reader system was 0.1495 at 1:100 dilution. By using western and immune blot methods, the
presence of VDAC3 protein in human sperm could be
detected as a band in the molecurar weight range of
about 30 kDa. No positive reaction could be detected
in the sperm protein extract with ELISA method using
preimmunserum (Fig. 2). The measurement of the velocity of sperm motility
immediately after addition (0 min) of the VDAC3
antiserum (AS3R2) or at incubation times of 30 and
60 minutes demonstrated that the required time
(seconds) of sperm to reach 0.1 mm distance increased
significantly as compared to preimmunserum
treatment (Fig. 3). The differences in seconds required
to reach 0.1 mm distance increased with duration of
incubation: 0.28 sec at 0 min < 0.32 sec at 30 min <
0.44 sec at 60 min (values of antiserum-incubated
samples minus values of preimmunserum-incubated
samples from the table in Fig. 3). The number of unmoved sperm 60 min after addition
of VDAC3 antiserum increased also significantly as
compared to the incubation with preimmunserum,
while the number of unmoved sperm at 0 and 30
minutes was not significantly different (Fig. 4).
Vol. 20, No. 1, February 2011 Genetic polymorphism of merozoit surface protein 11
Genetic polymorphism of merozoite surface protein-1 (MSP-1) block 2
allelic types in Plasmodium falciparum field isolates from mountain and
coastal area in West Sumatera, Indonesia Nuzulia Irawati Department of Parasitology, Medical Faculty of Andalas University, Padang, Indonesia
Abstrak
Latar belakang: Sampel P. falciparum dari lapangan dapat menampilkan bentuk dan jenis yang bervariasi.
Penelitian ini bertujuan mengetahui keragaman alel MSP-1 blok 2 isolat P. falciparum yang berasal dari daerah
pegunungan dan daerah pantai Sumatera Barat, Indonesia dan membandingkan keberadaan jenis-jenis alel dari
kedua daerah pegunungan dan pantai. Metode: 56 sampel darah yang terinfeksi P. falciparum, diperoleh dari 27 penderita yang berobat pada Puskesmas
di Kabupaten Solok Selatan yang merupakan daerah pegunungan dan 29 penderita yang datang berobat pada
Puskesmas dari daerah pantai di kabupaten Pesisir Selatan, Sumatera Barat, Indonesia. Daerah-daerah yang
mengapit sifat-sifat yang sangat polimorfik, blok 2 MSP-1, ditentukan genotipnya melalui allele-specific nested PCR
guna menganalisa populasi kepadatan parasit. Analisis urutan daerah-daerah polimorfik dari MSP-1 juga
dilakukan untuk mengidentifikasi keanekaragaman alel di dalam populasi parasit. Hasil: Polimorfisme alel yang beranekaragam dari MSP-1 diidentifikasi pada isolat P. falciparum dari suatu
daerah pegunungan dan daerah pantai di Sumatera Barat, Indonesia, dan kebanyakan infeksi ditemukan berupa
infeksi campuran. Analisa urutan MSP-1 blok 2 mengungkapkan bahwa teridentifikasi 16 alel berbeda untuk MSP-1
(3 untuk tipe K1, 2 untuk tipe MAD20 dan 2 untuk tipe RO33). Kesimpulan: Dari isolat lapangan P. falciparum yang dikumpulkan dari suatu daerah pegunungan dan daerah
pantai di Sumatera Barat teridentifikasi polimorfifme genetik yang luas. Juga ditemukan tingkat infeksi campuran
yang tinggi, sebagai derajat kemajemukan infeksi yang tinggi. (Med J Indones 2011; 20:11-4)
Abstract
Background: The field isolates of P. falciparum may display variant forms and different frequencies. This study
was designed to know the diversity of allelic type of MSP-1 block 2 among P. falciparum isolates collected in a
mountain and a coastal area in West Sumatera, Indonesia, and compare mountain and coastal area. Methods: A total of 56 P. falciparum infected blood samples, collected from 27 patients attending local health facilities in
South Solok district in a mountain region and 29 patients attending a local health facilities in South Coastal district region,
West Sumatera, Indonesia were used in this study. The regions flanking the highly polymorphic characters, block 2 for
MSP-1, were genotyped by allele-specific nested-PCR to analyse the population diversity of parasite. Sequence analysis of
the polymorphic regions of MSP-1 was also conducted to identify allelic diversity in the parasite population. Results: Diverse allelic polymorphism of MSP-1 was identified in P. falciparum isolates from a mountain area and
a coastal area in West Sumatera, Indonesia, and most of the infections were determined to be mixed infections.
Sequence analysis of MSP-1 block 2 revelaled that 16 different alleles for MSP-1 (3 for K1 type, 2 for MAD20 type
and 2 for RO33 type) were identified. Conclusion: Extensive genetic polymorphism with diverse allele type was identified in MSP-1 in P. falciparum
field isolates from a mountain and a coastal area. A high level of mixed infections was also obcserved, as was a high
degree of multiplicity of infection. (Med J Indones 2011; 20:11-4) Key words: allelic types, coastal area, mountain area, MSP-1 block 2, Plasmodium falciparum
Genetic diversity displayed by P. falciparum field
isolates, the occurence of variant forms of parasite at
different frequencies in different geographic areas, and
the complexity of infection represent major obstacles
for the effective control of malaria. The propagation of
multi-drug resistant parasites and insecticide-resistant
mosquitoes has led to major difficulties in controlling
the spread of malaria. To fight against malaria, an
effective vaccine is urgently needed.1,2
A number of
antigens expressed at different stages of parasite’s life cycle
have been characterized with respect to their use in vaccine
development against P. falciparum. Merozoite surface
protein-1 (MSP-1) is one of the most promising vaccine
candidates.3 People naturally exposed to P. falciparum
develop antibodies against MSP-1. Further-more, an
association between a naturally acquired immune response
to MSP-1 and reduced malaria morbidity has been
observed. In a number of independent studies, Correspondence email to: [email protected]
12 Irawati Med J Indones
immunization with purified native MSP-1 or a recombinant
fragment of protein has induced at least partial protection
against parasite challenge. Sequence comparisons showed
that the entire MSP-1 gene could be divided into 17 blocks
that are vaiable, conserved, or semiconserved.4 In seven
blocks 1,3,5,12, and 17, the sequences are conserved. In
seven blocks (blocks 2,4,6,8,10, 14, and 16), the sequence
show extensive diversity, while in the remaining (blocks
7,9,11,13, and 15), the sequence are
semiconserved.Variation in sequences of variable regions
are dimorphic (K1/Wellcome or MAD20) in nature with the
exception of the trimorphic– encoding region in block-2,
which has a third version (RO33) found in natural isolates.5,6
Naturally acquired antibodies react more frequently against
variable rather than conservedMSP_1 blocks and are
specific for one of the major version of variable blocks.7
In the current study, we have analyzed polymerase
chain reaction (PCR)-amplified fragments containing
variable blocks 2,4, and 12-16 of the MSP-1 gene in
the P. falciparum natural population and allelic types
were scored by sampling allele-specific radio-labeled
olingonuclotide probes. The allelic types were
compared among the isolates collected from regions
of hyperendemic malaria transmission (RHEMT) and
mesoendemic malaria transmission (RMEMT).8,9
We
have also analyzed the allelic diversity in the isolation
showing more than strain of parasites. METHODS Clinical samples The study was conducted in South Solok district, a
area located in Bukit Barisan Mountain and in Pesisir
Selatan, a area located in west coastal in West
Sumatera province, Indonesia. The area has a farming
of cocoa and sawit coconut in South Solok and
majority was the fishing community in Pesisir selatan.
All area is infested a primary vector, Anopheles
balabacensis in South Solok and Anopheles sundaicus
in Pesisir Selatan and is characterized by high altitude,
relative high humidity, constant rain, and an average
of temperature 23oC, in South Solok, and coastal area,
relative high humidity, constant rain, and an average
of temperature 30oC in Pesisir Selatan. The analyzed
samples were collected during an outbreak in which
the prevalence of malaria was 60%, measured as the
percentage of people with parasites among those who
presented with malaria symptoms at a health service.
The samples was collected by finger puncture in the form of
thick smears on slides. The slides were stained with
Giemsa, and the presence of P. falciparum was detected
under microscopic observation. The slides were then sent to
the Medical Faculty, Andalas University in Padang, and
parasitemia was determined and normalixed for 100
leukocytes. This information was converted into the number
of parasites per microliter, assuming a leucocyte count of
8,000/µL. To prepare DNA of the clinical samples, the thick
smear, moistened previously with 1% saponin, the
incubated for one hour at 4oC. The sample was centrifuged
at 12,000 xg for five minutes, and the supernatant
discarded. The precipitate was resuspended in 40 µL of
Chelex-100 5% and boiled for 10 minutes. Finally the
sample was centrifuged at 12,000xg for five minutes, and
the supernatant was recovered and stored at 4oC.
10,11 We
used 8 µL of the extract to amplify the MSP-1 gene through
polymerase cian reaction (PCR). The first amplification were used as a template for
respective nested PCR assays. We took 5 µL to
identify the allotypes in block 2 of MSP-1. Allotype detection in block 2 of MSP-1 In the PCR-based amplification for MSP1 gene and the
nested PCR to identify the allotypes in block 2 of this
gene, we used an amplification profile with an initial
denaturation at 94oC/2 min followed by 72
oC/2 min, time
during which the Taq DNA Polymerase enzyme was
added. Then, 35 cycles at 94oC/30 sec, 55
oC/30 sec, and
72oC/2 min were performed, ending with a final
extension at 72oC/2 min. The following primers were
used in amplifying the MSP1 gene: OK11 )5’ TAG AAG
ATG CAG TAT TGA CAG GTT A 3’) and OK12 (5’
ATT CTA ATT CAA GTG GAT CAG TAA ATA A 3’).
To define the allele present in block 2 of the MSP-1
gene, the primers OK1 (CTT AAA TGA AGA AGA
AAT TAC TAC AAA AGG TGC 3’) and OK2 (5’ GAG
GGC TTG CAC CAG ATG AAG T 3’) were used for
the K1 allelic type. The primers OK3 (5’ GTA TTA
AAT GAA GGA ACA AGT GGA ACA 3’)and OK4 (5’
TAT CTG AAG GAT TTG TAC GTC TTG AAT T 3’)
were used to typify the MAD20 allotype. The primers
Primer-primer OK5(5’ ATT AAA GGA TGG AGC
AAA TAC TCA AFT TGT 3’ and OK6 (5’ TC GAA
GGA TTT GCA GCA CCT GGA GA 3’) were used to
amplify the RO33 allelic type. Both the primary and the
nmested PCR were conducted in a final volume of 50 µL,
using 200 µM of each dNTP, 1 µM of each primer, 2,5 U
of TaqDNA polymerase (Promega) per reaction and
1,mM of MgCl2 in the enzyme buffer (50 mM KCl, 10
mM Tris-HCl, pH 9.0, 0,1% Triton x100).
Vol. 20, No. 1, February 2011
Allelic distribution and complexity of infection The prevalence of each allelic type analyzed was
determined as the percentage of PCR fragments for the
type in the total number of amplified bands for the
corresponding locus. The complexity of infection, which
is the average number of PCR bands per infected
individual, was determined as described earlier. The
percentage for type and complexity of infection were
calculated independently for each genetic marker. RESULTS Of 56 samples analyzed from mountain area and
coastal area, the endemic area in West Sumatera result
in MSP1 was 14 peoples respectively. Genetic
diversity was analyzed through PCR amplification of
polymorphic regions in MSP1 gene. The three
previously reported allelic types were found in block 2
of MSP1 from 28 samples were K1, MAD20, and
RO33 type with the result as following: (Table 1) Table 1. The result of the allelic amplification K1, MAD20, and
RO33 of MSP1 gene of P. falciparum in mountain area and coastal area.
Combined allelic types Mountain area Coastal area K1 0 2 MAD20 0 0 RO33 0 1 K1,MAD20 3 7 K1,RO33 0 0 MAD20,RO33 1 0 K1, MAD20, RO33 10 4 Total 14 14
These types were established on the basis of differences
in size observed through electrophoresis and showed
respective sizes of 99-147 bp, 110-136 bp, and 99-120
bp of K1, MAD20, and RO33 respectively. The allelic
most often present in the parasite population of the
samples in mountain area studied was MAD20, with the
frequency of 36.84% ( 14 of 38), K1 34.21% (13 of 38),
and RO33 28.94% (11 of 38). Similarly, the allelic most
often present in the parasite population of the samples in
coastal area studied was K1, with the frequency of
44.8% ( 13 of 29), MAD20 37.93% (11 of 29), and
RO33 17.24% (5 of 29). Table 2. Distribution of fragments length of K1 allele types
Located K1
99 bp 120 bp 147 bp total
Mountain area 3 3 5 11
Coastal area 3 4 6 13
Genetic polymorphism of merozoit surface protein 13
Table 3. Distribution of fragments length of MAD20 allele types
Located MAD20
110bp 136bp total
Mountain area 6 7 13
Coastal area 5 6 11
Table 4 Distribution of fragments length of RO33 allele types
Located RO33
99 bp 120 bp total Mountain area 6 5 11 Coastal area 5 - 5
DISCUSSION The structure of natural P. falciparum population plays a
highly important role in the natural acquisition of immunity
in malarial infection. Knowledge of this structure is
necessary to develop strategies to control the disease,
beginning with the design of effective vaccines against P.
falciparum and including policy on the use of antimalarial
medicines. We analyzed the genetic diversity of P.
falciparum isolates collected in mountain endemic area and
in coastal endemic area in West Sumatera, Indonesia for
malaria but one where there is no permanent transmission of
the parasite, as in certain African zones. From the result was known that there were three
infection combinations in mountain area and four
infection combinations in coastal area. This condition
may be caused by both these study areas were the open
areas for all the comers and result in chance to occur
mutation to P. falciparum infection is very large that is
genetic recombination and variable result. Although the
mountain and the coastal area in West Sumatera is the
low endemic area, in Sumatera allelic variation is highly.
This is much the same to result obtained ih other region,
such as Thailand12
and Senegal.13
The presence of novel
variation is due to transmigration from other island in
Indonesia to Sumatrera terrestrial is the important issue. In this study is also found amount balance of K-type
allele, MAD20-type allele, and RO33-type allele in
their frequency. This condition is proven with other
regions having geographical isolation. For example,
the studies by Diana Gomez only find MAD20 and K-
tyoe alleles, by fragment variance is restricted.
Because there are in isolation areas in Colombia.14
In some same research in different geographic area
than msp1 block 2 as a marker, report important
Vol. 20, No. 1, February 2011 Comparison of adipose tissue processing 15
Effect of adipose tissue processing procedures in culture result: a
study preliminary Jeanne A. Pawitan,
1 Arleni Bustami,
2 Lia Damayanti,
1 Radiana D. Antarianto,
1 Ni M. Swantari
3
1 Department of Histology, Faculty of Medicine, University of Indonesia
2 Immunology and Endocrinology Integrated Laboratory, Faculty of Medicine, University of Indonesia
3 Department of Surgery, Faculty of Medicine, University of Indonesia
Abstrak
Latar belakang: Ada berbagai cara pemrosesan jaringan lemak sebelum dikultur, tergantung jenis sampelnya yang
dapat mempengaruhi hasil kultur. Penelitian ini bertujuan membandingkan berbagai modifikasi prosedur kultur
dan subkultur jaringan lemak yang disesuaikan dengan kondisi lab yang ada. Metode: Penelitian ini adalah penelitian deskriptif yang dilakukan di Makmal Terpadu Imunologi dan
Endokrinologi, Universitas Indonesia, mulai Oktober 2009 sampai April 2010. Kami membandingan tiga cara
pemrosesan, berbagai jumlah sel yang ditanam yang tergatung jumlah perolehan sel, dan dua cara subkultur, lalu
membandingkan hasilnya dalam hal jumlah sel yang dihasilkan dan waktu yang diperlukan. Pada cara pemrosesan
pertama, pencernaan dengan collagenase-1 dilakukan selama 30 menit dan jumlah sel yang ditanam adalah 24.000 dan 36.000 sel per wadah kultur; pada cara kedua, pencernaan dengan collagenase-1 dilakukan selama 60 menit
dan jumlah sel yang ditanam adalah 24.000, 48.000, dan 72.000 per wadah kultur; dan pada cara ketiga, sisa
jaringan lemak dari pemrosesan pertama dicerna kembali selama 45 menit dan jumlah sel yang ditanam adalah
74.000 dan 148.000 per wadah kultur. Perbedaan cara subkultur adalah pada ada atau tidaknya tahap pencucian.
Hasil: Prosedur -1 menghasilkan jumlah sel yang paling sedikit, dan sesudah dikultur, selnya tumbuh sangat
lambat, dan terkontaminasi sebelum panenan kultur primer. Prosedur-2 dan -3 berhasil menumbuhkan kultur
primer. Beberapa kultur terkontaminasi, sehingga tidak dapat dilanjutkan dengan subkultur, dan hanya satu cara
pemrosesan (prosedur-2: pencernaan collagenase-1 selama 60 menit tanpa penggunaan dapar pelisis, dan jumlah
sel yang ditanam 48.000 dan 72.000) yang berhasil menyelesaikan semua proses yang direncanakan sampai
subkultur ketiga. Walaupun beberapa prosedur tidak mencapai subkultur ketiga, hasilnya tetap dapat disimpulkan. Kesimpulan: Penelitian pendahuluan ini menunjukkan bahwa pencernaan collagenase-1 selama 60 menit dipadu
dengan goyangan berkala setiap 5 menit dan jumlah sel yang ditanam sekitar 50.000 atau lebih, diikuti dengan cara
subkultur tanpa tahap pencucian memberi hasil yang terbaik. (Med J Indones 2011; 20:15-9)
Abstract
Background: There are various methods of processing adipose tissue before culture, depending on the adipose
tissue samples. The aim of this study is to compare several modifications of culturing and sub-culturing procedures
of adipose tissue to fit the condition in our laboratory. Method: This is a descriptive study that was done in the Immunology and Endocrinology Integrated Laboratory, University of Indonesia, from October 2009 to April 2010. Three adipose tissue processing procedures, various amount of seeding and two subculture methods were compared in term of cell yield and time needed. In the first procedure, collagenase-1 digestion was done in 30minutes, cell seeding were 24,000 and 36,000 per flask; in the second procedure, collagenase-1 digestion was done in 60minutes, cell seeding were 24,000, 48,000, and 72,000 per flask; and in the third procedure, the adipose tissue remnants from the first procedure were again digested for another 45 minutes, cell seeding were 74,000, and 148,000 per flask. Difference in subculture methods were the presence or absence of washing step. Result: Procedure 1 yielded the lowest amount of cell, and after culture, the cells grew very slow, and was contaminated
before harvest of primary culture. Procedure-2 and -3 succeeded to yield primary cultures. Some of the cultures were
contaminated, so that further subculture was not applicable, and only one tissue processing procedure (procedure 2: 60
minute collagenase-1 digestion, without lysis buffer, cell seeding 48,000 and 72,000) could complete the three subcultures.
Though some of the procedures could not be completed, final result could be concluded. Conclusion: In this preliminary study, 60 minute colagenase-1 digestion with intermittent shaking every 5 minutes
and cell seeding around 50,000 or more, followed by subculture method without washing step gave the best result. (Med J Indones 2011; 20:15-9) Key words: collagenase-1, primary culture, subculture, stromal-vascular fraction
Correspondence email to: [email protected]
16 Pawitan et al. Med J Indones
Adipose tissue stem cells are adult stem cells that
have similar properties to the previously identified
bone marrow mesenchymal stem cells. They can be
isolated from adipose tissue stromal vascular fraction (SVF) that is called adipose stromal compartment.
1,
2 The stromal vascular fraction derived cells are
also called processed lipo-aspirate (PLA) cells,2 or
alternatively, adipose tissue derived mesenchymal stem cells (AT-MSCs). Adipose tissue stem cells have
various differentiation2 and angiogenic potentials.
3 In
addition, they have immuno-suppressive properties,4, 5
and might be used to treat autoimmune diseases.6
Moreover, the ease in collecting the samples compared to that of bone marrow make adipose tissue
stem cells very promising for regenerative medicine.7
There are various methods of processing adipose
tissue before culture, depending on the adipose tissue
samples. Processing adipose tissue samples from
lipoaspirate is different from resection derived
samples. Further, there are various procedures for
resection derived samples. The aim of this study is to
compare several modifications of culturing and sub-
culturing procedures for resection sample to fit the
condition in our laboratory. METHODS This is a descriptive study that is part of a research on
adipose tissue derived stem cells, which has got an
approval from the ethical committee of the Faculty of
Medicine University of Indonesia. This research was
done in the Immunology and Endocrinology Integrated
Laboratory, Faculty of Medicine, University of
Indonesia, from October 2009 to April 2010 Sample The adipose tissue resection sample was taken by a
plastic surgeon, after the patient who underwent a
plastic surgery got information about the research and
had signed the informed consent form. Tissue processing In this study, we compared several procedures of tissue
processing. We also compared different amount of cells
that were cultured. First of all, the adipose tissue sample
was washed from contaminating blood in phosphate
buffered saline (PBS) pH 7.4 until the washing solution
was clear, cut into 2 pieces, weighted, and the weights
were noted. All processing was done in aseptic condition
using sterile instruments and solutions.
Both adipose tissue pieces were subjected to
collagenase-1 digestion. Digestion was done in a 50mL
tube containing 25mL 0.075% collagenase-1 in PBS pH
7.4 at 37oC, and was gently shaken every 5 minutes.
In this preliminary study, we tested 3 kinds of modified
procedures using the available equipments in our lab. In
the first and second procedure, digestion was done in 30
and 60 minutes respectively. In the third procedure, the
adipose tissue remnants from the first procedure were
again digested for another 45 minutes. After digestion, the floating adipose tissue was removed
and the infranatant was placed in 15mL tubes,
centrifuged at 800g, and the supernatant was discarded. Culture and subculture In the first and second procedure, the pellets were dissolved
in 2.5 and 3 ml tissue culture (TC) medium respectively,
and the cells were counted in Neubauer chamber. In the third procedure, the pellet was dissolved in 4mL
lysis buffer and incubated at 37oC for 5 minutes, then
centrifuged at 800g, and the supernatant was discarded.
The pellet was dissolved in 3mL TC medium, and the
cells were counted in Neubauer chamber. The TC medium contained 10% fetal bovine serum
(FBS, Biowest), 1% penicillin streptomycin (Lonza)
and 1% Amphotericin B (Biowest) in Dulbeco
Minimal Eagle Medium (DMEM, Lonza). According to cell yield of every procedure, the cells were
then seeded at different cell numbers (Table 1) in a final
volume of 8mL TC medium in 25mL TC flask, and
incubated at 37˚C with 5% CO2.The cultures were checked
for the presence of contamination every day. Contaminated
flasks were discarded. Beginning at day two, the flasks were
checked every day for cell attachment. After the cell
attachment of all flasks, the TC medium was replaced twice
a week, every Monday and Thursday, or more frequent
when the color changed into orange. When the cells were 40 - 80% confluence, subculture
was done. We tested two subculture procedures, i.e. with
and without washing step (direct subculture). Subculture
(until subculture-3) was done by replacing the TC
medium by 1.5mL of 0.05% trypsin in PBS pH 7.4, until
the cells were detached, and trypsin solution was added
when the cells were not detached after 10 m minutes.
Further the trypsin was neutralized by a same amount of
TC medium. The number of cells in the cell
Vol. 20, No. 1, February 2011
suspension was counted. In direct subculture, half of the
cell suspension was directly sub-cultured, and in the
procedure with washing step, the other half was washed
by PBS pH 7.4 before sub-culturing. When the yield was
abundant, part of the cell suspension was directly sub-
cultured, and a same amount was washed before sub-
cultured, and the rest was cryopreserved. For direct
subculture, the TC medium was replaced the next day.
Further, for both subculture procedures, the TC medium
was replaced twice a week, or more frequent when the
color changed into orange. Data collection and interpretation The total numbers of cell yield per gram of adipose
tissue for every procedure were noted. Further, the days
needed until the cells attached and began to grow in
primary culture, became confluence or contaminated for
every procedure and seeding and cell yield of every
subculture were noted and tabulated. The procedure that
yielded 40-80% confluence in the shortest time was
regarded as the best.
Comparison of adipose tissue processing 17
RESULTS Adipose tissue weight in the first (followed by the third) and
second procedure was 2.74 and 1.94 grams respectively. The
total number of cell yield in procedure 1, 2, and 3 were 60,000,
144,000, and 296,000 cells respectively, and cell yield per
gram of adipose tissue in procedure 1, 2 and 3 was 21,898,
74,227, and 108,029 cells, respectively. The cells were attached at day-3 to day-8 (Table 1).
Primary culture took a long time to grow, but subcultures
grew faster and became confluence in shorter time. The
time needed until confluence or contamination, and the
total yield of cells for every culturing and sub-culturing
procedure can be seen in Table 2. Cell yield in procedure 1, 2 and 3 was 21,898, 74,227,
and 108,029 cells/gram of adipose tissue. Some of the cultures were contaminated, so that
further subculture was not applicable, and only one
tissue processing procedure could complete the three
subcultures (Table 1 and 2).
Table 1. The number of seeded cells and needed time for attachment
Procedure Seeding (final) Cell attachment Cell growth Cell yield 1-1 24,000 Day-8 NC-42 - 1-2 36,000 Day-8 NC-18 - 2-1 24,000 Day-7 NC-42 - 2-2 48,000 Day-3 C-16 (70%) 200,000 2-3 72,000 Day-3 C-16 (40%) 32,000 3-1 74,000 Day-5 C-28 (80%) 1,464,000 3-2 74,000 Day-6 NC-13 - 3-3 148,000 Day-7 NC-11 -
C-= confluence at day-, NC= not yet confluence and contaminated at day- Table 2. The time needed until sub-culturing or contamination and the yield of cells for every sub-culturing in the various procedures
P Subc-1 Cell yield Subc-2 Cell yield Subc-3 Cell yield (x1000) (x1000) (x1000)
1-1 NA - NA - NA - 1-2 NA - NA - NA - 2-1 NA - - - - - 2-2 Dir-S: 100, C-7 (80%) 1,080 Dir-S: 540, C-8 (90%) 4,496 Dir-S: 1,124, C-7 (80%) 2,960
W-S: 152, C-15 (50%) 460 NA-cryo - W-S: 60, C-7 (50%) 456 Dir-S: 228, C-8 (80%) 1,152 Dir-S: 384, C-7 (80%) 2,464 W-S: 80, Cont-21 (40%) 144 NA -
2-3 Dir-S: 16, C-23 (85%) 1,312 NA - cryo - NA - W-S: 8, Cont-22 - NA - NA -
3-1 Dir-S: 488x1.5, cont-1 - NA - NA - 3-2 NA - NA - NA - 3-3 NA - NA - NA -
P= procedure, Subc= subculture, C-= confluence at day-, cont-= contaminated at day-, NA= not applicable, Dir-S= directly sub-cultured and number of cell
seeded, W-S= washed before sub-cultured and number of cell seeded, cryo= cryopreserved
20 Buang et al. Med J Indones
The metabolic effects of di (2-ethyl hexyl) phthalate medium dose on lipid
profiles in serum and liver tissue Buang Y
1,2 6 Department of Chemistry, Faculty of Science and Engineering, Nusa Cendana University, Kupang, Indonesia
7 Laboratory of Applied Biochemistry, Department of Applied Biological Science, Saga University, Saga Shi, Honjo Machi-
1, Saga, Japan
Abstrak
Latar belakang: Di (2-ethyl hexyl) phthalate merupakan bahan plasticizer yang banyak digunakan pada kantong
darah untuk transfusi. Bahan ini dapat mempengaruhi metabolisme lipid. Penelitian ini bertujuan menyelidiki efek
metabolik di (2-ethyl hexyl) phthalate dosis tengah pada profil lipid dalam serum dan jaringan hati. Metode: Tikus percobaan galur Sprague Dawley diberi diet yang disuplementasi dengan 1,0% di (2-ethyl hexyl)
phthalate (kelompok DEHP, n=5) dan diet yang tak disuplementasi (kelompok kontrol, n=5) selama 10 hari. Hewan
percobaan dibiarkan mendapatkan makanan secara ad libitum. Kadar lipid dalam serum diukur menggunakan
enzyme assay kits. Lipid jaringan hati diekstraksi dan konsentrasinya ditentukan. Sepotong jaringan hati diambil
untuk menentukan aktivitas malic enzyme dan carnitine palmitoyl transferase-1 (CPT-1). Hasil: Kadar lipid serum kelompok DEHP menurun dibandingkan dengan kelompok kontrol (P<0,05), di mana kadar lipid serum
(mg/dL) pada kelompok kontrol dan DEHP masing-masing: trigliserida (TG) (100,5±16,5) dan (31,2±1,7); fosfolipid (PL)
(143,3±7,8) dan (88,9±3,2); kolesterol total (88,7±4,6) dan (51,9±2,3); dan kolesterol HDL (high-density lipoprotein) (29,8±1,0)
dan (16,1±0,7). Kandungan PL hati pada kelompok DEHP meningkat secra bermakna dibandingkan dengan kelompok kontrol
(P<0,05); peningkatannya mencapai 15%. Kandungan lipid hati (mg/g jaringan) pada kedua kelompok masing-masing: TG
(40,8±4,4) dan (23,7±1,3); kolesterol total (3,36±0,29) dan (2,33±0,23); PL (36,5±1,0) dan (41,7±0,6). Aktivitas malic enzyme dan
CPT-1 masing-masing meningkat sebesar 4,35 dan 2,33 kali kelompok kontrol. Kesimpulan: Di (2-ethyl hexyl) phthalate dosis tengah menurunkan sekresi lipid dari sel-sel hati ke dalam aliran darah.
Kandungan TG dan kolesterol total sel-sel hati juga berkurang, sebaliknya kadar fosfolipid hati meningkat. Peningkatan
fosfolipid hati disertai peningkatan aktivitas malic enzyme dan CPT-1 merupakan faktor utama penurun kadar lipid serum,
TG dan kolesterol sel-sel hati yang diinduksi oleh di (2-ethyl hexyl) phthalate. (Med J Indones 2011; 20:20-6)
Abstract
Background: Di (2-ethyl hexyl) phthalate is the most widely used plasticizer in blood storage bag for transfusion.
This substance can modify lipid metabolism. This study was aimed to elucidate the metabolic effects of di (2-ethyl
hexyl) phthalate medium dose on lipid profiles in serum and liver tissue. Methods: Sprague Dawley rats were fed 1.0 % di (2-ethyl hexyl) phthalate diet (DEHP group, n=5) or a non-supplemented
diet (control group, n=5) for 10 days. The rats were allowed to freely access each food. Serum lipid concentrations were
measured using enzyme assay kits. Lipids of liver tissues were extracted and the lipid contents were determined. A peach
of liver was prepared to determine the activities of malic enzyme and carnitine palmitoyl transferase-1 (CPT-1). Results: Serum lipid concentrations (mg/dL) of DEHP group decreased compared to control (P<0.05). The serum
triglyceride (TG) concentrations of control and DEHP groups were respectively (100.5±16.5) and (31.2±1.7); phospholipid (PL), (143.3±7.8) and (88.9±3.2); total cholesterol, (88.7±4.6) and (51.9±2.3). The liver TG content of control and DEHP group (mg/g liver) were respectively, (40.8±4.4) and (23.7±1.3); liver cholesterol were (3.36±0.29) and (2.33±0.23); and the liver PL were (36.5±1.0) and (41.7±0.6). Malic enzyme and CPT-1 activities (nmol/min/ mg protein) of DEHP group increased compared to control (P<0.05), in which their increases were approximately by 4.35- and 2.33-folds, respectively. Conclusion: The di (2-ethyl hexyl) phthalate medium dose attenuates lipids secretion from the liver cells into the
bloodstream. The increase of liver PL level accompanied with the promotions of malic enzyme and the CPT-1 activities are
the key factors of the dietary di (2-ethyl hexyl) phthalate effects in rats to attenuate the lipid secretions from the livers. (Med J Indones 2011; 20:20-6) Key words: Di (2-ethyl hexyl) phthalate, hyperphospholipids, lipolysis, liver lipids, serum lipids
Di (2-ethyl hexyl) phthalate is the most widely used
plasticizer in polyvinyl chloride plastic. It was reported that
di (2-ethyl hexyl) phthalate used in blood storagebags
leaches out in significant amounts into the blood stored and
the blood products resulted from exposure of patients to this
compound during transfusion.1-3
It was also reported
that after 21 days storage of blood used to transfuse in
human recipients, the blood storage bags averagely
leaches out 10 mg di (2-ethyl hexyl) phthalate/100 mL
blood. Furthermore, a number of reports are available on
the toxicity of di (2-ethyl hexyl) phthalate, particularly
studied in the liver.4,5
Almost all of those studies carried Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011
out the treated doses reached 200mg/100g body weight
(BW). Gayathri et al.6 administered the rats with a dose
of 0.75 mg/100g BW which is equivalence with
transfusion of ten unit of blood in a human recipient.
These authors did not find the serious toxic effects as
evidenced by lack of any histopathological changes in
the liver or significant alterations in many biochemical
parameters. Overall, the doses of di (2-ethyl hexyl)
phthalate that had been treated have ranges 750µg-
200mg per 100g BW. Therefore, the dose of 75 mg di (2-
ethyl hexyl) phthalate/100g BW that was used in the
present study might be considered medium dose. Currently, di (2-ethyl hexyl) phthalate, a phthalate
plasticizer, belongs to a peroxisome proliferators class of
rodent nongenotoxic hepatocarcinogens.7,8
This
phthalate modulates the peroxisome proliferators-
activated receptor (PPAR).9 PPARα is known as lipid-
activated transcription factors expressed in the liver that
belongs to the nuclear hormone superfamily. Numerous
authors7-9
reported that di (2-ethyl hexyl) phthalate is the
essential transcription factors regulating key cellular
functions that include lipid metabolism. Some biochemical parameters in lipid metabolism
such as serum lipid profiles are constantly altered
during normal states or disorders of metabolisms.
Very-low density lipoprotein is a lipoprotein handling
the lipid transportation from the synthesized lipid in
the liver into extra hepatic tissues. Hence, serum lipid
profiles generally indicate how lipid metabolism
occurred in the liver. Commonly, disorders of lipid
metabolism in the liver such as fat infiltration induce
hepatic steatosis.10-12
The impacts of the hepatic
steatosis is similar to those seen in patients with
alcoholic liver disease and range from mild hepatic
steatosis to steatohepatitis, liver fibrosis, and
cirrhosis,13
and, rarely, to hepatocellular carcinoma.14
Considering di (2-ethyl hexyl) phthalate is widely used in
consumer products in common society such as food
packaging materials and children’s toys15
and used for
tubing and containers for blood transfusions and blood
products, etc., di (2-ethyl hexyl) phthalate constantly and
directly or indirectly interacts with human and animal
health cells. Therefore, its effect on lipid profiles in
serum and liver tissue is of interested to evaluate. The
present study was conducted to elucidate the metabolic
effects of di (2-ethyl hexyl) phthalate medium dose on
lipid profiles in serum and liver tissue using sprague-
dawley (SD) rats as animal model.
Metabolic effects of di (2-ethyl hexyl) phthalate medium dose 21
METHODS
Animals and experimental design
All aspects of the experiment were conducted according
to guidelines provided by the ethical committee of
experimental animal care at Saga University (Saga,
Japan). Male SD-rats aged 5 weeks were housed
individually in an air-conditional room (24oC) with a 12-
h light/dark cycle. After one week acclimatization, rats
were assigned to two groups (five rats each). Control diet
(as control group) was prepared according to
recommendations of the American Institute of Nutrition
(AIN) and contained (in weight %) 20 of casein, 10 of
safflower oil, 1 of vitamin mixture (AIN-93), 3.5 of
mineral mixture (AIN-93), 10 of sucrose, 0.25 of choline
bitartrate, 0.3 of L-Cystein, 0.0014 of t-BHQ, 5 of
cellulose, 13.2 of α-cornstarch, and β-cornstarch to make
100. The di (2-ethyl hexyl) phthalate diet (as DEHP
group) was prepared by replacement of 1.0% β-cornstarch with di (2-ethyl hexyl) phthalate to the
control diet. Considering evidences in food intake and
final BW of the dietary di (2-ethyl hexyl) phthalate in
male SD-rats, the 1% of food intake is equally to a range
of 73-77 mg di (2-ethyl hexyl) phthalate/100g BW
dose.16
The animals received the diets for 10 days. At the
end of the feeding period, rats were killed by
decapitation after a 9-h starvation. Livers were excised
immediately, and serum was separated from blood.
Analyses of serum and liver lipids
Liver lipids were extracted according to the method of Folch
et al.,17
and concentrations of TG, cholesterol, and
phospholipids (PL) were measured by the methods used
elsewhere.10-12,18,19
Serum TG, PL, cholesterol, and glucose
were measured using enzyme assay kits from Wako Pure
Chemicals according to the manufacture’s instructions.
Preparation of liver sub cellular fractions
The mitochondrial and cytosol of liver sub cellular
fractions were prepared as previously reported by
Nagao et al.19
Protein content was determined by the
method used in our previous studies.10-12,18,19
Assays of hepatic enzyme activity
The malic enzyme (ME, EC1.1.1.40), the carnitine
palmitoyl transferase-1 (CPT-1; EC2.3.1.23), glucose
6-phosphate dehydrogenase (G6PDH; EC1.1.1.49),
fatty acid synthase (FAS; EC2.3.1.85), phosphatidate
phosphohydrolase (PAP, EC3.1.3.4) activities were
22 Buang et al. Med J Indones
determined by the methods used in our previous studies.
10-
12,18,19 The glutathione peroxidase (GSH-Px; EC1.11.1.9)
was determined by the methods used elsewhere.20,21
Statistical analyses All values are expressed as mean ± standard error of the
mean (SEM). Data were analyzed by one-way analysis
of variance, and all differences were inspected by
Duncan’s new multiple-range test using SPSS statistical
software (SPSS inc., Chicago, IL, USA). RESULTS Dietary di (2-ethyl hexyl) phthalate promoted
liver weight The daily food intake is shown in Table 1. The food
intake of DEHP group decreased in comparison to
control. The low level of food intake in the group was
equivalent with the reduction of body weight.
However, the weights of liver were significantly
higher than that of the control group (P<0.05).
Effects of di (2-ethyl hexyl) phthalate on glucose
blood level, serum and liver lipid levels As shown in Figure 1, the lipid levels in serum of DEHP
group decreased significantly (P<0.05), in which serum
TG, PL, total cholesterol, and HDL-cholesterol levels
decreased approximately by 70%, 38%, 41%, and 46%,
respectively. Although failed to reach significant level,
the glucose blood level decreased by approximately 9%.
Table 1. The metabolic effects of di(2-ethyl hexyl) phthalate
on growth parameters Group Control DEHP* Initial body weight (g) 132.8 ± 3.4 134.6± 2.5 Final body weight (g) 206.1± 3.5
a 188.4± 6.3b
Food intake (g/day) 18.7± 0.8a 14.1± 0.8
b Liver weight (g/100 g body weight) 4.0± 0.1
a 6.7± 0.2b
Values are expressed as mean ± SEM of five rats. Clearly define a & b indicates
significant difference at P < 0.05. *DEHP, di(2-ethyl hexyl) phthalate
Figure 1. Serum lipids and glucose levels
Values are expressed as mean± SEM of five rats. Clearly define a & b regarding difference
of significance at P < 0.05.
Vol. 20, No. 1, February 2011 MnSOD mRNA expression and specific activity 27
Expression of manganese superoxide dismutase in rat blood, heart and
brain during induced systemic hypoxia Septelia I. Wanandi,
1 Syarifah Dewi,
1,2 Sri W. A. Jusman
1 Mohamad Sadikin
1 8 Department of Biochemistry and Molecular Biology, Faculty of Medicine Universitas Indonesia, Jakarta
9 Master Program in Biomedical Sciences, Faculty of Medicine Universitas Indonesia, Jakarta
Abstrak
Latar belakang: Hipoksia mengakibatkan peningkatan ROS. Hingga saat ini, belum banyak diketahui mengenai peran MnSOD – enzim antioksidan endogen utama – pada respons adaptasi sel terhadap hipoksia. Penelitian ini bertujuan menganalisis
ekspresi mRNA dan aktivitas spesifik MnSOD pada darah, jantung dan otak tikus yang diinduksi hipoksia sistemik. Metode: 25 ekor tikus Sprague Dawley diinduksi hipoksia sistemik di dalam ruang hipoksia (8-10% O2) selama 0,
1, 7, 14 atau 21 hari. Ekspresi relatif mRNA MnSOD dianalisis menggunakan Real Time RT-PCR. Aktivitas spesifik
MnSOD diukur dengan metode inhibisi xantin oksidase. Hasil: Ekspresi relatif mRNA MnSOD pada darah dan jantung tikus menurun selama fase awal induksi hipoksia
sistemik (hari ke 1) dan meningkat setelah hari ke 7, sedangkan ekspresi mRNA pada otak meningkat sejak hari ke 1
dan mencapai kadar maksimum pada hari ke 7. Hasil pengukuran aktivitas spesifik MnSOD selama awal induksi
hipoksia sistemik menyerupai hasil ekspresi mRNA. Pada kondisi hipoksia yang sangat lanjut (hari ke 21), aktivitas
spesifik MnSOD pada darah, jantung dan otak menurun secara signifikan. Ekspresi mRNA MnSOD pada ketiga
jaringan tersebut selama hari ke 0-14 induksi hipoksia sistemik berkorelasi positif dengan aktivitas spesifiknya.
Selain itu, ekspresi mRNA dan aktivitas spesifik MnSOD pada jantung berkorelasi kuat dengan hasil pada darah. Kesimpulan: Ekspresi MnSOD pada fase awal dan lanjut induksi hipoksia sistemik mengalami regulasi yang berbeda. Ekspresi
MnSOD pada otak berbeda dengan pada darah dan jantung, menunjukkan bahwa jaringan otak dapat lebih bertahan pada induksi
hipoksia sistemik dibandingkan jantung dan darah. Pengukuran ekspresi MnSOD di dalam darah dapat digunakan untuk
menggambarkan ekspresinya di dalam jantung pada keadaan hipoksia sistemik. (Med J Indones 2011; 20:27-33)
Abstract
Background: Hypoxia results in an increased generation of ROS. Until now, little is known about the role of MnSOD - a major
endogenous antioxidant enzyme - on the cell adaptation response against hypoxia. The aim of this study was to determine the
MnSOD mRNA expression and levels of specific activity in blood, heart and brain of rats during induced systemic hypoxia. Methods: Twenty-five male Sprague Dawley rats were subjected to systemic hypoxia in an hypoxic chamber (at 8-
10% O2) for 0, 1, 7, 14 and 21 days, respectively. The mRNA relative expression of MnSOD was analyzed using
Real Time RT-PCR. MnSOD specific activity was determined using xanthine oxidase inhibition assay. Results: The MnSOD mRNA relative expression in rat blood and heart was decreased during early induced systemic hypoxia (day 1) and increased as hypoxia continued, whereas the mRNA expression in brain was increased since day 1 and reached its maximum level at day 7. The result of MnSOD specifi c activity during early systemic hypoxia was similar to the mRNA expression. Under very late hypoxic condition (day 21), MnSOD specific activity in blood, heart and brain was significantly decreased. We demonstrate a positive correlation between MnSOD mRNA expression and specific activity in these 3 tissues during day 0-14 of induced systemic hypoxia. Furthermore, mRNA expression and specific activity levels in heart strongly correlate with those in blood. Conclusion: The MnSOD expression at early and late phases of induced systemic hypoxia is distinctly regulated.
The MnSOD expression in brain differs from that in blood and heart revealing that brain tissue can possibly survive
better from induced systemic hypoxia than heart and blood. The determination of MnSOD expression in blood can
be used to describe its expression in heart under systemic hypoxic condition. (Med J Indones 2011; 20:27-33) Key words: MnSOD, mRNA expression, ROS, specific activity, systemic hypoxia
Nowadays, the pattern of morbidity and mortality in
Indonesia has shifted from infectious to degenerative
diseases, such as cardio- and cerebrovascular diseases
and cancer. Almost all risk factors for those diseases
could induce hypoxic condition, indicating the
involvement of hypoxia in pathogenesis of the
degenerative diseases.1
Hypoxia is a pathological condition in which the body as
a whole or region of the body is deprived of adequate
oxygen supply. This condition threatens life of cells or
organisms. The ability to maintain oxygen homeostasis is
essential for the survival of all aerobic species. Oxygen
homeostasis mechanisms can occur at systemic level and
cellular level, such as by oxygen sensing. At Correspondence email to: [email protected]
28 Wanandi et al.
systemic level, low oxygen could stimulate heart rate,
peripheral vasodilatation and hyperventilation,
whereas at cellular level, anaerobic metabolic
pathways would be activated.2,3
One of the cellular oxygen sensing reactions in
hypoxia is the increased level of hypoxia-inducible
factor-1α (HIF-1). HIF-1α is a ubiquitous intracellular
protein that is degraded by prolyl hydroxylase right
after its biosynthesis in normoxic condition. Stabilized
HIF-1α joins HIF-1β to form HIF-1 transcription
factor which interacts with HRE (HIF-1 response
element) and regulates the transcription of essential
genes for the adaptation responses to hypoxia.4-6
Hypoxia results in an increased generation of reactive
oxygen species (ROS), such as superoxide anion radical
(O2•-) and hydrogen peroxide (H2O2) in mitochondria.
Free radicals are molecules that have at least one
unpaired electron and thus are very reactive. The term
ROS also includes reactive oxygen species which are
chemically not radicals, e.g., hydrogen peroxide. Under
hypoxic condition, the consumption of oxygen at
cytochrome c oxidase level (complex IV of the
mitochondrial electron transport chain) is lower than
under normoxic conditions and electrons accumulate at
the preceding complex III. Such an accumulation leads
to an increased generation of ROS at complex III7 or on
the transport between the two complexes by cytochrome
C. In hypoxia, ROS also participate in signal
transduction pathways inducing the stabilization of HIF-
1α. Moreover, pro-oxidant treatment in normoxic cells
can activate genes that induce hypoxia.3,8
Superoxide dismutase (SOD) is one of the antioxidant
enzymes that could protect cells from oxidative damage.
This enzyme converts very reactive superoxide anion
radicals (O2•-) to less reactive hydrogen peroxide (H2O2).
Among the three isoforms of SOD, manganese superoxide
dismutase (MnSOD) is the major antioxidant enzyme in
mitochondria that scavenges superoxide radicals generated
by the electron transport chain in mitochondria.7 Decreasing
the MnSOD level could elevate ROS levels in mitochondria
and lead to oxidative stress including oxidative the damage
of biomacromolecules, such as proteins, lipids and DNA.9
Many studies have explained the important role of
MnSOD in the prevention of oxidative stress.10,11
However, little is known about the expression of
MnSOD during systemic hypoxic conditions, particularly
in the essential tissues, such as brain, heart and blood. In
the present study, mRNA expression and specific activity
of MnSOD were analyzed. The information about
Med J Indones
differential MnSOD expression in various tissues during
induced systemic hypoxia would open the new concept of
localized adaptation response as antioxidant protection. METHODS This was an experimental study carried out at
Biochemistry and Molecular Biology Laboratory,
Faculty of Medicine University of Indonesia. All
procedures were approved by the Ethical Committee
of Research Center and Health Development, Ministry
of Health Republic of Indonesia (BALITBANGKES
RI; No. LB.03.02/ KE/1347/2008). Systemic hypoxia induction Twenty-five male Sprague Dawley rats (6-8 weeks old;
body weight 150-200 g at entry into protocol) were
randomly divided into 5 groups (n = 5 per group). Rats
were subjected to systemic hypoxia by placing them into
a normobaric hypoxic chamber treated with 8-10% of O2
for 0 (control rats without hypoxia), 1, 7, 14 and 21 days,
respectively. The hypoxic chamber (kindly provided by
Dr. F. Ferdinal) was designed as previously described by
Corno et al.12
All rats had free access to water and
standard rat chow. Water and food consumption was
assessed every 2 days. Isolation of total RNA and protein After hypoxic treatment, rats were sacrificed with ether
anaesthesia. Rat blood was immediately collected from
the heart for blood gas analysis. Subsequently, brain and
heart tissues were rapidly excised. Samples from blood,
heart and brain were used for the analysis of mRNA
expression and specific activity of MnSOD. All excision
procedures were executed in the hypoxic chamber. Whole blood (200 µl) was added into 600 µl of Red Blood
Cell Lysis Solution® (Promega). The mixture was incubated
for 10 minutes at room temperature and centrifuged at
16000 rpm for 20 seconds. The white pellet containing
leucocytes was collected and kept at -800C before use. Total
RNA was extracted from leucocytes and tissue samples (100
mg) using Tripure RNA Isolation Kit® (Roche) and was
kept at -800C before use. The isolation of total protein from
leucocytes and tissue samples was performed as previously
described by Hardiany et al.13
Analysis of MnSOD mRNA relative expression
using Real Time RT-PCR Total RNA (~300 ng) was amplified using iScript One Step
RT-PCR Kit with SYBR Green® (BioRad). cDNA synthesis
and PCR amplification were carried out in the same tube.
Vol. 20, No. 1, February 2011 MnSOD mRNA expression and specific activity 29
Reaction protocol was as follows: cDNA synthesis for 10
minutes at 50oC; inactivation of reverse transcriptase for 5
minutes at 95°C; PCR cycles (40 cycles) for 10 seconds at
95°C, 30 seconds at 59°C (after optimalization), 30 seconds
at 72°C; melting curve analysis for 1 minute at 95°C, 1
minute at 55°C; 10 seconds at 55°C (80 cycles increasing
0.5°C each cycle). Primers were designed according to
NCBI gene bank data: NM_017051 (for MnSOD) and
NM_031144 (for β-actin as a reference gene) using Primer3
program & Primer Analysis software. Primer sequences used to generate cDNA for MnSOD
(178 bp) are: 5’- AACGTCACCGAGGAGAAGTA - 3’
(forward); 5’- TGATAGCCTCCAGCAACTCT - 3’
(reverse) and those used to generate cDNA for β-actin
(174 bp) are: 5’- CACTGGCATTGTGATGGACT - 3’
(forward); 5’- CTCTCAGCTGTGGTGGTGAA - 3’
(reverse). Amplification procedures for the β-actin gene
were the same as for the MnSOD gene. Aqua bidest was
used as a negative control (NTC) to reduce false positive
results. The level of mRNA expression of treated groups
was relatively determined using PfaffI formula and
normalized to the control group (as a calibrator with
expression level of 1). Analysis of MnSOD specific activity SOD activity was biochemically determined using
xanthine oxidase inhibition assay, as previously
described.13
To inhibit the Cu/ZnSOD, prior to addition
of xanthine oxidase, natrium cyanide (5 mM) was first
added into each sample and incubated for 5 minutes in
room temperature. Kinetic of enzyme activity was
measured using spectrophotometer at 505 nm after 30
seconds and 3 minutes and calculated as a percentage
inhibition of the samples plotted to the standard curve.
The specific activity of MnSOD enzyme was calculated
as enzyme activity (in Unit) per mg protein. Protein
concentration was measured using spectrophotometer at
280 nm and plotted to the BSA (Bovine Serum Albumin)
standard curve. Specific activity of MnSOD in rat blood,
heart and brain are expressed as Unit/gram protein, and
compared by using t-test.
RESULTS Analysis of MnSOD mRNA expression using Real Time
RT-PCR was first optimized for the primers’ specificity.
As shown in Figure 1, there was merely a single peak in
the melting curve and a single band in the electrophoresis
of cDNA product of MnSOD as well as β-actin. This
indicates that the primers designed in this study for both
genes could generate the specific cDNA products and
there were no primer dimers present.
Figure 1. Melting curve of MnSOD and β-actin cDNA
produced by Real Time RT-PCR. Insert: Electrophoresis on 2% agarose gel for MnSOD cDNA (178 bp) and β-
actin cDNA (174 bp). NTC (Non-template control) is a negative control: no
cDNA prod-uct visible for NTC. Figure 2 shows that MnSOD mRNA relative expression
in rat blood and heart was decreased during early induced
systemic hypoxia (day 1) and continuously increased
after 7 days of systemic hypoxia. Compared to this result,
the relative expression of MnSOD mRNA in rat brain
was increased from day 1 of induced systemic hypoxia
and reached its maximum level at day 7. Figure 2. Relative expression level of MnSOD mRNA in rat blood,
heart and brain during induced systemic hypoxia. The level
of mRNA relative expression of treated groups was
determined using Real Time RT-PCR, calculated according
to PfaffI formula and normalized to the data of particu-lar
control group (as a calibrator with expression level of 1). β-
actin was used as a reference gene. The result of MnSOD specific activity during early systemic
hypoxia was similar to the result of mRNA expression. Figure 3
demonstrates that MnSOD specific activity in rat blood and
heart during early systemic hypoxia was significantly (t-test; p
< .05) decreased on day 1 and subsequently increased
afterwards, whereas this activity in rat brain
34 Tjakradidjaja and Tjakradidjaja Med J Indones
Pomegranate (Punica granatum L) powder reduced malondialdehyde
(MDA) level in cigarette smoke exposed rats Francisca A. Tjakradidjaja,
1 Anita S. Tjakradidjaja
2
10 Department of Medicine, Faculty of Medicine and Health Science, Syarif Hidayatullah State Islamic University, Jakarta
11 Department of Animal Nutrition and Food Technology, Faculty of Animal Science, Bogor Agricultural University, Bogor
Abstrak
Latar belakang: Mengetahui efek pemberian bubuk “pomegranate” selama 14 hari terhadap peroksidasi lipid
berdasarkan pengukuran kadar malondialdehida (MDA) pada tikus yang dipaparkan asap rokok. Metode: Rancangan acak lengkap diterapkan pada penelitian ini. Tigapuluh tikus Sprague-Dawley dibagi menjadi
tiga kelompok, yaitu: kelompok tanpa penambahan bubuk pomegranate (kontrol), kelompok R1 dengan
penambahan 5% (kandungan flavonoid 0,351%/100g) dan kelompok R2 dengan penambahan 10% (kandungan
flavonoid 0,566%/100g) bubuk pomegranat ke dalam ransum. Ransum diberikan ‘ad libitum’ selama 14 hari. Tikus
dipaparkan pada asap rokok selama tiga kali sehari. Kadar MDA diukur sebelum pemaparan, hari ke-8 dan -15
pemaparan. Data dianalisis menggunakan uji ANOVA setelah pengujian normalitas data. Hasil: Kadar MDA sebelum pemaparan adalah 0.35±0.06 nmol/mL, 0.38±0.06 nmol/mL dan 0.38±0.06 nmol/mL berturut-turut untuk kelompok kontrol, R1 dan R2 (P= 0.65). Pada hari ke-8, kadar MDA adalah 0.70±0.06
nmol/mL, 0.57±0.06 nmol/mL dan 0.56±0.06 nmol/mL berturut-turut untuk kelompok control, R1 dan R2. Kadar
MDA pada hari ke-15 berturut-turut untuk kelompok kontrol, R1 dan R2 adalah 1.02 ±0.06 nmol/mL, 0.89±0.06
nmol/mL dan 0.80±0.06 nmol/mL. Terdapat perbedaan bermakna (P= 0,001) rerata kadar MDA hari ke-8 dan hari
ke-15 antar kelompok. Rerata kadar MDA pada kelompok kontrol paling tinggi dibandingkan kelompok R1 dan R2
baik pada hari ke-8 maupun hari ke-15. Rerata kadar MDA pada kelompok R2 paling rendah dibandingkan
kelompok R0 dan R1 pada hari ke 8 maupun hari ke 15. Peningkatan kadar MDA pada hari ke delapan
dibandingkan sebelum pemaparan pada kelompok R0, R1 dan R2 berturut-turut adalah 97%, 52% dan 48%,
sedangkan peningkatan MDA pada hari ke 15 dibandingkan sebelum pemaparan pada kelompok R0, R1 dan R2
berturut-turut adalah 187%, 137% dan 113%. Peningkatan kadar MDA terbesar adalah pada kelompok R0. Kesimpulan: Pemberian bubuk pomegranat pada kadar 5% dan 10% dapat menekan terjadinya peroksidasi lipid
yang ditunjukkan dengan kadar MDA dibandingkan dengan kelompok kontrol. (Med J Indones 2011; 20:34-9)
Abstract
Background: To analyze the effect of pomegranate (P. granatum) powder consumption for 14 days on lipid
peroxidation as shown by malondialdehyde (MDA) level in cigarette smoke exposed rats. Methods: Thirty Sprague-Dawley male rats were randomly divided into three groups, i.e.: a control group and two
treatment groups. The treatment groups either received 5% (R1: 0.351% flavonoids/100g) or 10% (R2: 0.566% flavonoids/100g) pomegranate extract powder, respectively. The diets in the form of pellets were freely consumed (ad libitum) and were given for 14 days. Rats were exposed to cigarette smoke three times per day. Blood samples were taken on day 0, day 8th and 15th for MDA analyses. Comparison of MDA levels was done by ANOVA’s test on normal data. Results: On day 0, the MDA levels were 0.35±0.06 nmol/mL, 0.38±0.06 nmol/mL and 0.38±0.06 nmol/mL for control, 5% and 10% pomegranate powder group, respectively (P=0.65). On day 8th, the MDA levels were 0.70±0.06 nmol/mL, 0.57±0.06 nmol/mL and 0.56±0.06 nmol/mL, and on day 15th, the MDA levels were 1.02 ±0.06 nmol/mL, 0.89±0.06 nmol/mL and 0.80±0.06 nmol/mL in control, 5% and 10% pomegranate powder group, respectively. There was a significant difference (P< 0.001) in MDA levels on day 8th and 15th between groups. The average MDA level for rats consuming control diet was the highest on day 8th and 15th. On the other hand, the lowest average MDA level on day 8th and 15th was observed in rats given 10% pomegranate extract powder. In comparison to MDA level before cigarette smoke exposure, the increases in MDA levels for rats consuming control diet, 5% and 10% pomegranate extract powder were 97%, 52% and 48% on day 8th, and 187%, 137% and 113% on day 15th, respectively. The highest increase in MDA level was observed in control group. Conclusion: The use of pomegranate powder at 5% and 10% concentration was able to prevent the occurrence of
lipid peroxidation as shown by the MDA levels and the effect was dose dependent. (Med J Indones 2011; 20:34-9) Key words: antioxidant, flavonoids, lipid peroxidation
Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011
Cigarette smoke contains more than 4000 elements and
at least 200 of them are harmful to health. The main
toxins in cigarettes are tar, nicotine, and carbon
monoxide. In addition, cigarette smoke also contains
other chemicals that are not less toxic such as ammonia,
formic acid, formaldehyde, hydrogen cyanide, etc.1, 2
The combustion of cigarettes can lead to the production of
reactive oxygen species (ROS). Free radicals, components
of ROS are found in cigarette mainstream and side stream
smoke. Side stream cigarette smoke contains more toxic
gases and free radicals than the mainstream cigarette
smoke.3, 4
The adverse effects of smoking may result from
the accumulation of oxidative damage brought about by
ROS, which is called oxidative stress. Oxidative stress is a condition that occurs due to imbalance
betweenfreeradicalandantioxidantproductions.Thiswill
cause serious damage to biological macromolecules and
disregulation of normal metabolism and physiological
functions. 5 Free radicals can cause lipid peroxidation in cell
membranes, which in turn produces compounds that are
toxic to cells, such as malondialdehyde (MDA). Elevated
levels of MDA show the increased activity of lipid
peroxidation.6
As a response to oxidative damage, antioxidants are
produced. Antioxidants are molecules that slow or
prevent the oxidation of other chemicals.7 Antioxidants
can be derived from the body or from outside the body.
Antioxidants from outside the body are natural food
ingredients from fruits. One of the antioxidant containing
fruits is pomegranate (Punica granatum L.).
Pomegranate contains high concentration of antioxidants
(11.33 mmol/100 g). The main natural antioxidants in
pomegranate are polyphenols; 8 and one of the
polyphenols is the flavonoid. Rat is one of the animals, which are widely used as
laboratory animals due to their similar anatomy to
mammals, and some other advantages such as easy
handling, their short life cycle, and they are readily
available. Moreover, rats resemble humans in most
conditions, and their reproduction also resemble those
of large mammals.9
Currently, there is no study that has determined the effect
pomegranate powder consumption against cigarette
smoke induced oxidative stress. Therefore, the objective
of this study was to evaluate the possible effects of
pomegranate in reducing the blood MDA content in
cigarette smoke exposed rats (Rattus norvegicus).
Pomegranate powder reduced malondialdehyde (MDA) 35
METHODS This study was conducted in a completely randomized
design that compared three groups of rats. The treatments
were R0 (control diet), R1 (95% of R0 + 5% of
pomegranate powder), and R2 (90% of R0 + 10% of
pomegranate powder). The experiment was carried out for
two months in an animal house at the Laboratory of Animal
Genetic and Breeding, Department of Animal Production
and Product Technology, Faculty of Animal Science, Bogor
Agricultural University, and at the Laboratory of
Biochemistry, Faculty of Medicine and Health Sciences
Syarif Hidayatullah State Islamic University, Jakarta. Subjects Thirty male white rats (Rattus norvegicus) of Sprague-
Dawley strain (3 weeks of age) with average body
weight of 80 g were used in this experiment. These
rats were divided into 3 groups (R0, R1 and R2) that
consisted of 10 rats each. These rats were individually
kept in a plastic cage. Pomegranate powder Pomegranate powder was commercial pomegranate
powder (Taify®). Nutrient composition of the
pomegranate powder is shown in Table 1. Diet and drink A standard diet of commercial feed for rats in powder
form was used. For the control rats no pomegranate
powder was added. For the treatment groups,
pomegranate powders were added at the final levels of 5
and 10%. All diets were made into -pellets. The pellets
were freely consumed (ad libitum) through oral (without
gavage) and were given weekly, for two weeks (14 days).
Food intake was measured by subtracting the amount of
food that was given with the amount of food that was
left. The result was divided by 7 days to obtain food
intake per day. Food intake was then multiplied with dry
matter (DM) content to obtain DM intake. Flavonoid
intake was calculated by multiplying DM intake with
flavonoid content of each treatment diet. Cigarette exposure Rats were exposed to cigarette smoke 3 times per day (in
the morning, at noon and in the evening) using 1
cigarette per rat. The cigarette used was a commercial
filter cigarette. A burning cigarette was place in a glass
36 Tjakradidjaja and Tjakradidjaja Med J Indones
cup and was put into each of the plastic cage. The top
of each of plastic cage was then fully covered with a
paper cartoon to expose the rats with cigarette smoke.
This treatment was applied until the cigarette was
burned, and the paper cartoon was then replaced. Blood sampling Blood sampling was taken at day-0, -8, and -15 by
cutting the tip of the tail (+0.5 cm from the tail tip); the
tail was then massaged from its base up to the tip of the
tail to collect the blood (2 ml). Blood was collected using
a vaccutainer and stored in an ice box to be brought to
the laboratory for MDA measurement. Malondialdehyde measurement Measurement of MDA level was done according to the
method of soewoto et al,10
in brief: the blood sample was
added to 0.50 mL of 10% cold TCA solution, which was
then centrifuged for 15 minutes. The supernatant formed
was added to 0.75 mL of 0.67% TCA solution, and the
mixture was then placed into a boiling-water containing
water bath for 10 minutes. After it was cold, it was read
using a spectrophotometer at a wavelength of 532 nm to
determine the MDA concentration. The MDA
concentration was obtained by dividing the absorption
with ε (ε=153.000 M-1
cm-1
).10
Data analysis The data obtained were noted and tabulated to be
entered and processed using Microsoft Excel 2007
software. All results were expressed as mean±standard
deviation. Statistical test to compare the three groups
was done using two ways repeated ANOVA’s test on
normal data. Differences were considered significant
if P< 0.05.
RESULTS All the rats were in healthy conditions throughout the
study. The diet was controlled every day and added
when necessary. Cages were cleaned once a week and
the replacement of husk as bedding was also carried
out at the same time. Every time after cigarette smoke
exposure the rats looked weak. The composition of nutrients in the diet
11 is presented in
Table 1. Addition of pomegranate powder into the diet
changed the composition. Generally, the amount of
almost all nutrients was increased; except for crude
protein, it decreased on the addition of pomegranate
powder at 5%, and a similar result was found in ash and
Beta-N contents when pomegranate powder was added
at 10%. The control diet already contained flavonoids.
With the addition of pomegranate powder, the
flavonoid content was increased nearly one-fold in R1,
and the increase was doubled in R2. Table 1. The content of nutrients in the diet
Nutrients Pomegranate Diet
powder R0 R1 R2
Dry matter (DM - %) 81.50 89.35 91.50* 91.46*
Ash (%DM) 5.06 8.66 8.81* 8.28*
Crude Protein (%DM) 4.86 18.18 17.4* 18.47*
Fiber crude (%DM) 16.82 10.44 11.47* 15.22*
Fat crude (%DM) 1.31 3.67 4.14* 4.20*
Beta N (%DM) 71.95 48.40 56.67* 45.29*
Energy (kcal/gram) 3855 3.88 4.04* 4.07*
Flavonoids (%/100g) 4.22 0.253 0.351* 0.566*
R0= control diet, R1= 95%R0+5% pomegranate powder, R2= 90%R0+10%
pome-granate powder, *= ANOVA test result: P < 0.01 compared to R0
Food intake in all three groups can be seen in Table 2.
There was no significant difference in food intake
between the three groups (P = 0.65). Flavonoid intakes
are presented in Figure 1. In R0 group, flavonoid intake
was lower than in that of R1 (P= 0.000) and R2 group
(P= 0.000). In R1 group, flavonoid intake was lower than
in the R2 group (P = 0.000). The addition of
pomegranate powder in the diet will increase the content
of flavonoids. The higher the addition of pomegranate
extract powder, the higher the flavonoid content will be. Tabel 2. Average of food intake in each group (g/head/day)
Groups First week2 Second week
2 P-value3
R0 10.40 (0.97) 10.50 (0.53) 0.65
R1 10.45 (0.52) 11.27 (1.62)
R2 10.30 (0.48) 10.70 (0.48) R0= control diet, R1= 95%R0+5% pomegranate powder, R2= 90%R0+10%
pome-granate powder, 2= Mean (standard deviation),
3= ANOVA test result
(mg
) in
tak
e F
lav
on
oid
Figure 1. Average flavonoid intake in the first and second week (mg).
40 Sjarif et al. Med J Indones
Anthropometric profiles of children with congenital heart disease Damayanti R. Sjarif,
1 Shirley L. Anggriawan,
2 Sukman T. Putra,
2 Mulyadi M. Djer,
2 12 Division of Pediatric Nutrition and Metabolic Disease, Department of Child Health, University of Indonesia, Jakarta, Indonesia
13 Division of Pediatric Cardiology, Department of Child Health, University of Indonesia, Jakarta, Indonesia
Abstrak
Latar belakang: Kekurangan gizi merupakan penyebab umum morbiditas pada anak dengan penyakit jantung
bawaan (PJB). Data dari negara berkembang memperlihatkan prevalensi malnutrisi penderita dengan PJB sebelum
dioperasi mencapai 45%. Penelitian ini bertujuan untuk mengetahui profil anhropometrik dan prevalensi
kekurangan gizi pada anak dengan PJB dengan melakukan pengukuran anthropometrik. Metode: Penelitian ini merupakan penelitian dengan rancang bangun cross sectional pada anak berusia 0-2 tahun
dengan PJB di RSCM. Pengukuran antropometri (berat badan, panjang badan, lingkar kepala) dilakukan pada
seluruh pasien. Kekurangan gizi, failure to thrive/FTT, perawakan pendek, mikrosefali dinilai dengan menggunakan
rekomendasi WHO tahun 2006, berupa perhitungan z-skor BB/PB, BB/U di 2 titik, PB/U dan LK/U < -2 SD. Hasil: Total subyek dalam penelitian ini berjumlah 95 orang, 73 orang dengan asianotik dan 22 orang dengan PJB
sianotik. Prevalensi kekurangan gizi sebesar 51,1% dengan 22,3% diantaranya adalah gizi buruk. FTT terdapat
pada 64,9%, perawakan pendek pada 49,5% dan mikrosefali pada 37% pasien. FTT ditemukan lebih banyak pada
pasien dengan lesi asianotik (72,2%) dibandingkan dengan lesi sianotik (42,9). Pada lesi asianotik, berat badan
lebih dipengaruhi daripada panjang badan (72,2% dengan 49,3%). Pasien dengan lesi sianotik, berat dan panjang
badan akan dipengaruhi secara seimbang (42,9% dengan 54.5%). Konsultasi diet diberikan kepada pasien dengan
kekurangan gizi. Terapi obat-obatan, intervensi transkateter atau bedah diindikasikan pada pasien tertentu. Kesimpulan: Prevalensi FTT lebih tinggi dibandingkan dengan kekurangan gizi pada anak dengan kelainan jantung
kongenital. FTT ditemukan lebih banyak pada pasien dengan lesi asianotik. Pada lesi asianotik, berat badan lebih
dipengaruhi daripada panjang badan. Pada lesi asianotik, berat badan lebih dipengaruhi daripada panjang badan. (Med J Indones 2011; 20:40-5)
Abstract
Background: Undernutrition is a common cause of morbidity in children with CHD. Previous data from developing
country showed prevalence of preoperative undernutrition in children with CHD was up to 45%. The aim of this study are to determine the anthropometric profiles and prevalence of undernutrition in children with CHD by using
the anthropometric measurement. Methods: A cross-sectional study was carried out in children aged 0-2 years old with CHD in Cipto Mangunkusumo
hospital. All patients underwent an anthropometric evaluation (weight, length and head circumference) at presentation.
Undernutrition, failure to thrive /FTT, short stature and microcephaly were determined according to WHO, weight-for-
length, weight-for-age at 2 points, length-for-age, head circumference-for-age z-score < -2SD accordingly. Results: We had total of 95 patients, 73 patients with acyanotic and 22 patients with cyanotic lesions. Prevalence of undernutrition in CHD was 51.1%, with 22.3% severe undernutrition. FTT was found in 64.9%, short stature in 49.5% and microcephaly in 37% patients. FTT was found higher in acyanotic (72.2%) compared to cyanotic lesions (42.9%). In acyanotic, weight was affected more than length (72.2% vs 49.3%). In cyanotic, weight and length affected equally (42.9% vs 54.5%). Diet counseling were done in patients with undernutrition. Medicines, transcatheter or surgery intervention were indicated in selected patients. Conclusions: Prevalence of FTT was higher than undernutrition in children with CHD. FTT was found higher in acyanotic
lesions. In acyanotic, weight was affected more than length. In cyanotic, weight and length affected equally. (Med J Indones 2011; 20:40-5) Key words: congenital heart disease, failure to thrive, short stature, undernutrition
Undernutrition is one of the malnutrition problem in
Indonesia. Data from National Socioeconomic Survey
(Survei Social Ekonomi Nasional/SUSENAS) 2007
showed the prevalence of children under 5 years who
had underweight is 18.4%. Indonesia‘s MDG
(Millenium Developmental Goal) in 2015 is to reduce
the prevalence of severe underweight to 3.3% and
moderate underweight to 18%.1
Undernutrition is a common cause of morbidity in
children with congenital heart disease (CHD).
Undernutrition can be caused by inadequate nutritional
intake or absorption, excessive energy expenditure,
frequent respiratory infections, limitation of growth
potential and genetic syndromes. Previous data from
developing country showed prevalence of pre operative
undernutrition in children with CHD was up to 45%.2,3
Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011
At birth, the weight and length of children with CHD
are typically normal or close to normal and APGAR
scores are generally high.4
Cyanotic patients are affected in growth, depending on
the severity of tissue hypoxemia and on the degree of
physiological adaptation. Weight and height are affected
equally in cyanotic patients. Acyanotic lesions,
especially in combination with septal defect, left to right
shunt, will affect weight more than height. Acyanotic
lesions were related to acute malnutrition, whereas
cyanotic lesions were related to chronic malnutrition.4,5
The aims of this study are to determine the anthro-
pometric profiles and prevalence of undernutrition in
children with CHD by using the anthropometric
measurement. Those measurements are useful in early
detection of CHD and assessing the prognosis of the
basic defects and their complications.
METHODS A cross-sectional study was carried out in children aged
0-2 years old with CHD who had consultation in our
outpatient clinic, cardiology division, department of
child health in Cipto Mangunkusumo Hospital, Jakarta.
This study was conducted from February to August
2009. Children should meet the inclusion criteria for age,
no definitive or palliative treatment were given and filled
up the informed consent. Consent was obtained in
accordance with the Ethical Committee Cipto
Mangunkusumo Hospital-University of Indonesia. All patients underwent an anthropometric evaluation
(weight, length and head circumference/HC) at
presentation. Echocardiography was done on the same
day to determine the type of CHD. Anthropometric data were analyzed using WHO
anthro 2006 (software for assessing growth and
development of the world’s children). Undernutrition,
failure to thrive, short stature and microcephaly were
determined according to weight-for-length, weight-
for-age at 2 points, length-for-age and head
circumference-for-age z-score < -2SD accordingly.6
RESULTS We had total of 95 patients, consisted of 52 (54.7%)
male and 43 (45.3%) female with age of gestation ranged
from 31 to 40 weeks. Their ages ranged from 0.49 to 24
months old with 12.8% of them had low birth weight.
Anthropometric profiles of children with congenital heart disease 41
Table 1. Age and anthropometric measurement (birth weight,
length, and weight) in children with CHD
Variable Minimum-maximum Median Age (month) 0.49 – 24 7,1 Birth weight (gram) 1300– 4000 3100 Birth length (cm) 30– 54 49 Weight (gram) 2415 – 13740 5750
Table 2. Anthropometric measurement (length, head circum-
ference, weight/length, weight/age, length/age, HC/
age z-score) in children with CHD
Variable Mean + Standar Deviation (SD) Length (cm) 64.93 + 8.92 Head circumference/HC (cm) 41.16 ± 3.94 weight/length z-score -1.93 + 1.57 weight/age z-score - 2.69 ± 1.51 length/age z-score -2.09 + 1.47 HC/age z-score -1.67 + 1.52
HC= head circumference; SD= standard deviation
Table 3. Prevalence of undernutrition, failure to thrive, short
stature and microcephaly in children with CHD
Variable < - 2 SD (%, 95%CI) < - 3 SD (%,95% CI) weight/length z-score 51.1% (40.4%-61.7%) 22.3% (13.4%-31.3%) weight/age z-score 64.9% (54.7%-75.1%) 46.8% (36.2%-57.4%) length/age z-score 49.5% (38.9%-60.1%) 30.5% (20.7%-40.3%) HC/age z-score 37% (26.5%-47.4%) 21,7% (12.8%-30.7%)
HC= head circumference; SD= standard deviation; CI= confidence interval
Acyanotic heart disease was present in 73 (76.8%) of all
patients whereas cyanotic heart disease affected 22 (23.2%).
The most common diagnoses were ventricular septal defect/
VSD (23.2%), patent ductus arteriosus/PDA (13.7%),
tetralogy of fallot/ TOF (12.6%), atrial septal defect/ASD
(7.4%) and valvular pulmonary stenosis (6.3%). Two or
more CHD were found in 27.8% patients. Study done in our
institution (1983-1992) showed the same results, with
76.7% acyanotic and 23.3% cyanotic CHD.7
Birth weight/age z-score < -2SD was 12.8% (95% CI
5.5%-20%), < -3SD 9.6% (95% CI 3.1%-16.1%),
mean -0.76 ± 1.31. Weight/age z-score < -2SD was
64.9% (95% CI 54.7%-75.1%), < -3SD was 46.8%
(95% CI 36.2%-57.4%), and mean -2.69 ± 1.51.
Birth length/age z-score <-2SD was 14.9% (95% CI
6.1%-23.6%), <-3 SD 5.4% (95% CI 0-11.2%), mean
-0.76 ± 1.38. Length/age age z-score < -2SD was
49.5% (95% CI 38.9%-60.1%), <-3SD was 30.5%
(95% CI 20.7%-40.3%) and mean -2.09 ± 1.47.
42 Sjarif et al. Med J Indones
WHO standards WHO standards
CHD ( N = 95 ) CHD( N = 95 )
Figure 1. Birth weight/age z-score Figure 2. weight/age z-score children with CHD
WHO standards
CHD ( N = 73)
Figure 3. Birth length/age z-score
WHO standards
WHO standards
CHD ( N = 95 )
CHD ( N = 95 )
Figure 4. Length/age z-score children with CHD
Weight/length z-score <-2SD was 51.1% (95% CI
40.4%-61.7%), < -3SD was 22.3% (95% CI 13.4%-
31.3%) and mean -1.93 ± 1.57. In acyanotic, weight/length z-score < -2SD was 54.2%
(95% CI 42%-66.4%), <-3SD was 22.2% (95% CI
11.9%-32.5%), mean -1.99 ± 1.47. In cyanotic, weight/
length z-score < -2SD was 40.9% (95% CI 18.1%-
Figure 5. Weight/length z-score children with CHD 63.7%), <-3SD was 22.7% (95% CI 2.9%-42.5%) and
mean -1.74 ± 1.88. In acyanotic, weight/age z-score < -2SD was 72.2% (95%
CI 61.2-83.3%), <-3SD was 50% (95% CI 37.8%-62.2%),
mean -2.76 ± 1.46. In cyanotic, weigth/age z-score <-2SD
was 42.9% (95% CI 19.3-66.4%), <-3SD was 33.3% (95%
CI 10.8%-55.9%) with mean -2.38 ± 1.47.
46 Kusumadewi et al. Med J Indones
Dietary iron intake, serum ferritin and haemoglobin levels, and cognitive
development scores of infants aged 6–8 months
Dian Kusumadewi,
1 Saptawati Bardosono,
1 Rini Sekartini
2 14 Nutrition Department, Faculty of Medicine, University of Indonesia, Jakarta, Indonesia
15 Child Health Department, Faculty of Medicine, University of Indonesia, Jakarta, Indonesia
Abstrak
Latar belakang: Defisiensi besi selama masa kanak-kanak dapat menimbulkan pengaruh buruk pada fungsi kognitif
dan perkembangan psikomotor. Penelitian ini bertujuan mengetahui kadar feritin serum dan hemoglobin dan
hubungannya dengan skor perkembangan kognisi pada usia 6-8 bulan. Metode: Rancangan penelitian potong lintang digunakan pada 76 bayi yang diperoleh dari beberapa Posyandu
terpilih di kelurahan Kampung Melayu, kecamatan Jatinegara, Jakarta yang memenuhi kriteria penelitian. Data
yang dikumpulkan meliputi usia, berat, panjang, lingkar kepala, asupan zat iron, feritin serum, haemoglobin dan
skor perkembangan kognitif dengan menggunakan Capute Scales method (Cognitive Adaptive Test/ Clinical Linguistic Auditory Milestone Scales/ CAT-CLAMS). Hasil: Dari 74 bayi usia 6-8 bulan yang menjadi subyek penelitian ini, 73% mempunyai asupan zat besi kurang dari
AKG (7 mg/hari), 18,9% mempunyai kadar feritin serum kurang dari normal (20 µg/L), dan 56,7% mempunyai
kadar hemoglobin kurang dari normal (11 mg/dL). Terkait dengan skor perkembangan kognitif, ditemukan skor
CAT yang lebih rendah secara bermakna pada subyek dengan kadar hemoglobin <11 mg/dL (p = 0,026). Kesimpulan: Sebagai upaya pencegahan dini terhadap gangguan perkembangan kognitif, disarankan agar sejak
usia 6 bulan mulai memperhatikan asupan zat besi dari makanan pendamping ASI agar tidak terjadi penurunan
kadar hemoglobin. (Med J Indones 2011; 20:46-9)
Abstract
Background: Iron deficiency during infancy may lead to negative effect on cognitive function and psychomotor
development. This study aimed to investigate serum ferritin, haemoglobin level and its relation to cognitive
development score in infants aged 6–8 months. Methods: This cross-sectional study was done on 76 infants recruited from several selected community health center in Kampung Melayu Village, Jatinegara Jakarta who had fulfilled the study criteria. Data collected consist of age, weight, height, head circumference, energy, protein and iron intake, serum feritin levels, haemoglobin levels and cognitive development score using Capute Scales method (Cognitive Adaptive Test/ Clinical Linguistic Auditory Milestone Scales/ CAT-CLAMS). Results: Among 74 infants aged 6-8 months, 73% had less dietary iron intake as compared to its RDA (7 mg/d), 18.9% were with serum ferritin less than normal value (20 µg/L), and 56.7% with haemoglobin levels less than
normal value (11 mg/dL). In relation to cognitive development score, this study revealed that the CAT score was significantly lower among subjects with hemoglobin value less than 11 mg/dL (p = 0.026). Conclusion: Early prevention of impaired cognitive development is urgently needed by providing iron-rich complementary
foods to infants since 6 months (mo) old to maintain the normal level of hemoglobin. (Med J Indones 2011; 20:46-9)
Key words: cognitive score, ferritin, hemoglobin, infants Iron deficiency anemia (IDA) is still remaining a global
nutritional problem all over the world1 especially in
developing countries, including Indonesia. The Survei
Kesehatan Rumah Tangga (SKRT) (Household health
survey) 2001 stated that IDA in Indonesia is as high as
61.3% among less than 6-mo old infants and 64.8% in 6–
11 mo infants. Survey done by Indonesian pediatricion
association 2004 found that among 4–12-mo infants in
Matraman district-Jakarta, 38% had anemia and 73%
had iron deficiency.2
Infants’ iron status is affected by many factors including
food intake, physiology (low birth weight), and
environment factors (socio-demographic background).
Depletion of iron storage can be identified using specific
indicators, such as serum ferritin level. However,
hemoglobin level is a parameter commonly measured to
detect anemia, although it can not specifically find out
the cause of the anemia.3
During infancy, IDA if not being treated properly will
result in negative effects on cognitive function and Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011 Dietary iron, serum ferritin and cognitive development score 47
in psychomotor development interference. Infants
with IDA have impaired psychomotor development
and would have even low psychomotor and mental
development compared to infants with iron deficiency
but not (yet) being anemic.4 Black et al. also stated
that micronutrient supplementation consisting of iron
and zinc each 20 mg every week for six months had
an advantage in motoric development.5 Faber et al.
6
found that infants at the age of 6–12 mo, who
consumed 40 g porridge fortified with 11 mg of iron
every day for six months would have an increase in
their iron status and developmental scores. This study aims to investigate dietary iron intake,
serum ferritin and hemoglobin levels and their relation
to cognitive development score among infants aged 6–
8 mo in Kampung Melayu Village, Jatinegara district
Jakarta Timur. METHODS Subjects The subjects were infants aged 6–8 months recruited from
several selected community health center in Kampung
Melayu during November 2009 to February 2010 who met
the study criteria: 1) male and female infants aged 6-8
months, 2) having normal gestational age and birth weight,
3) apparently healthy, and permitted by the mothers as the
respondents to participate in this study. Study design The study used a cross-sectional design to determine
the correlation between cognitive development score
and dietary iron intake, serum ferritin and hemoglobin
levels. Data collection Interview with the respondents was conducted to
obtain data concerning the characteristics of subjects
and respondents, to find out the infants’ intake from
breast feeding and complementary feeding using the
24-hour food recall and a one month semiquantitative
FFQ to assess the adequacy of iron intake among the
research subjects.7 In addition to interview, the
respondents were also asked to fill out a questionnaire
on cognitive development scores with Capute Scales
methode (Cognitive Adaptive Test/ Clinical Linguistic
Auditory Milestone Scales/ CAT-CLAMS).8
Subject´s weight and height were measured twice to
obtain the average measure. Nutritional status indicator
was analyzed using WHO anthro 2005 program.9
The laboratory examinations performed include the
assessment of hemoglobin and serum ferritin levels. The
sample of blood was drawn from the cubiti region which
was disinfected using alcohol 70% before the 1.5 ml of
venous blood was drawn. The hemoglobin level was
assessed using HemoCue method by placing two drops
of blood in the microcuvette. After the microcuvette was
completely filled, it was placed to the HemoCue
photometer. After several seconds, numbers indicating
hemoglobin levels would appear to be recorded. The
remaining venous blood was then placed to a vacutainer
and sent to Prodia laboratory to assess the serum ferritin
level using a method of Elisa.10,11
Statistical analysis All statistical analyses were performed using SPSS for
windows version 11.5. Data were expressed as mean ±
SD for normally distributed data and median
(minimum-maximum) for the non-normally
distributed data. Normality of the data distribution was
checked using Kolmogorov-Smirnov test before
further analysis. Based on the results of normality
tests, relationships between dietary iron, serum ferritin
and hemoglobin levels to cognitive development score
were performed using independent-t test or Mann-
Whitney U. Power of the study was 0.90 based on
assumption to be able to have mean difference of 10%
and probability for type I error α=0.05.12
RESULTS Subjects of the study There were 74 subjects participating in this study.
Data on the characteristics of the subjects include sex
and age and were furthermore collected from
anthropometric measurements and blood assessment.
Cognitive deve-lopment score was determined as the
outcome of the study. Subjects consisted of 46 (66.2%) boys and 28 (33.8%)
girls with median age of 6.79 mo. The median weight
was 7.4 kg, the average of length was 67.70 ± 3.13
cm, and head circumference 43.21 ± 1.56 cm, as
shown in Table 1.
48 Kusumadewi et al.
Tabel 1. Characteristics of infants under the study (n = 74) Variables value
Sex, n (%):
Male 49 (66.2) Female 25 (33.8)
Age in months, median (min-max) 6.79 (6.02 – 8.81) Weight in kg, median (min – max) 7.4 (5.35 – 14.50) Length in cm, mean ± SD 67.70 ± 3.13 Head circumference in cm, mean ± SD 43.21 ± 1.56
Iron status Table 2 shows that the median of dietary iron was 3.82
mg /d ranging from 0.42 mg/d to 14.4 mg/d. This study
revealed that 54 of the subjects (73%) had dietary iron
intake less than its RDA for Indonesian infants aged 7-12
mo (7 mg/d). The median serum ferritin level of the
subjects was 42.3 mg/L ranging from 2.37 mg/L to 333
mg/L. Fourteen subjects (18.9%) had serum ferritin level
less than 20 mg/L as the cut-off of its normal value. The
median of hemoglobin values found in this study was
10.80 mg/dL ranging from 7.60 mg/ dL to 13.80 mg/dL.
This study revealed that 42 subjects (56.8%) had
hemoglobin value less than 11 mg/dL, the cut-off for
anemic status for infants. Table 2. Cognitive score, iron intake, serum ferritin and hemo-
globin level of the subjects (n = 74)
Variables Value Cognitive score, median (min – max)
CAT score, median (min – max) 107.5 (75.7 – 148.0) CLAMS score, median (min – max) 114.25 (85.7 – 185.7)
Dietary iron in mg, median (min – max) 3.82 (0.42 – 14.4) % of iron requirement, median (min – max) 62 (4.2 – 193.33)
<RDA (7 mg/day), n (%) 54 (73) ³RDA, n (%) 20 (27)
Serum ferritin in mg/L, median (min – max) 42.3 (2.37 – 333.0) Iron deficiency 8 (10.8) Iron depletion 6(8.1) Normal 60(81.1)
Hemoglobin concentration, median (min – max) 10.80 (7.60 – 13.80) Moderate anemia 8 (10.8) Mild anemia 34(45.9) Normal 32(43.2)
Cognitive development status Cognitive development status was determined using
CAT and CLAMS scores. Table 2 shows that the median
of CAT-score was 107.5 with values ranging from 75.7
to 148.0. The median of CLAMS-score was 114.25 and
Med J Indones
values ranged from 85.7 to 185.7. To be able to see
factors related to the cognitive development scores,
this study analyzed whether the CAT-CLAMS scores
differed in relation to the iron status of each subject,
i.e. dietary iron, serum ferritin and hemoglobin status. Table 3 shows that the CAT score did not significantly
different in relation to the dietary iron and serum ferritin
status, however, the score was significantly higher (p
=0.026) among subjects having hemoglobin value >11
mg/dL. This study did not show any significant
difference in the relation between CLAMS score and
dietary iron, serum ferrtin and haemoglobin status.
Table 3. Relationships between cognitive development score (CAT) and dietary
iron intake, serum ferritin and haemoglobin levels
Variables Cognitive development p-value
score (CAT)
Dietary iron (mean ± SD) 0.419
<7 mg/day 109.11 ± 13.36 (independent-t test)
>7 mg/day 106.04 ± 117.01
Serum ferritin levels (median, min-max) 0.590
<20 mg/dL 103.95 (86 – 131.4) (Mann-Whitney U)
>20 mg/dL 107.75 (75.7 - 148)
Haemoglobin levels (median, min-max) 0.026
<11 mg/dL 101.85 (76.6 – 138) (Mann-Whitney U)
>11 mg/dL 113.15 (75.7 – 148)
DISCUSSION This study found that in general, iron status in terms of
dietary iron intake, serum ferritin and haemoglobin
levels were less than normal. This cross-sectional
study also shows a significant dependence of cognitive
development CAT-score on hemoglobin status. This study shows that the average of dietary iron intake of
the subjects from breastmilk and complementary foods was
lower than its RDA (7 mg/d) and 73% of the subjects had
low dietary iron intake. Theoretically, dietary iron intake is
related to iron content in breastmilk and complementary
foods, increased requirement in relation to the rapid growth
during infancy, iron malabsorption, and other pathological
conditions.1 The low dietary iron intake found in this study
was in accordance with the fact that breastmilk for the age
of 6-8 months infants will only provide approximately 0.03
mg/dL or 4.32 mg/d if receiving 6 times 240 mL
breastmilk/d. Thus, among infants aged 6 mo and over,
there is a need to have supplemented dietary iron from iron-
rich
50 Widjaja et al. Med J Indones
Highly active antiretroviral therapy adherence and its determinants in
selected regions in Indonesia Felix F. Widjaja,
1 Caroline G. Puspita,
1 Ferdi Daud,
1 Ienag Yudhistrie,
2 Marita R. Tiara,
3 Christopher S.
Suwita,1 Ekachaeryanti Zain,
4 Lailatul Husna,
5 Samsuridjal Djauzi
6 16 Faculty of Medicine Universitas Indonesia/RSUPN Cipto Mangunkusumo, Jakarta, Indonesia
17 Faculty of Medicine Universitas Brawijaya/RSU Saiful Anwar, Malang, Indonesia
18 Faculty of Medicine Universitas Padjajaran/RSU Hasan Sadikin, Bandung, Indonesia
19 Faculty of Medicine Universitas Hasanuddin/RSU Wahidin Sudirohusodo, Makassar, Indonesia
20 Faculty of Medicine Universitas Syiah Kuala/RSU Zainoel Abidin, Aceh, Indonesia
21 Department of Internal Medicine, Faculty of Medicine Universitas Indonesia/RSUPN Cipto Mangunkusumo, Jakarta, Indonesia
Abstrak
Latar belakang: Mengkonsumsi obat antiretrovirus dapat mengurangi morbiditas dan mortalitas orang dengan HIV/ AIDS
(ODHA). Tetapi, hal tersebut bergantung pada adherens terhadap pengobatan. Penelitian ini bertujuan untuk menilai
adherens obat antiretrovirus dan mengevaluasi karakteristik individu pasien (self-efficacy, tingkat depresi dan dukungan
sosial) yang menentukan adherens terhadap obat antiretrovirus di beberapa daerah di Indonesia. Metode: Studi potong lintang ini dilakukan di Jakarta, Malang, Bandung, Makasar, dan Banda Aceh. Subjek penelitian
kami adalah ODHA yang berumur lebih dari 13 tahun dan telah mengkonsumsi obat antiretroviral setidaknya satu bulan.
Subjek diambil secara konsekutif kemudian ditanyakan jumlah pil yang mereka tidak minum sejak satu bulan yang lalu.
Adherens dikatakan rendah apabila persentase rata-rata adherens di bawah 95%. Kami mengadaptasi HIV treatment
adherence self-efficacy scale (HIV-ASES), Beck Depression Inventory (BDI-II) dan Interpersonal Support Evaluation List
(ISEL) untuk menilai self-efficacy, tingkat depresi, dan dukungan sosial, secara berurutan. Hasil: Pada penelitian ini didapatkan 96% subjek penelitian (n=53) memiliki adherens yang baik terhadap pengobatan
antiretrovirus. Selain itu, tidak ditemukan adanya hubungan antara adherens dengan self-efficacy, tingkat depresi dan dukungan
sosial. Penyebab utama rendahnya adherens pada penelitian ini karena faktor lupa tanpa adanya alasan yang spesifik. Kesimpulan: ODHA di beberapa daerah di Indonesia memiliki adherens yang baik terhadap pengobatan antiretrovirus
dan adherens tersebut tidak berhubungan dengan self-efficacy, tingkat depresi dan dukungan sosial. (Med J Indones 2011; 20:50-5)
Abstract
Background: Highly active antiretroviral therapy (HAART) can reduce morbidity and mortality of HIV-infected
patients. However, it depends upon adherence to medication. The objective of this study was to examine the adherence to HAART and to evaluate individual patient characteristics i.e. self-efficacy, depression level, and social
support and to finally determine HAART adherence in selected regions in Indonesia. Methods: This cross-sectional study was conducted in Jakarta, Malang, Bandung, Makasar and Banda Aceh. The subject of the study was HIV-infected patients who were older than 13 years old and had taken HAART for at least a month. They were recruited consecutively then asked how many pills they had missed during the previous month. Poor adherence can be stated if the percentage of adherence rate is below 95%. HIV treatment adherence self-efficacy scale (HIV-ASES), Beck Depression Inventory (BDI-II) and Interpersonal Support Evaluation List (ISEL) was adapted to assess self-efficacy, depression level and social support, respectively. Results: We found that 96 % (n=53) of the subjects adhered to HAART. There were no associations between adherence
with self-efficacy, depression level, and social support. The main cause of non-adherence in this study was ‘simply forget’. Conclusion: Adherence to HAART was found to be high and not associated with self-efficacy, depression level and
social support in some central regions in Indonesia. (Med J Indones 2011; 20:50-5) Key words: adherence, depression, HAART, HIV, self-efficacy, social support
Acquired immunodeficiency syndrome (AIDS) is
caused by human immunodeficiency virus (HIV). The
virus attacks human immunity response, hence HIV-
infected patients would be easily infected by other
pathogens. Since the discovery of HIV in 1983, it has
become pandemic and a major cause of deaths by
opportunistic infections.1
According to Joined United Nations Programme for
HIV/AIDS (UNSAID) data in 2007, there were 33.2
million HIV-infected patients in the world, 2.1 million of
whom had died. The number of HIV-infected patients is
increasing annually although less newly HIV-infected
patients are recorded.2 The HIV epidemic in Indonesia is
among the fastest rising numbers in Asia. Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011 Adherence to HAART and its determinants 51
This is considered to result from the development of
intravenous drug users (IVDUs) since 1999.2,3
Although a cure for HIV infection is yet to be found, the
infection can be controlled. By taking highly active
antiretroviral therapy (HAART) regularly, viral replication
in HIV-infected patients can be suppressed. In addition,
drug resistance can be prevented in order to avoid morbidity
and mortality of HIV-infected patients.4 However, these
benefits depend upon adherence to medication due to the
complexity of antiretroviral therapy by using triple
regimens and due to the fact that this medication must be
taken life-long. Some studies showed reduction of viral load
and avoidance of chronic (opportunistic) diseases provided
the adherence rate was above 95%.4,5
There are many factors that may contribute to therapy
adherence including self-efficacy, social support and
depression level.6 Involvement of self-efficacy can be
seen by their persistence i.e. high motivation,
thoughts, cognition and affection to take the regimens
to improve the quality of life of the recent condition.7
Depression level and social support affect adherence
in psychological setting. Social stigma compels HIV-
infected patients fall into depression. However,
adequate social support may help them to overcome
these psychological symptoms and to gain
subsequently optimal medication adherence rate.6
The purpose of this study is to examine the proportion
of adherence to HAART and to evaluate factors (self-
efficacy, depression level, and social support) related
to adherence in selected regions in Indonesia. We
hypothesized that self-efficacy, depression level, and
social support influence the adherence of taking
medication in selected regions in Indonesia. METHODS Study Participants This cross-sectional study was conducted in five regions by
the Medical Faculties of five universities: Jakarta
(Universitas Indonesia), Malang (Universitas Brawijaya),
Bandung (Universitas Padjajaran), Makassar (Universitas
Hasanuddin) and Banda Aceh (Universitas Syiah Kuala). Between April 2009 and October 2009, in the five cities,
participants were recruited consecutively from ambulatory
care of each hospital or non-governmental organizations.
The participants were older than 13 years and had been in
treatment of HAART at least a month. HIV-
infected patients who were treated in the hospital and those
who refused to participate in this study were excluded. This study was approved by the Committee of Medical
Research Ethics of the Faculty of Medicine Universitas
Indonesia. Participants were given verbal and written
information about the study. Written informed consent
was obtained from all participants prior to inclusion into
the study. No financial incentives were provided and all
data were kept confidential. In order to validate our questionnaires and to measure
minimum sample size a preliminary study was conducted
with fifteen subjects at ambulatory care of Dharmais and
Cipto Mangunkusumo Hospitals, Jakarta. From this
study, we obtained that 93% of the subjects (n=15)
adhered to HAART therapy – the subsequent calculation
of the minimum number for this study was 25 subjects. Assessment Procedures The data was collected by asking the participants to
fill the questionnaires, which was accompanied by
surveyors to avoid misunderstandings and unnecessary
mistakes. Every participant took about 15 minutes to
answer all the questions. Measures Demographics. Demographic data included participants’
age, gender, marital status, education and employment. Medication. We asked whether the participants had
ever missed taking their antiretroviral medications. If
they answered ‘yes’, there were 12 questions about the
reasons with choices of “very rare”, “rare”, “often” or
“very often”. The frequency range described was
scored from 0-3, respectively. Medication adherence
was assessed with indirect methods by self-reporting,
asking the participants how many pills they had
missed to take during the previous month. Patients
were classified as adherent when not more than three
doses were missed and non-adherent if the patients
admitted having missed at least four doses during the
last month. We used one month recall period since we
assessed self-efficacy, depression level and social
support represented for the condition at that month. Self-efficacy. HIV treatment adherence self-efficacy scale
(HIV-ASES) developed by Johnson et al. 8 was assessed
with a 12-item scale of patient confidence to carry out
important treatment-related behaviour plans for nutrition,
exercise, etc. in front of barriers. Responses
52 Widjaja et al.
range from 1 (cannot do it at all) to 10 (certainly can do
it).8 Questions were translated to Indonesian language
and a preliminary study was conducted to assess the
validity and reliability of the questionnaire. Eight
questions were valid with excellent internal consistency
(Cronbach’s α = 0.858). In its adapted form, the scale
consists of eight items with a score range of 0-80 with
higher scores indicating higher confidence in ability to
carry out treatment-related behaviours. Depression Level. Beck Depression Inventory (BDI-II)
which consists of 21-items self-report instrument was
developed by Beck et al. 9 to assess the existence and
severity of symptoms of depression as listed in DSM IV.
There is a four-point scale for each item ranging from 0
to 3. There are also cut score guidelines which can be
adjusted according to the purpose of use.9 Questionnaires
were also translated, then validity and reliability were
tested in the same way as in the self-efficacy section.
Fourteen items were valid and the questionnaire was
shown to have excellent internal consistency
(Cronbach’s α = 0.88). The cut score was also modified
according to the number of items. In the total score, 0-8
is considered minimal range, 9-12 is mild, 13-18
moderate, and 19-42 is considered severe. Social Support. Interpersonal Support Evaluation List
(ISEL), which originally consists of 40 questions was
developed by Cohen et al. 10
to assess the perceived
availability of the four separate functions of social support:
appraisal items, tangible items, self-esteem items and
belonging items as well as providing an overall functional
support measure.10
In this study, we did not assess each
function separately. The translated questionnaire was
checked for validity: 12 items were valid and had reliable
psychometric properties (Cronbach’s α = 0.842). Each
question was scored ranging from 0 to 3. The modified
ISEL consists of 12 items with a score range of 0-36 with
higher scores indicating more social support. Participants were informed that their answers in self-
efficacy, depression level and social support sections
should represent their condition in the past month. Statistical Analysis Bivariate associations of numerical variables (social
support score and self-efficacy scale) with medication
adherence were analyzed using unpaired t-test or
Mann-Whitney test as an alternative. Kolmogorov-
Smirnov test was used to examine normality of data.
For analyzing depression level with medication
adherence, Mann-Whitney test was used. Probability
Med J Indones
value of ≤ 0.05 was considered significant. All
analyses were performed with SPSS® Statistic 17.0. RESULTS Description of the participants Demographic characteristics are shown by adherence
status in Table 1. The average age of patients (n=53)
was 32 years, 77.4% were male, 83% of our
participants had a senior high school degree or more,
and approximately half of them were married. There
were 6 unemployed participants (11.3%) in this study. Most patients (n = 28 or 52.8%) had ever missed taking
their medications. Among them, 64.29% forgot to take
their medication in the night, followed by 28.57% who
forgot it in the morning and the rest in the afternoon. The
major reasons affecting their adherence were simply
“forget” without any specific reasons (score = 34),
followed by “busy with other things” (score = 25), “run
out of medications” (score = 19) and “ashamed if seen by
others” (score = 18). There were 2 participants (3.8%)
who were classified as non-adherent indicating that they
missed at least four doses of their antiretroviral
medications over the previous month. The mean of self-efficacy was 70.11 (SD = 13.4) with
the highest score of 80. The distribution of these data
was not normal (p < 0.001). The depression level was
47.2% scored minimal, 17% mild, 17% moderate, and
18.9% scored severe. The mean of social support score
was 25.49 (SD = 5.95) with the highest score of 36.
The data distribution was normal (p = 0.200). Bivariate Analysis of associations between self-
efficacy, depression level and social support with
antiretroviral adherence In this study, we found that adherence was neither
associated with self-efficacy (p = 0.962), social
support (p = 0.474) nor depression level (p = 0.709). Although we did not hypothesize any relationship
between self-efficacy, social support and depression
level, we found that they were significantly related to
each other. The depression level was not categorized
and distribution of the data was not normal (p =
0.007), hence Spearman test was used. The correlation
between self-efficacy and depression level was weak
(r = -0.304, p = 0.027); as was the correlation between
self-efficacy and social support (r = 0.286, p = 0.038);
while correlation between depression level and social
support was moderate (r = -0.461, p = 0.001).
56 Endarti et al. Med J Indones
Access to health information may improve behavior in preventing Avian
influenza among women Ajeng T. Endarti,
1,2 Shamsul A. Shah
2 1Faculty of Health Sciences, Universitas Pembangunan Nasional “Veteran” Jakarta
2Department of Community Health, Faculty of Medicine, Universiti Kebangsaan Malaysia
Abstrak
Latar belakang: Peningkatan perilaku terhadap Flu burung dapat menurunkan risiko infeksi Flu burung. Tujuan
penelitian ini ialah untuk mengetahui faktor-faktor dominan yang mempengaruhi perilaku pencegahan penyebaran
penyakit Flu burung pada masyarakat.
Metode: Desain studi potong lintang dilakukan dalam bulan Juli 2008 untuk mengetahui perilaku yang diukur
dengan menghitung skor pengetahuan, sikap dan tindakan. Penelitian ini dilakukan di suatu kecamatan di Depok,
Jawa Barat, yang merupakan wilayah berisiko terjadinya penyebaran kasus Flu burung. Dalam menentukan unit
sampel, untuk memilih kepala rumah tangga digunakan metode multi stage sampling.
Hasil: Dari 387 responden 29,5% responden berperilaku baik terhadap penyakit Flu burung. Perilaku subjek yang baik
dipengaruhi oleh jenis kelamin dan akses terhadap informasi kesehatan. Perempuan dibandingkan lelaki 67% lebih tinggi
berperilaku baik terhadap penyakit Flu burung [risiko relatif (RRa) = 1,67; 95% interval kepercayaa (CI) = 0,92-3,04; P
= 0,092]. Sedangkan, subjek yang mempunyai dibandingkan yang tidak yang mempunyai akses terhadap informasi
kesehatan 3,4 lipat berperilaku baik terhadap penyakit flu burung (RRa = 3,40; 95% CI = 0,84-13,76; P = 0,087).
Kesimpulan: Akses terhadap informasi mengenai flu burung terutama efektif di antara perempuan untuk
meningkatkan perilaku penyakit flu burung. (Med J Indones 2011; 20:56-61)
Abstract
Background: Improving human behavior toward Avian influenza may lessen the chance to be infected by Avian
influenza. This study aimed to identify several factors influencing behavior in the community.
Method: A cross-sectional study was conducted in July 2008. Behavior regarding Avian influenza was measured by
scoring the variables of knowledge, attitude, and practice. Subjects were obtained from the sub district of Limo, in
Depok, West Java, which was considered a high risk area for Avian influenza. The heads of household as the sample
unit were chosen by multi-stage sampling.
Results: Among 387 subjects, 29.5% of them was had good behavior toward Avian influenza. The final model revealed
that gender and access to health information were two dominant factors for good behavior in preventing Avian influenza.
Compared with men, women had 67% higher risk to have good behavior [adjusted relative risk (RRa) = 1.67; 95%
confidence interval (CI) = 0.92-3.04; P = 0.092]. Compared to those with no access to health information, subjects with
access to health information had 3.4 fold increase to good behavior (RRa = 3.40; 95% CI = 0.84-13.76; P = 0.087).
Conclusion: Acces to health information concerning Avian influenza was more effective among women in
promoting good behavior toward preventing Avian influenza. (Med J Indones 2011; 20:56-61)
Key words: avian influenza, behavior, gender, health promotion
WHO have stated the risk of Avian influenza to humans
was almost confined to those who had close contact with
infected domestic poultry. The first Avian influenza
outbreak in Hong Kong in 1997 caused 18 cases with 6
deaths.1 The study revealed that live poultry markets
were the primary source of infection.2 The pandemic
then was started in Vietnam in 2003 and spread to other
Asian and African countries.1 In Indonesia, the number
of confirmed cases of human Avian influenza in 2006
was 28 cases with 71.4% deaths, and most of them had high
interaction with chicken and ducks.3 Authorities Network
showed a large number of confirmed human cases acquired
the infection during the slaughtering and subsequent
handling of diseased or dead birds prior to cooking.4
To prevent Avian influenza in high risk population,
farms or people with domestic poultry, behavioral
changes should be attempted. It can be through public Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011 Behavior in preventing Avian influenza 57
education and reinforced through behavioral counseling.
Based on research in Thailand,2 attitudes, which will
influence behavioral changes,5 such as how to protect
oneself from poultry with Avian influenza. The behavior
changed significantly after the respondents heard about
Avian influenza. These changes in human behavior,
included those related to food handling, can reduce the
opportunity to be infected by Avian influenza. Therefore
behavioral changes can become the most important way
to reduce the risk of further human infection.4
The importance of identifying preventive behavior in
Avian influenza have encouraged researchers to
conduct studies of knowledge attitude and practice in
Avian influenza on many different subjects. For
instance studying behavior among school children,1
poultry workers,6 health workers,
7 and people living
in high risk Avian influenza areas.8,9
The mode of transmission of Avian influenza is known
and many evidence showed that Avian influenza
occurrences in humans were due to unhealthy behavior
when in contact with poultry and also by unhygienic
behavior.2,10,11
Besides the behavioral factors, other non-
pharmaceutical interventions that can be utilized to
prevent Avian influenza were good surveillance and case
reporting and increasing rapid viral diagnosis.12
The aim of this study was to identify several dominant
risk factors influencing the behavior of the community
in preventing Avian influenza. METHODS This cross-sectional study was conducted in a sub district of
District Depok, West Java, Indonesia in July 2008 which
was considered to be a high risk area for Avian influenza. In
this area many homes keep poultry in the backyard, and the
poultry were not certified free of Avian influenza virus.13
In
addition, the location of sub district Limo borders with DKI
Jakarta Province (the second largest Avian influenza cases
in Indonesia)3 and the rate of migration of people between
these areas was high. Multi-stage sampling was used in determining the
sample. This method was suitable because there was a
hierarchy within study area, such as village and
neighborhood, to reach the sample unit (head of
household). The instrument for this study was modified from Avian
Flu Baseline Survey Backyard Poultry Farmers of
Vietnam (USAID 2006)
14 and A Guide for
Monitoring and Evaluating Avian influenza Programs
in Southeast Asia (USAID 2007) questionnaires.15
To
assure the reliability of the questionnaires, we conducted questionnaire tryouts to 20 persons. Behavior was defined as the respondent’s activities in
preventing the spread of Avian influenza. At the end
of the study, behavior was categorized into good
behavior and poor behavior based on Knowledge,
Attitude and Practice (KAP). Knowledge was the respondents’ knowledge about
Avian influenza (definition, symptoms, route of
transmission and preventive activities). Knowledge was
categorized into poor and good. If the respondents could
answer at least 6 questions correctly (from 10 questions),
the respondent knowledge was good (score 1). Attitude was response of the respondents about Avian
influenza. Attitude was categorized into poor and
good. If the respondents could answer at least 7
questions correctly (from 11 questions), the
respondent attitude was good (score 2). Practice was the respondent’s action in preventing the spread of
Avian influenza within their surroundings. Practice was
categorized into poor and good. If the respondents could
answer at least 9 questions correctly (from 14 questions), the
respondent practice was good (score 3). This categorization was used to decide whether the
respondent’s behavior was good or poor. From these
three variables (Knowledge, Attitudes and Practices) if
the sum of those variables were 6 the behavior was good.
But if the sum were less than 6 the behavior was poor. Variable such as access to health care was categorized
into good if respondents answered all three questions
(regarding accessibility, affordability, and satisfaction
to health services). Family/neighbor support was
categorized as good if they answered at least 2 out 3
questions. Age was grouped as young (18-29 years),
young adults (30-50 years), and old (50 years or older) Cox Regression was used to analyze data. This study
obtained ethical clearance from the ethical committee of the
Faculty of Medicine, Universitas Kebangsaan Malaysia.
RESULTS The study revealed there was about 29.5% out of 387
subjects with good behavior in preventing Avian
58 Endarti et al. Med J Indones
influenza. Subject with good behavior and poor
behavior was similarly distributed by educational
level, income, age group, ethnic, access to health care,
and family and community support (table 1). In the final model, gender and access to health
information were two dominant factors for good
behavior in preventing Avian influenza (table 2).
Compared with men, women had 67% higher risk to
good behavior [adjusted relative risk (RRa) = 1.67; 95%
confidence interval (CI) = 0.92-3.04; P = 0.092].
Compared to those with no access to health information,
those with access had 3.4 fold risk to good behavior
(RRa = 3.40; 95% CI = 0.84-13.76; P = 0.087).
Table 1. Several characteristics of subjects and the risk of good behavior in preventing Avian influenza
Poor Behavior Good Behavior Crude 95% confidence
relative risk interval P
(n=273) (n=114)
Educational level
Poor 187 71 1.00 Reference
Average 74 37 1.21 0.814-1.802 0.345
High 12 6 1.21 0.526-2.787 0.652
Income
Low 53 15 1.00 Reference
Middle 174 75 1.36 0.784-2.377 0.271
High 46 24 1.55 0.815-2.963 0.180
Age
Young group 37 24 1.00 Reference
Young adult 191 74 0.71 0.448-1.125 0.144
Old 44 15 0.64 0.339-1.232 0.185
Ethnic
Sundanese 36 16 1.00 Reference
Javanese 89 33 0.87 0.48-1.60 0.672
Betawi 132 59 1.00 0.58-1.74 0.989
Other 16 6 0.65 0.38-2.27 0.801
Access to health care
Poor 43 12 1.00 Reference 0.262
Good 230 102 1.40 0.77-2.56
Family and community support
Poor 166 68 1.00 Reference 0.859
Good 107 46 1.03 0.71-1.50
Table 2. The relationship between gender, access to health information and good behavior in preventing Avian influenza Poor Behavior Good Behavior
Adjusted relative risk 95% confident interval P
(n=273) (n=114)
Gender
Men 53 12 1.00 Reference 0.092
Women 220 102 1.67 0.92-3.04
Access to health information
No 21 2 1.00 Reference
Yes 251 112 3.40 0.84-13.76 0.087
66 Susanna et al. Med J Indones
The level of Escherichia coli contamination in foods and drinks sold at
canteens campus Dewi Susanna,
1 Tris Eryando,
2 Yvonne M. Indrawani
3 1 Department of Environmental Health, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia
22 Department of Biostatistics and Health Informatic, Faculty of Public Health, University of Indonesia, Depok
Campus, Jawa Barat, Indonesia
23 Department of Nutrition, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia
Abstrak
Latar belakang: Kontaminasi bakterial pada makanan yang disediakan di kantin kampus merupakan hal yang
sering terjadi dan dapat mengganggu aktivitas akademik. Penelitian ini bertujuan mengetahui tingkatan
kontaminasi Escherichia coli pada makanan dan minuman yang dijajakan di kantin sebuah kampus universitas. Metode: Sebanyak 49 makanan dan 24 jenis minuman diperiksa dengan menggunakan metode konvensional untuk pengukuran
Most Probable Number (MPN), yaitu uji penduga, uji penguat, dan uji pelengkap. Analisis kontaminasi pada makanan dan
minuman dilakukan di Laboratorium Kesehatan Lingkungan Fakultas Kesehatan Masyarakat Universitas Indonesia. Analisis data
dengan membuat tingkatan kontaminasi berdasarkan kelompok makanan dan minuman serta lokasi kantin. Hasil: Hampir semua kelompok makanan terkontaminasi. Makanan dengan sambal adalah makanan yang paling
berisiko untuk terkontaminasi E. coli (90,15 %), diikuti oleh makanan kering, sedangkan makanan berkuah adalah
yang paling kecil risikonya (38,89%). Minuman yang paling tinggi kontaminasinya adalah jus lacy, diikuti oleh jus
jambu, lalu jus sirsak dan orange di peringkat ketiga, sementara jus mangga kontaminas nya terendah. Jus melon,
cappucino dan coctail tidak menunjukkan adanya kontaminasi. Kesimpulan: Makanan dan minuman yang ditemukan pada tiga lokasi yang menduduki urutan tertinggi disebabkan
oleh terkontaminasinya alat makan dan tangan penjamah makanan. (Med J Indones 2011; 20:66-70)
Abstract
Background: Bacterial contamination is a common phenomenon in foods served in campus canteens and my cause
physical illness which will affect academic activity. The aim of this study was to rank the level of Escherichia coli
contamination in food and drink in campus canteens. Methods: Forty nine (49) foods and 24 types of drink were examined using conventional agar broth method for calculation of most probable number (MPN). The steps of the mothod were presumptive test for coliforms, fecal coliforms and E. coli, confirmes test for coliforms, fecal coli and E. coli and then completed test for E. coli. An analysis for contamination by E. coli in meals, utensils, and on the hands of the server was also undertaken. The data analyzed in percentage and rank all type of foods and drinks, also rank based on the location. Results: Almost all type of meals was contaminated. Meals with chili sauce were the most risky from the contamination of
E. coli (90.15 %), then followed by dry meals (38.89%), while the wet meals were the the most unrisky meals. In drinks,
the highest was lacy juice, followed by jambu (guava) juice, then Sirsak and Orange juices on the third rank, while the
mango juice was the lowest contamination. Melon juice, cappucino and fruit-coctail did not have E. coli contamination. Conclusion: The contamination in the top three rank of contamination could be from the utensils used and foodhandler. (Med J Indones 2011; 20:66-70) Key words: campus, canteen, drink, Escherichia coli, food
Meals that served for university members in campus,
mainly served in canteen and some by group of mobile
eatery in the area of the campus, which organized or not
by the faculty management. Meals contamination may
cause physical illness, which related to productivity of
the costumers, and will affect the academic activity. The
previous studies in the same area found that there were
quite low in knowledge on food hygiene and sanitation
of the food handlers.1,2
Canteen in the area of campus means a place where
people get meals. Canteen sometimes is also used for
discussion or for social events, and the peak time is
mostly during the lunch time. Each canteen served
different type of meals, from the very light meals to
heavy meals. It is necessary to monitor each canteen
about the bacterial contamination, for instance,
Esherichia coli, condition of sanitation, personal
hygiene, knowledge and practice of the food handler, Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011 Escherischia coli contamination in foods 67
as well as the materials and utensils used, since they are
all related to the so called food-borne diseases. Some
physical illness that related to hygiene and sanitation of
the meals are diarrhea, gastroenteritis and poisoning. 3
The Decree of Ministry of Health no.715/MENKES/
SK/V/2003 mentioned that it is necessary to control
food, people, place and the utensil uses to avoid
possible hazards or illness. The decree also mentioned
that every eatery or canteen need to have the licence
from local government, and for the hygiene and
sanitation aspect has to be certified by the local health
office. The workers in the canteen has their own
health standard, since they related directly to the foods
and the instruments that served to the costumers, so
they have to possess health and chef certificate, but
sometimes is neglected especially in small canteens. There are limited number of information and literature
on food hygiene and sanitation and so are researches in
this related area in Indonesia. Survey in Three type of
food establishment in Jakarta in 2003 study found that E.
coli contamination in served cooked, fresh cooked food,
and raw food were 12.2 %, 7.5 %, and 40 % respectively.
Contamination also found in water, food handlers and
kitchen utensil with various percentage, they were 12.9
%, 12.5 %, and 16.9 %.4 In an outbreak in Bogor (2005),
E. coli found in raw meat and beefsteak seemed to be
causative organism. 5
The source of E. coli contamination might be from meat,
milk, water, and food handlers. It have been proven that
all meat (100%) coming from abattoirs and traditional
markets were contaminated with E. coli O157:H7, in
addition to most of the fresh and pasteurized milk
samples (73.3%) coming from cattle ranches and home
industries. Contamination was also found in most of the
water samples (60%) and in food handlers (41.7%).6
Another study showed that there are more or les around
35 types of common bacteria exist in foods, some of
them are Bacillus, Camphylobacter, Clostridium,
Escherichia, Salmonella, Shigella, and Staphylococcus.7
One of the strains of E. coli is E. coli O157:H7. The contamination of E. coli O157:H7 will
risk people with diarrhea and could lead to
hemorrhagic colitis, hemolytic uremic syndrome (HUS), and thrombotic thrombocytopenic purpura (TTP), which is quite dangerous to human body. Canteen costumers in a campus are mostly students,
and they prefer to get cheap meals. The problem then
is not about cheap or expensive meals, but the most
important aspect is whether these meals are healthy or
save to be consumed. During first to fourth semester
2006, gastroenteritis was put at the second position of the
ten diseases in University of Indonesia, although moved
from 2 to 3 in first semester 2007. In order to know the
contaminating bacteria and to guarantee that the foods
and or drinks served by canteens are healthy, measuring
the presence Escherichia coli in food and drinks is
needed. The objective of this study was to measure the
existence of E. coli in all type of foods sold in canteens
around the campus of University of Indonesia.
METHODS This was a cross-sectional study, conducted around
campus of University ‘X’ (this is a university’s initial),
between 2007 and 2008. Thirteen canteens around the
Depok Campus of University of Indonesia were observed
for the presence of E. coli in meals served in each
canteen. For ethical purposes, the real name of the
canteens was given by the initial names. Those were A
for canteen from Faculty of Mathematic and Sciences, B
for Faculty of Engineering, C for Faculty of Law, D for
Faculty of Economic, E for Faculty of Psychology, F for
Faculty of Humanities, G for Faculty of Social and
Politics Science, H for Faculty of Public Health, I
Faculty of Nursing, J for Faculty of Computer Science, K
canteen next to the Tower, and finally L for Rectorate’s
canteen. There were 4 category of foods observed and
analyzed: dry foods where no water added in the meals,
wet foods, and food with sambal (chili) and sambals
itself. Food mixture with sambal is kind of traditional
meals; named as gado-gado, pecel, karedok, siomay,
which contain vegetables added or mixed with sambal
(mix of chili, peanut, onion, garlic, sugar, and salt). A
total of 49 type of foods were sampled, consisted of 18
dry food, 14 wet food, 9 food with sambal mixture or
poured, and 8 type of sambals that used in many different
type of meals. Twenty four types of drink were also
examined, which consisted of 16 juices, 4 iced teas, and
others. An analysis for contamination by E. coli in meals,
utensils, and on the hands of the server was also
undertaken. Each sample measured in food and drink, in
the utensil used for preparation and serving, and on the
hand of the food handlers. Data were collected by 5 trained collectors. Sample of
meals were analyzed in the Faculty of Public Health-
University of Indonesia Laboratory for the presence of E.
coli in meals and drinks using most probable number
(MPN) method. The data analyzed in percentage and in
68 Susanna et al. Med J Indones
rank of each category of meal for all type of foods, also made
rank based on the location where the samples were come from
with symbolic letters from A to M (13 locations). Colonies of the bacteria were calculated
using formula; colony 1
N = petridish p
s
Where; N: number of colonies per mL or gram
sample p: solution ratio s: volume (mL) or weight of the sample in grams RESULTS Totally there were 49 types of foods that divided into 4
categories. The examination found that almost all type
of meals from eah canteen were contaminated by E.
coli. Meals with sambal were the most risky from the
contamination of E.coli (90,15 %), then followed by
dry meals (38,89%), while the wet meals were the the
most unrisky meals. For the dry meals, rice with chicken grilled has the
highest contamination of E. coli, whereas Kweetiauw
was the lowest. Lontong sayur was in the first rank of
E.coli contamination in wet meals, while the lowest
contamination was lamb soup. In food with sambal,
karedok, gado-gado, pecel, and ketoprak were the type
of foods with higher contamination compared with
siomay. At last, the sambal in rib soup and in chicken
grilled were riskier than others type of sambals from
13 canteens around Campus. (Table 1) Table 2 shows the rank of ‘positive’ percent of E. coli
in drinks per mL from 13 canteens around campus,
2008. Tabel 1. The rank of ‘positive’ percentage of E. coli in foods (per mL) from 13 canteens around campus, 2008
Food Category Type of foods Number of Frequency Number Percentage of Rank of its category
measured (n=49) of measured of ‘positive’ ‘positive’ of foods
Dry meals Fried rice 7 21 5 23,88 4
Mix rice 3 9 4 44,44 3
Rice + chicken grilled 1 3 3 100,00 1
Padang rice 4 12 8 66,67 2
Kweetiauw 1 3 0 0,00 6
Fried noodle 2 6 1 16,66 5
Total 18 54 21 38,89 2
Wet meals Lamb soup 1 3 0 0,00 4
Tongseng 1 3 1 33,33 2
Meet soup 2 6 2 33,33 2
Chicken soto 3 9 1 11,11 3
Noodle soup 2 6 2 33,33 2
Meat soto 1 3 1 33,33 2
Rib soto 2 6 2 33,33 2
Lontong sayur 1 3 2 66,67 1
Noodle + chicken 1 3 1 33,33 2
Total 14 42 12 28,57 4
With Sambal Ketoprak 2 6 3 50,00 4
Gado-gado 4 12 10 83,33 2
Karedok 1 3 3 100,00 1
Pecel 1 3 2 66,67 3
Siomay 1 3 1 33,33 5
Total 9 21 19 90,15 1
‘Sambal’ in meat soup 1 3 1 33,33 2
in chicken soto 2 6 0 0,00 3
in noodle soto 1 3 1 33,33 2
in rib soup 2 6 4 66,67 1
for chicken grilled 1 3 2 66,67 1
for Padang rice 1 3 0 0,00 3
Total 8 24 8 33,33 3
Frequency of measured: in food, utensil, and food handler
66 Susanna et al. Med J Indones
The level of Escherichia coli contamination in foods and drinks sold at
canteens campus Dewi Susanna,
1 Tris Eryando,
2 Yvonne M. Indrawani
3 1 Department of Environmental Health, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia
24 Department of Biostatistics and Health Informatic, Faculty of Public Health, University of Indonesia, Depok
Campus, Jawa Barat, Indonesia
25 Department of Nutrition, Faculty of Public Health, University of Indonesia, Depok Campus, Jawa Barat, Indonesia
Abstrak
Latar belakang: Kontaminasi bakterial pada makanan yang disediakan di kantin kampus merupakan hal yang
sering terjadi dan dapat mengganggu aktivitas akademik. Penelitian ini bertujuan mengetahui tingkatan
kontaminasi Escherichia coli pada makanan dan minuman yang dijajakan di kantin sebuah kampus universitas. Metode: Sebanyak 49 makanan dan 24 jenis minuman diperiksa dengan menggunakan metode konvensional untuk pengukuran
Most Probable Number (MPN), yaitu uji penduga, uji penguat, dan uji pelengkap. Analisis kontaminasi pada makanan dan
minuman dilakukan di Laboratorium Kesehatan Lingkungan Fakultas Kesehatan Masyarakat Universitas Indonesia. Analisis data
dengan membuat tingkatan kontaminasi berdasarkan kelompok makanan dan minuman serta lokasi kantin. Hasil: Hampir semua kelompok makanan terkontaminasi. Makanan dengan sambal adalah makanan yang paling
berisiko untuk terkontaminasi E. coli (90,15 %), diikuti oleh makanan kering, sedangkan makanan berkuah adalah
yang paling kecil risikonya (38,89%). Minuman yang paling tinggi kontaminasinya adalah jus lacy, diikuti oleh jus
jambu, lalu jus sirsak dan orange di peringkat ketiga, sementara jus mangga kontaminas nya terendah. Jus melon,
cappucino dan coctail tidak menunjukkan adanya kontaminasi. Kesimpulan: Makanan dan minuman yang ditemukan pada tiga lokasi yang menduduki urutan tertinggi disebabkan
oleh terkontaminasinya alat makan dan tangan penjamah makanan. (Med J Indones 2011; 20:66-70)
Abstract
Background: Bacterial contamination is a common phenomenon in foods served in campus canteens and my cause
physical illness which will affect academic activity. The aim of this study was to rank the level of Escherichia coli
contamination in food and drink in campus canteens. Methods: Forty nine (49) foods and 24 types of drink were examined using conventional agar broth method for calculation of most probable number (MPN). The steps of the mothod were presumptive test for coliforms, fecal coliforms and E. coli, confirmes test for coliforms, fecal coli and E. coli and then completed test for E. coli. An analysis for contamination by E. coli in meals, utensils, and on the hands of the server was also undertaken. The data analyzed in percentage and rank all type of foods and drinks, also rank based on the location. Results: Almost all type of meals was contaminated. Meals with chili sauce were the most risky from the contamination of
E. coli (90.15 %), then followed by dry meals (38.89%), while the wet meals were the the most unrisky meals. In drinks,
the highest was lacy juice, followed by jambu (guava) juice, then Sirsak and Orange juices on the third rank, while the
mango juice was the lowest contamination. Melon juice, cappucino and fruit-coctail did not have E. coli contamination. Conclusion: The contamination in the top three rank of contamination could be from the utensils used and foodhandler. (Med J Indones 2011; 20:66-70) Key words: campus, canteen, drink, Escherichia coli, food
Meals that served for university members in campus,
mainly served in canteen and some by group of mobile
eatery in the area of the campus, which organized or not
by the faculty management. Meals contamination may
cause physical illness, which related to productivity of
the costumers, and will affect the academic activity. The
previous studies in the same area found that there were
quite low in knowledge on food hygiene and sanitation
of the food handlers.1,2
Canteen in the area of campus means a place where
people get meals. Canteen sometimes is also used for
discussion or for social events, and the peak time is
mostly during the lunch time. Each canteen served
different type of meals, from the very light meals to
heavy meals. It is necessary to monitor each canteen
about the bacterial contamination, for instance,
Esherichia coli, condition of sanitation, personal
hygiene, knowledge and practice of the food handler, Correspondence email to: [email protected]
Vol. 20, No. 1, February 2011 Escherischia coli contamination in foods 67
as well as the materials and utensils used, since they are
all related to the so called food-borne diseases. Some
physical illness that related to hygiene and sanitation of
the meals are diarrhea, gastroenteritis and poisoning. 3
The Decree of Ministry of Health no.715/MENKES/
SK/V/2003 mentioned that it is necessary to control
food, people, place and the utensil uses to avoid
possible hazards or illness. The decree also mentioned
that every eatery or canteen need to have the licence
from local government, and for the hygiene and
sanitation aspect has to be certified by the local health
office. The workers in the canteen has their own
health standard, since they related directly to the foods
and the instruments that served to the costumers, so
they have to possess health and chef certificate, but
sometimes is neglected especially in small canteens. There are limited number of information and literature
on food hygiene and sanitation and so are researches in
this related area in Indonesia. Survey in Three type of
food establishment in Jakarta in 2003 study found that E.
coli contamination in served cooked, fresh cooked food,
and raw food were 12.2 %, 7.5 %, and 40 % respectively.
Contamination also found in water, food handlers and
kitchen utensil with various percentage, they were 12.9
%, 12.5 %, and 16.9 %.4 In an outbreak in Bogor (2005),
E. coli found in raw meat and beefsteak seemed to be
causative organism. 5
The source of E. coli contamination might be from meat,
milk, water, and food handlers. It have been proven that
all meat (100%) coming from abattoirs and traditional
markets were contaminated with E. coli O157:H7, in
addition to most of the fresh and pasteurized milk
samples (73.3%) coming from cattle ranches and home
industries. Contamination was also found in most of the
water samples (60%) and in food handlers (41.7%).6
Another study showed that there are more or les around
35 types of common bacteria exist in foods, some of
them are Bacillus, Camphylobacter, Clostridium,
Escherichia, Salmonella, Shigella, and Staphylococcus.7
One of the strains of E. coli is E. coli O157:H7. The contamination of E. coli O157:H7 will
risk people with diarrhea and could lead to
hemorrhagic colitis, hemolytic uremic syndrome (HUS), and thrombotic thrombocytopenic purpura (TTP), which is quite dangerous to human body. Canteen costumers in a campus are mostly students,
and they prefer to get cheap meals. The problem then
is not about cheap or expensive meals, but the most
important aspect is whether these meals are healthy or
save to be consumed. During first to fourth semester
2006, gastroenteritis was put at the second position of the
ten diseases in University of Indonesia, although moved
from 2 to 3 in first semester 2007. In order to know the
contaminating bacteria and to guarantee that the foods
and or drinks served by canteens are healthy, measuring
the presence Escherichia coli in food and drinks is
needed. The objective of this study was to measure the
existence of E. coli in all type of foods sold in canteens
around the campus of University of Indonesia.
METHODS This was a cross-sectional study, conducted around
campus of University ‘X’ (this is a university’s initial),
between 2007 and 2008. Thirteen canteens around the
Depok Campus of University of Indonesia were observed
for the presence of E. coli in meals served in each
canteen. For ethical purposes, the real name of the
canteens was given by the initial names. Those were A
for canteen from Faculty of Mathematic and Sciences, B
for Faculty of Engineering, C for Faculty of Law, D for
Faculty of Economic, E for Faculty of Psychology, F for
Faculty of Humanities, G for Faculty of Social and
Politics Science, H for Faculty of Public Health, I
Faculty of Nursing, J for Faculty of Computer Science, K
canteen next to the Tower, and finally L for Rectorate’s
canteen. There were 4 category of foods observed and
analyzed: dry foods where no water added in the meals,
wet foods, and food with sambal (chili) and sambals
itself. Food mixture with sambal is kind of traditional
meals; named as gado-gado, pecel, karedok, siomay,
which contain vegetables added or mixed with sambal
(mix of chili, peanut, onion, garlic, sugar, and salt). A
total of 49 type of foods were sampled, consisted of 18
dry food, 14 wet food, 9 food with sambal mixture or
poured, and 8 type of sambals that used in many different
type of meals. Twenty four types of drink were also
examined, which consisted of 16 juices, 4 iced teas, and
others. An analysis for contamination by E. coli in meals,
utensils, and on the hands of the server was also
undertaken. Each sample measured in food and drink, in
the utensil used for preparation and serving, and on the
hand of the food handlers. Data were collected by 5 trained collectors. Sample of
meals were analyzed in the Faculty of Public Health-
University of Indonesia Laboratory for the presence of E.
coli in meals and drinks using most probable number
(MPN) method. The data analyzed in percentage and in
68 Susanna et al. Med J Indones
rank of each category of meal for all type of foods, also made
rank based on the location where the samples were come from
with symbolic letters from A to M (13 locations). Colonies of the bacteria were calculated
using formula; colony 1
N = petridish p
s
Where; N: number of colonies per mL or gram
sample p: solution ratio s: volume (mL) or weight of the sample in grams RESULTS Totally there were 49 types of foods that divided into 4
categories. The examination found that almost all type
of meals from eah canteen were contaminated by E.
coli. Meals with sambal were the most risky from the
contamination of E.coli (90,15 %), then followed by
dry meals (38,89%), while the wet meals were the the
most unrisky meals. For the dry meals, rice with chicken grilled has the
highest contamination of E. coli, whereas Kweetiauw
was the lowest. Lontong sayur was in the first rank of
E.coli contamination in wet meals, while the lowest
contamination was lamb soup. In food with sambal,
karedok, gado-gado, pecel, and ketoprak were the type
of foods with higher contamination compared with
siomay. At last, the sambal in rib soup and in chicken
grilled were riskier than others type of sambals from
13 canteens around Campus. (Table 1) Table 2 shows the rank of ‘positive’ percent of E. coli
in drinks per mL from 13 canteens around campus,
2008. Tabel 1. The rank of ‘positive’ percentage of E. coli in foods (per mL) from 13 canteens around campus, 2008
Food Category Type of foods Number of Frequency Number Percentage of Rank of its category
measured (n=49) of measured of ‘positive’ ‘positive’ of foods
Dry meals Fried rice 7 21 5 23,88 4
Mix rice 3 9 4 44,44 3
Rice + chicken grilled 1 3 3 100,00 1
Padang rice 4 12 8 66,67 2
Kweetiauw 1 3 0 0,00 6
Fried noodle 2 6 1 16,66 5
Total 18 54 21 38,89 2
Wet meals Lamb soup 1 3 0 0,00 4
Tongseng 1 3 1 33,33 2
Meet soup 2 6 2 33,33 2
Chicken soto 3 9 1 11,11 3
Noodle soup 2 6 2 33,33 2
Meat soto 1 3 1 33,33 2
Rib soto 2 6 2 33,33 2
Lontong sayur 1 3 2 66,67 1
Noodle + chicken 1 3 1 33,33 2
Total 14 42 12 28,57 4
With Sambal Ketoprak 2 6 3 50,00 4
Gado-gado 4 12 10 83,33 2
Karedok 1 3 3 100,00 1
Pecel 1 3 2 66,67 3
Siomay 1 3 1 33,33 5
Total 9 21 19 90,15 1
‘Sambal’ in meat soup 1 3 1 33,33 2
in chicken soto 2 6 0 0,00 3
in noodle soto 1 3 1 33,33 2
in rib soup 2 6 4 66,67 1
for chicken grilled 1 3 2 66,67 1
for Padang rice 1 3 0 0,00 3
Total 8 24 8 33,33 3
Frequency of measured: in food, utensil, and food handler
Vol. 20, No. 1, Februari 2011 Iron deficiency anemia 71
Iron deficiency anemia in the elderly Indra Kurniawan Pangkalbalam Public Health Centre & Bhakti Wara Hospital, Pangkalpinang, Bangka Belitung Archipelago, Indonesia
Abstrak
Jumlah kaum lanjut usia (lansia) di seluruh dunia mengalami pertumbuhan dengan pesat. Anemia merupakan masalah
hematologi yang paling utama pada lansia. Namun, anemia sebaiknya tidak dianggap sebagai konsekuensi penuaan yang
tidak dapat dihindari. Anemia pada lansia menandakan adanya suatu penyakit yang mendasari. Anemia Defisiensi Besi
(ADB) merupakan salah satu penyebab utama anemia pada lansia. ADB pada lansia menyebabkan terjadinya gejala-
gejala yang tidak spesifik. Diagnosis ADB biasanya didasarkan pada hasil laboratorium. Oleh karena itu, penggunaan
berbagai pemeriksaan laboratorium memegang peranan penting di dalam penegakkan diagnosis ADB. Adanya ADB pada
lansia biasanya berhubungan dengan terjadinya suatu kelainan gastrointestinal. Maka pada semua pasien dengan ADB
perlu dilakukan evaluasi gastrointestinal kecuali pada mereka yang mempunyai riwayat perdarahan non gastrointestinal
yang bermakna secara klinis. Lansia yang mengalami ADB perlu mendapat supplementasi besi, baik untuk mengkoreksi
anemia maupun untuk memperbaiki cadangan besi tubuh. Selain itu, juga harus dilakukan tatalaksana terhadap penyakit
yang mendasari untuk mencegah kehilangan besi lebih lanjut. (Med J Indones 2011; 20:71-7)
Abstract
The numbers of older people in the world have been growing rapidly. Anemia is the most common hematologic problem encountered in older adults. However, anemia should not be accepted as an inevitable consequence of aging. Anemia in the elderly signifies an underlying disease. Iron Deficiency Anemia (IDA) is being one of the most common causes of anemia in older people. IDA in the elderly is often associated with such non specific symptoms. The diagnosis of IDA is typically based on laboratory results. Hence, the utilization of the various laboratory tests plays an important role for the diagnosis of IDA. The presence of IDA in the elderly is usually related with gastrointestinal disorders. Thus, gastrointestinal evaluation should be contemplated in all patients with IDA unless there is a history of clinically important non gastrointestinal blood loss. Older people with IDA should have iron supplementation both to correct anemia and to replenish body iron stores. However, the underlying cause should always be treated to prevent further iron loss. (Med J Indones 2011; 20:71-7) Key words: anemia, elderly, gastrointestinal, iron deficiency
Anemia is defined as a reduction in the number of
circulating red blood cells, or the hemoglobin concentration
in the blood. The World Health Organization (WHO)
defined it as a hemoglobin (Hb) level <13 g/dL in men and
<12 g/dL in women. Anemia is extremely frequent in
elderly persons, defined in this article as those aged 65
years and older. A recent review of studies of anemia in
elderly patients (2008) confirms that anemia affects 1 in
every 7 or 8 older people living in the community.1,2
Nowadays, anemia is considered to be an important health
problem among the elderly. With advancing age, there is a
progressive and apparently physiological decrement of
marrow hematopoesis. However, anemia in the elderly is
due to disease and should never be considered as a normal
physiological response to ageing. 1,2
The causes of anemia in the elderly are diverse, with
anemia of chronic disease and iron deficiency anemia
being the most common causes. In community studies,
Iron Deficiency Anemia (IDA) outranks the anemia of
chronic disorders in prevalence, but the reverse is
encountered in hospital practice. The diagnosis of IDA is
important because proper iron therapy can improve the
symptoms, and investigations may help in detecting an
occult gastrointestinal pathology such as malignancy. 1,3,4
AGE-ASSOCIATED CHANGES IN
THE HEMATOPOIETIC SYSTEM The bone marrow is the site of production for blood
cells, such as circulating RBCs, granulocytes, and
platelets. As aging proceeds, the marrow becomes
increasingly localized to the axial skeleton. However, in
the non-diseased elderly, the total number of marrow
cells in the body is not decreased; it is similar to that of
healthy young adults. Consequently, clinical examination
of the marrow of older persons does not differ from that
of normal young adults. The prevalence of anemia is Correspondence email to:[email protected]
72 Kurniawan
increased in populations of community-dwelling, clinic
visiting, and hospitalized elderly. However, anemia is not a
consequence of aging. This supports the concept that older
persons develop anemia due to underlying disease.5
ETIOLOGY In the absence of any history of hemorrhage, iron
deficiency anemia in older people is sometimes related to
diet, but is usually a result of digestive disorder.
Focusing on digestive disorders, the etiology of IDA of
gastrointestinal origin can be divided into two groups:
situations with increased loss of iron and those with
decreased iron absorption. In the former, there could be a
hidden bleeding, which might be more difficult to
diagnose. Common causes include NSAID use, colonic
cancer or polyp, gastric cancer, angiodysplasia, and
inflammatory bowel disease. Rare causes include
previous gastrectomy, intestinal teleangiectasia, lym-
phoma, leiomyoma and other small bowel tumour. The
possible existence of a malignancy as the source of
anemia, which leads to early completion of endoscopic
examinations is a great concern.3,6-8
In the second category of etiology, reduced iron
absorption can be caused by celiac disease, atrophic
gastritis, and postsurgical status (gastrectomy,
intestinal resection). In a study on patients referred to
gastroenterologists because of IDA, celiac disease was
the diagnosis in at least 2-3% of cases. Microscopic
alterations in the duodenal mucosa in non-treated
celiac disease will lead to a refractory condition in
oral iron treatment. Gastroscopy with biopsy allowed
detection of gastritis with or without H.pylori. The
positivity of autoantibodies (anti-intrinsic factor or
anti-parietal cell) supports the diagnosis of
autoimmune atrophic gastritis. A recent meta-analysis
concluded that the infection of H.pylori is associated
with depleted iron deposits. The mechanism is not
clear, but it appears to involve gastrointestinal blood
loss, diminished iron absorption from the diet, and
increased consumption of iron by the bacteria.6,9
CLINICAL MANIFESTATION The clinical presentation of IDA depends on the degree
of anemia, the speed of onset, the underlying cause, and
the presence of comorbid conditions. IDA in the elderly
is often associated with such nonspecific symptoms as
general weakness, fatigue, functional decline, irritability,
poor concentration and headache. Sometimes, IDA
Med J Indones
causes no symptoms (asymptomatic) and could be found
only by laboratory survey. Although the impact of IDA
on the quality of life of the subject is high, they often get
used to their symptoms and these are assumed as normal.
The patient becomes aware of an improvement only
when the symptoms disappear. 4,10,11
Older people with IDA might have alopecia, atrophy
of lingual papillae, or dry mouth due to loss of
salivation. These changes were caused by reduction of
iron-containing enzymes in the epithelia and the
gastrointestinal tract. Some older people could have
other signs, such as cheilosis (fissures at the corners of
the mouth) and koilonychia (spooning of the
fingernails). The presence of these signs suggests that
there might be an advanced tissue iron deficiency.
Physical examination might be normal or show pallor
of varying intensity. Besides that, there might be a
systolic murmur in cardiac auscultation.4,10-12
LABORATORY FINDINGS The diagnosis of IDA is typically based on laboratory
results. There are various measurements of iron status.
No single measurement is ideal for all clinical
circumstances, as all are affected by confounding
factors. Hence, the utilization of the various
laboratory tests for the diagnosis of IDA is required. 26 Complete blood count
The World Health Organization (WHO) defines
anemia as the decline in blood hemoglobin to a concentration below 13 g/dl in men and 12 g/dl in
women. The diagnosis of anemia needs complete
blood count examination, including a measure of
the mean corpuscular volume (MCV). In this way,
the anemias can be characterized morphologically
as normocytic, microcytic, or macrocytic. Faced
with microcytic anemia, there are four main
diagnostic possibilities include iron deficiency
anemia (IDA), thalassemia, anemia of chronic
disorders, and sideroblastic anemia. The next step
in diagnosis should be directed toward
confirmation or exclusion of IDA. 5,10,12
27 Serum iron (SI) and total iron binding capacity
(TIBC)
The SI level represents the amount of circulating
iron bound to transferrin. The TIBC is an indirect
measure of the circulating transferrin. The SI and
TIBC give a measure of the iron supply to the
tissues. In normal subjects, SI shows a diurnal
rhythm, with values being lower in the morning
Vol. 20, No. 1, Februari 2011
than in the evening. In iron deficiency, however,
values stabilize at low levels respectively. A low SI
(<10 µmol/l) with increase in TIBC (>70 µmol/l) is
characteristic of iron deficiency. A serum transferrin
saturation (SI/TIBC × 100) that is persistently less
than 15% is insufficient to support normal
erythropoiesis, indicates iron deficiency states. 7,13,14
3. Serum ferritin Free iron is toxic to the cells, and the body has
established a set of protective mechanisms to bind
iron in various tissue compartments. Within cells,
iron is stored complexed to protein as ferritin.
Apoferritin binds to free ferrous iron and stores it in
the ferric state. Iron in ferritin can be extracted for
release by the RE cells. In normal conditions, the
serum ferritin level reflects total body iron stores.
Thus, the serum ferritin level is the most convenient
laboratory test to estimate iron stores. 13
The normal value for ferritin varies according to age
of the individual. Serum ferritin level tends to rise
with aging. In adults, a serum ferritin concentration
<15 µg/L is diagnostic of iron deficiency. However,
in the elderly, the diagnosis of IDA is highly likely
in those with ferritin levels of up to 45 µg/L. A low
serum ferritin level always indicates iron deficiency,
but normal value does not exclude this because
ferritin synthesis is influenced by factors other than
iron. It also acts as an acute-phase reactant in many
inflammatory diseases. Iron deficiency is highly
unlikely if the serum ferritin concentration is >100
µg/L. 7,13,14
4. Evaluation of bone marrow iron stores Bone marrow aspiration and staining for iron
(Prussian blue stain) provides a definite diagnosis
of IDA. It is considered to be the standard for
assessing iron status. However, in addition to
storage iron, the marrow iron stain provides information about the effective delivery of iron to
developing erythroblasts. Normally, when the
marrow smear is stained for iron, 20–40% of
developing erythroblast will have visible ferritin
granules in their eythoplasm. This represents iron
in excess of that needed for hemoglobin synthesis.
In iron deficiency anemia, RE iron and
erythroblast iron are absent. 7,13,14
5. Red cell protoporphyrin Protoporphyrin is an intermediate in the pathway to
heme synthesis. Under conditions in which heme
synthesis is impaired, protoporphyrin accumulates
within the red cell. This reflects an inadequate iron
supply to erythroid precursors to support
Iron deficiency anemia 73
hemoglobin synthesis. Normal values are <30 g/dL
of red cells. Concentrations greater than the normal
upper limit of 80 g/dL hemoglobin therefore indicate
iron deficiency. Protoporphyrin levels may also
increase in patients with sideroblastic anaemias and
lead poisoning. Convenient analysers measure zinc
protoporphyrin – the form in which most of the
protoporphyrin exists in iron deficiency. 13,14
Evaluation of iron status using the Zinc
Protoporphyrin /Heme (ZPP/H) ratio is another
diagnostic indicator of IDA diagnostic of early iron
depletion. The ZPP/H ratio reflects iron status in the
bone marrow during the formation of Hb. When iron
supply is diminished, Zn utilization increases
resulting in a high ZPP/H ratio. Das and Philip
compared the utility of ZPP/H ratio as a diagnostic
measure of IDA with bone marrow iron store
aspirates. They concluded that ZPP/H was reliable in
reflecting the bone marrow iron status except in the
pre-latent phase of iron deficiency. 15
6. Serum levels of transferrin receptor protein Serum transferrin receptor (sTfR) reflects eryt-
hropoesis and inversely the amount of iron available for
erythropoiesis. sTfR levels increase in the absence of
storage iron (absolute iron deficiency). sTfRs can
contribute significantly to the detection of IDA. Chang
et al. compared the utility of serum sTfR levels and
serum ferritin to bone marrow iron stores in identifying
IDA. They concluded that elevated sTfR levels were
found to be the most sensitive marker for the detection
of absent bone marrow iron (100%). This laboratory
test is becoming increasingly available and, along with
the serum ferritin, has been proposed to identifying
IDA. 13-15
INVESTIGATION The underlying cause of IDA should always be
investigated before treatment is begun, because in
many cases it is correctable. A study reported that in
most patients, the treatment of IDA will not be
effective if a cause for IDA is not found. History Poor iron deficient diets are sometimes found and a
dietary history should be taken to identify poor iron
intake. The use of aspirin and NSAID should be noted
and these drugs should be stopped when the clinical
indication is weak or other choices are available. Family
history of IDA (which may indicate inherited disorders
ISSN: 0853-1773