Matrix GLA Protein Stimulates VEGF Expression through ... · protein-2 (BMP-2) (19-21), a member of the transforming growth factor (TGF)-ß superfamily of growth factors critical

1

Matrix GLA Protein Stimulates VEGF Expression through Increased TGF-ß1 Activity in

Endothelial Cells

Kristina Boström, M.D., Ph.D.*¶ §, Amina F. Zebboudj, M.D.¶, Yucheng Yao, M.D., Ph.D.

¶, Than S. Lin, B.S. ¶, Alejandra Torres, B.S. ¶

¶ Division of Cardiology, David Geffen School of Medicine at UCLA,

Los Angeles, CA 90095-1679

§ Molecular Biology Institute, UCLA

*To whom correspondence and reprint requests should be addressed:

Kristina Boström, M.D., Ph.D.

Division of Cardiology, David Geffen School of Medicine at UCLA,

Box 951679, Room 47-123 CHS

Los Angeles, CA 90095-1679

Fax: 310-206-9133, Tel: 310-794-4417

E-mail: [email protected]

Short Title: MGP stimulates VEGF expression through TGF-ß1.

JBC Papers in Press. Published on September 27, 2004 as Manuscript M406868200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on August 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

2

ABSTRACT

Matrix GLA protein (MGP) is expressed in endothelial cells (EC), and MGP deficiency

results in developmental defects suggesting involvement in EC function. To determine the role of

MGP in EC, we cultured bovine aortic EC with increasing concentrations of human MGP

(hMGP) for 24 hours. The results showed increased proliferation, migration, tube formation, and

increased release of vascular endothelial growth factor-A (VEGF-A) and basic fibroblast growth

factor (bFGF). HMGP, added endogenously or transiently expressed, increased VEGF gene

expression dose-dependently as determined by real-time PCR. To determine the mechanism by

which hMGP increased VEGF expression, we studied the effect of MGP on the activity of

transforming growth factor (TGF)-ß1 compared to that of bone morphogenetic protein (BMP)-2

using transfection assays with TGF-ß- and BMP-response element reporter genes. Our results

showed a strong enhancement of TGF-ß1 activity by hMGP, which was paralleled by increased

VEGF expression. BMP-2 activity, on the other hand, was inhibited by hMGP. Neutralizing

antibodies to TGF-ß blocked the effect of MGP on VEGF expression. The enhanced TGF-ß1

activity specifically activated the Smad1/5 pathway indicating that the TGF-ß receptor activin-

like kinase 1 (ALK)1 had been stimulated. It occurred without changes in expression of TGF-ß1

or ALK1, but was mimicked by transfection of constitutively active ALK1, which increased

VEGF expression. Expression of VEGF and MGP were induced by TGF-ß1, but the induction of

MGP preceded that of VEGF, consistent with a promoting effect on VEGF expression. Together,

the results suggest that MGP plays a role in EC function, altering the response to TGF-ß

superfamily growth factors.

Key Words: Matrix GLA protein, TGF-ß, VEGF, endothelial cells, activin-like kinase 1 (ALK1),

angiogenesis.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

3

INTRODUCTION

Expression of matrix GLA protein (MGP) has been reported in vascular endothelium of

species as different as human and teleost fish (1,2), suggesting that MGP has a role in endothelial

cell (EC) function. In addition, several features in MGP deficiency in mice (3) and the human

equivalent, Keutel syndrome (4-8), suggest involvement of the vascular endothelium. Peripheral

pulmonary artery stenosis (4-8) may result from a failure in angiogenesis or fusion of peripheral

and central pulmonary vessels during lung development (9,10). Arterial calcification and

replacement of smooth muscle cells by cartilage-like cells (3) may be due to endothelial

dysfunction during vascular development (11). Loss of architecture and hypertrophic

chondrocytes in the bone growth plate (3) may in part be due to disturbed invasion of EC (12).

Furthermore, increased MGP expression has been reported in tube forming EC as determined by

subtractive hybridization (13), and in myometrial EC treated with vascular endothelial growth

factor (VEGF) as determined by microarray analysis (14). Altered expression of MGP has also

been reported in several types of malignancies, including glioma, ovarian cancer, colorectal

adenocarcinoma, and urogenital malignancies (15-18), and may relate to vascularization of the

tumors.

We have previously shown that MGP modulates the activity of bone morphogenetic

protein-2 (BMP-2) (19-21), a member of the transforming growth factor (TGF)-ß superfamily of

growth factors critical for morphogenesis and bone formation (22-25). TGF-ß1 is another

member of the same family, and is known to stimulate expression of VEGF in multiple cell types

(26-28). Two distinct TGF-ß signaling cascades have been identified within EC, the activin-like

kinase 1 (ALK1)-Smad1/5 pathway, and the ALK5-Smad2/3 pathway. ALK1 expression is

predominantly up-regulated in EC at sites of angiogenesis, and appears to have a stronger

involvement with the activation phase of angiogenesis, while ALK5 appears more involved with

the resolution phase (29-31).

The aim of this study is to determine whether MGP affects EC function. Our results

indicate that MGP promotes release of VEGF-A and basic fibroblast growth factor (bFGF), both


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

4

involved in angiogenesis. Furthermore, MPG increased VEGF gene expression through

enhanced TGF-ß1 activity without significant effect on expression of TGF-ß1, ALK1 or ALK5.

A concurrent inhibition of BMP-2 activity was detected. The enhanced TGF-ß1 activity

specifically activated the Smad1/5 pathway indicating that ALK1 had been stimulated by the

presence of MGP. The effect on VEGF expression was blocked by neutralizing antibodies to

TGF-ß, and mimicked by transfection of constitutively active ALK1, which also increased

VEGF expression. Expression of VEGF and MGP were induced by TGF-ß1, however, the

induction of MGP preceded that of VEGF, consistent with a role for MGP in promoting VEGF

expression. Together, the results suggest that MGP plays a role in EC function by altering the

response to TGF-ß growth factors, which in part may explain the vascular abnormalities seen in

MGP deficiency.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

5

METHODS

Cell Culture and Transfection Assays

Bovine aortic endothelial cells (BAEC) were purchased from VEC Technologies, Inc.

(Rensselaer, NY). They were cultured in Dulbecco’s modified Eagle’s medium (DMEM)

supplemented with 15% heat-inactivated fetal bovine serum (FBS) (Hyclone Laboratories,

Logan, UT), penicillin (100 U/ml), streptomycin (100 U/ml), sodium pyruvate (1 mM), and L-

glutamine (2 mM). Supplemented medium was discarded if not used within five days of its

preparation. The BAEC were used between passages 2-15, except for transfection experiments

when they were used between passages 2-6.

Transient transfections of BAEC were performed in quadruplicates in 24-well plates.

BAEC were plated onto 24-well plates at 3 x 104 cells/well 20-24 hours prior to transfection. The

cells were transiently transfected using 1.5 µl FuGene 6 reagent (Roche Molecular Biochemicals,

Indianapolis, IN) and 500 ng of DNA per well (usually 200 ng of luciferase reporter constructs,

200 ng of various expression constructs, and 100 ng of ß-galactosidase encoding construct as a

control for transfection efficiency). The total amount of expression construct was kept constant

with parental expression vector. Recombinant human TGF-ß1 (R & D Systems, Minneapolis,

MN), bovine bFGF (R & D Systems), recombinant human VEGF (R & D Systems), human

MGP or human BMP-2 were added at the time of transfection. Human MGP and BMP-2 were

added in the form of conditioned medium, and the methods to prepare the media and determine

the levels of MGP and BMP-2 respectively have been described previously (21). In experiments

where conditioned medium was used, the level of conditioned medium was kept constant at 80%

using sham-conditioned medium.

Cells were taken for analysis 24 hours after transfection. For luciferase assays, the cells

were lysed in 100 µl of Passive Lysis Buffer (PLB) (Promega, Madison, WI) per well. The cells

were freeze-thawed twice, and agitated for 15 min. Two 20 µl- and two 10 µl-aliquots from each

well were used for luciferase assays (Promega) and ß-galactosidase assays respectively.

Luciferase activity was determined using an AutoLumat LB953 luminometer (Perkin-Elmer


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

6

Corp., Norwalk, CT) and expressed as mean ± SD from quadruplicate transfections after

normalization to ß-galactosidase activity. Cell lysates were assayed for ß-galactosidase activity

by adding 190 µl of ß-galactosidase reagent to 10 µl of cell lysate, incubating at 37oC, and

reading the absorbance at 420 nm using a microplate reader (Molecular Devices, Sunnyvale,

CA). The ß-galactosidase reagent was prepared by mixing 350 µl ß-mercaptoethanol, 21 ml of 4

mg/ml O-nitrophenyl-ß-D-galactopyranoside, and 100 ml of ß-galactosidase buffer (100 mM

sodium phosphate buffer, pH 7.0 with 10 mM KCl, and 1 mM MgCl2) just prior to the assay.

RNA analysis

Total RNA was isolated using the RNeasy kit as per manufacturer’s instruction (Qiagen,

Valencia, CA).

Real-time PCR assays were performed using an Applied Biosystems 7700 sequence

detector (Applied Biosystems, Foster City, CA). Briefly, 2 µg of total RNA was reverse

transcribed with random hexamers using a MMLV Reverse Transcription Reagents kit

(Stratagene, La Jolla, CA) according to manufacturer’s protocol. Each amplification mixture (20

µl) contained 25 ng of reverse transcribed RNA, 8 µM forward primer, 8 µM reverse primer, 2

µM dual-labeled fluorogenic probe (Applied Biosystems), and 10 µl of Universal PCR mix

(Quantitect probe RT-PCR kit, Qiagen). PCR thermocycling parameters were 50oC for 2 min,

95oC for 10 min, and 40 cycles of 95oC for 15 sec and 60oC for 1 min. All samples were analyzed

for bovine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression in parallel in the

same run. Results of the real-time PCR data were represented as Ct values, where Ct was defined

as the threshold cycle of PCR at which amplified product was first detected. To compare the

different RNA samples in an experiment, we used the comparative Ct method (32,33), and

compared the RNA expression in samples to that of the control in each experiment. The primers

and probes were constructed so that the dynamic range of both the targets and the GAPDH

reference were similar over a wide range of dilutions (1:1–10,000). PCR was performed as

quadruplicates for each sample. The results were expressed as mean +SD for the relative


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

7

expression levels compared with the control, and minimums of four independent experiments

were performed. Primers and probes were designed by using Primer Express v1.5 software

(Applied Biosystems) as recommended in the manufacturer’s protocol to ensure suitability for

the ABI Prism 7700 sequence detection system and the reaction parameters. The following

bovine primers and probes were used: bovine VEGF (bVEGF) forward (F) (5’-

CCCACGAAGTGGTGAAGTTCA-3’), bVEGF reverse (R) (5’- CCACCAGGGTCTCGATGG-

3’), bVEGF Taqman probe (FAM- TCTACCAGCGCAGCTTCTGCCGT-TAMRA), bovine

MGP (bMGP) F (5’- GGGAAGCTTGTGATGACTTCAAA -3’), bMGP R (5’-

CGCTGCCGGTCGTAGGCAGCATTGTATCCA -3’), bMGP Taqman probe (FAM-

TTGCGAACGCTATGCCATGGTGT -TAMRA), bovine TGF-ß1 (bTGF-ß1) F (5’-

TGAAGTCTAGCTCGCACAGCAT -3’), bTGF-ß1 R (5’- GGTTCGGGCACCGCTT -3’),

bTGF-ß1 Taqman probe (FAM- TCTTCAACACGTCCGAGCTCCGG -TAMRA), bovine

GAPDH (bGAPDH) F (5’- GGCGCCAAGAGGGTCAT -3’), bGAPDH R (5’-

GTGGTTCACGCCCATCACA -3’), bGAPDH Taqman probe (FAM-

TCTCTGCACCTTCTGCCGATGCC -TAMRA), human ALK1 (hALK1) F (5’-

AGGGCAAACCAGCCATTG -3’), hALK1 R (5’- GGTTGCTCTTGACCAGCACAT -3’),

hALK1 Taqman probe (FAM- CACCGCGACTTCAAGAGCCGC -TAMRA), human MGP

(hMGP) F (5’- GGGAAGCCTGTGATGACTACAGA -3’), hMGP R (5’-

CGATTATAGGCAGCATTGTATCCA -3’), hMGP Taqman probe (FAM-

TTGCGAACGCTACGCCATGGTTT -TAMRA).

Semi-quantitative RT-PCR for ALK1, ALK5, and GAPDH was carried out using

previously described methods (19). The ALK1- and ALK5-primers were based on the human

sequences: ALK1 F (5’- ATTACCTGGACATCGGCAAC -3’), ALK1 R (5’-

TTGGGCACCACATCATAGAA -3’), ALK5 F (5’- GATGGGCTCTGCTTTGTCTC -3’),

ALK5 R (5’- CAAGGCCAGGTGATGACTTT -3’). The GAPDH primers have been described

previously (19). The annealing temperatures were 55oC for ALK1 and ALK5, and 58oC for

GAPDH. Densitometry using NIH Image J, version 1.62 (public domain program, Internet


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

8

address http://rsb.info.nih.gov/nih-image) was performed to compare the relative DNA levels

after normalization to GAPDH.

Immunoprecipitation of VEGF

Equal volumes (500 µl) of medium from treated BAEC were used for

immunoprecipitation of VEGF to improve VEGF detection in subsequent immunoblotting. After

pre-clearance with agarose-conjugated non-specific rabbit antibodies, 40 µl of agarose-

conjugated anti-VEGF antibody (A-20, Santa Cruz Biotechnology, Santa Cruz, CA) was added,

and incubation continued overnight at 4o C. The following day, the agarose was spun down, and

washed 3 times with RIPA-buffer (PBS with 1% Nonidet P-40, 0.5% sodium deoxycholate, and

0.1% SDS). Immunoprecipitated VEGF was recovered by boiling in electrophoresis sample

buffer, and detected by immunoblotting.

Immunoblotting

Immunoblotting was performed as previously described (19,21). Equal amounts of

cellular protein or culture medium were used. For analysis of VEGF in the culture medium, the

VEGF was first immunoprecipitated from 500 µl as described above. Blots were incubated with

specific antibodies to either VEGF (2 µg/ml; A-20, Santa Cruz Biotechnology), bFGF (2 µg/ml;

H-125, Santa Cruz Biotechnology), TGF-ß1 latency associated peptide (LAP) (0.2 µg/ml; R&D

Systems), P-Smad1 (0.4 µg/ml; Santa Cruz Biotechnology), P-Smad2/3 (0.4 µg/ml; Santa Cruz

Biotechnology), or Smad (0.4 µg/ml; H-465, Santa Cruz Biotechnology). For P-Smad

immunoblotting, 1 mM sodium fluoride and 1 mM sodium orthovanadate were added to the lysis

buffer. Densitometry using NIH Image J, version 1.62 was performed to compare protein levels.

Quantification of MGP

Quantification of MGP in tissue culture medium was performed as previously described

(21).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

9

Cell Proliferation Assay

BAEC were treated with hMGP-containing medium or control medium for 24 hours.

After treatment, the media were replaced by 300 µl fresh EC-medium which was left on the

treated BAEC for 24 hours. This medium was subsequently removed, supplemented with 1

µCi/ml of 3H-thymidine (Amersham-Pharmacia, Piscataway, NJ), and used in proliferation

assays.

Cell proliferation was determined by 3H-thymidine incorporation. BAEC were seeded in

6-well tissue culture dishes at a concentration of 5 x 104 cells per well. Cells were made

quiescent by incubation with serum free media for 4 h at 37 °C. The quiescent BAEC were

treated with the medium previously conditioned by BAEC exposed to no hMGP or to increasing

concentrations of hMGP. The cells were incubated at 37oC for 24 hours, washed in PBS, fixed in

5% trichloroacetic acid, and solubilized in 10M NaOH. Incorporation of [3H] thymidine was

determined by scintillation counter. Cell viability was assessed with Trypan Blue staining which

demonstrated >97% cell viability in all cells.

Migration Assay

BAEC were plated at 85% confluency in 6-well tissue culture dishes, and treated with

hMGP for 24 hours, until 100% confluency. Confluent monolayers were “wounded” with a

standard 20 µl pipette tip, after which the experiment was continued for the indicated number of

hours. Wound width was measured at 2, 5, and 24 hours through the use of the Scion Image

Analysis System (Scion Corporation, Frederick, MD).

Tube Formation Assay

Matrigel™ Matrix (BD Biosciences, Bedford, MA) was diluted 1:3 in EC medium

containing MGP-conditioned medium (final concentration of MGP 60 ng/ml) or the same

amount of sham-conditioned medium, and 300 µl was added to each well of a 12-well plate and


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10

incubated at 37oC for 30 min to allow polymerization. BAEC were suspended in the same EC-

medium containing MGP-conditioned medium (final concentration of MGP 60 ng/ml) at a

density of 5 x 104 cells/well, and 400 µl of the cell suspension was added to each well of the

plate and incubated for 48 hours in the presence or absence of MGP.

Vector constructions

The construct containing full-length hMGP cDNA has previously been described (19).

The TGF-ß responsive p3TP-lux luciferase reporter gene has previously been described (34).

The BMP-responsive luciferase reporter gene was obtained from Dr. Peter ten Dijke, The

Netherlands Cancer Institute, Amsterdam, The Netherlands, and has previously been described

(35). The construct for constitutively active ALK1 was obtained from Dr, Karen Lyons,

University of California, Los Angeles, CA.

Statistics

Data was analyzed for statistical significance by ANOVA with post-hoc Scheffe’s

analysis, unless otherwise stated. The analyses were performed using StatView, version 4.51

(Abacus Concepts, Berkeley, CA). All experiments were repeated a minimum of three times.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

11

RESULTS

MGP increases release of biologically active VEGF and bFGF in BAEC

Increased MGP expression has previously been reported in tube forming endothelial cells

as determined by subtractive hybridization (13), and VEGF has been reported to increase MGP

expression in myometrial EC (14). To determine whether MGP affects endothelial cell function,

assays for cell proliferation, cell migration, and tube formation were performed.

Cell proliferation was determined using 3H-thymidine incorporation in quiescent BAEC

exposed to medium from BAEC treated with hMGP (0-50 ng/ml) for 24 hours. Results showed

that BAEC proliferation increased significantly after exposure to medium from hMGP treated

cells compared to non-treated cells (Fig 1A), suggesting that MGP treatment stimulates release

of angiogenic factors. Cell migration was determined using the endothelial wounding assay in

confluent monolayers of BAEC that had been treated for 24 hours with MGP (0-100 ng/ml) prior

to wounding. Results showed a significant increase in migration after hMGP treatment (Fig 1B).

Tube formation was assessed in Matrigel where cells were exposed to hMGP (60 ng /ml) or

control medium for 24 hours. Results showed an increase in tube formation in the presence of

hMGP compared to control (Fig 1C).

To determine the effect of MGP on levels of VEGF and bFGF, BAEC were treated with

hMGP, at concentrations between 0 and 100 ng/ml. HMGP was added at the time of plating, and

after 24 hours VEGF and bFGF were determined in the medium and cellular extract using

immunoblotting. To better visualize VEGF from the medium, VEGF was immunoprecipitated

prior to immunoblotting. Results showed that hMGP stimulated the release of both VEGF-A (21

kDa) and bFGF into the medium, while the levels in the cell extracts remained constant or

decreased (Fig 2).

MGP increases expression of VEGF

To determine whether MGP also increased expression of VEGF, BAEC were treated with

hMGP at concentrations between 0 and 100 ng/ml. HMGP was added at the time of plating, and


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

12

after 24 hours VEGF expression was determined using real-time PCR and normalized to

GAPDH expression. Results showed a dose-dependent increase in VEGF expression (Fig 3A),

which increased approximately 4-fold after treatment with high levels of hMGP.

To determine whether over-expression of MGP using transient transfection would yield

similar results to exogenous treatment with MGP, BAEC were transfected with an expression

vector containing hMGP. Similar, but less pronounced, results were obtained in BAEC

transiently transfected with hMGP. The typical transfection efficiency in BAEC was 10-20%,

and VEGF expression increased approximately 1.5–2-fold when determined 24 hours after

transfection (Fig 3B). A corresponding increase of VEGF-A protein was detected in the medium

24 hours after transfection (data not shown). To ensure that the transfection of the hMGP vector

increased MGP expression and MGP levels in the medium, we performed real-time PCR for

bovine and human MGP normalized to bovine GAPDH, and quantified total MPG in the

medium. As expected, the results showed a large increase in human MGP expression after

transfection and also a small stimulation of bovine MGP (Fig 3C). The MGP concentration in the

medium increased significantly (Fig 3D).

TGF-ß1 and BMP-2 affects VEGF expression differently in BAEC

We have previously shown that MGP modulates BMP-2 signaling. Therefore, we

determined the effect on VEGF expression of BMP-2 and of TGF-ß1, a related growth factor

previously reported to stimulate VEGF expression in other cells (26-28). BAEC were treated

with BMP-2 (0-64 ng/ml) or TGF-ß1 (0-8 ng/ml) for 24 hours, after which VEGF expression

was determined using real-time PCR and normalized to GAPDH expression. Results showed that

VEGF-expression was mildly decreased in BMP-2 treated BAEC (Fig 4). However, TGF-ß1

dose-dependently increased VEGF-expression in BAEC (Fig 4), suggesting that TGF-ß1 is a

more likely the mediator of the effect of MGP than BMP-2.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

13

Effect of MGP on TGF-ß1 and BMP-2 activity

To determine the effect of MGP on TGF-ß1 and BMP-2 activity, we used transfection

assays where TGF-ß or a BMP-responsive luciferase reporter genes were transfected into BAEC

together with increasing amounts of hMGP expression construct (transfection efficiency 10-

20%). The cells were treated either with no exogenous growth factor or two different

concentrations of TGF-ß1 and BMP-2 respectively. BAEC express endogenous TGF-ß1 (Fig 8A,

below) and BMP-2 (36). The luciferase activity was determined after 24 hours of TGF-ß1 or

BMP-2 treatment, and was normalized to ß-galactosidase activity. The results showed that

increased expression of hMGP enhanced TGF-ß1 activity at each of the th ree levels of TGF-ß1

compared to control (no hMGP plasmid) (Fig 5A, the insert shows an enlargement of the bars on

the left, without exogenous TGF-ß1). This was paralleled by increased expression of VEGF

as determined by real-time PCR (Fig 5B, shown for 0 and 0.5 ng /ml of TGF-ß1). Real-time

PCR for bovine and human MGP was performed to ensure that hMGP expression increased after

transfection with hMGP construct (Fig 5C, compare Fig 3C & D). Since MGP enhances the

TGF-ß1 effect, the effect of MGP is dependent on the presence of TGF-ß1. Increasing the

exogenous TGF-ß1 from 0 to 0.5 ng/ml without adding MGP increases the luciferase activity

about 25-fold, and the VEGF expression about 1.5-fold. However, transfecting hMGP plasmid in

addition to the adding 0.5 ng/ml of TGF-ß1, increases the luciferase activity up to 100-fold and

the VEGF expression up to 4.5-fold. Thus, TGF-ß1 exerts a stronger effect in the presence of

MGP.

On the other hand, increasing expression of hMGP in BAEC treated with BMP-2

inhibited BMP-2 activity up to 60-70% at all levels of BMP-2 (Fig 6). Again, MGP expression

increased significantly after transfection with the hMGP construct similar to the results in figure

5C (data not shown).

Neutralizing antibodies to TGF-ß abolish the stimulating effect of MGP on VEGF expression


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

14

To confirm that the effect of MGP increases VEGF expression can be blocked by

inhibiting TGF-ß signaling, neutralizing TGF-ß antibodies were used. First, increasing amounts

of TGF-ß antibodies were added to BAEC, and VEGF expression was determined by real-time

PCR and normalized to GAPDH expression. Results showed that VEGF expression decreased up

to 40% in the presence of 50-600 ng/ml TGF-ß antibodies (Fig 7, left). BAEC were then treated

with increasing amounts of hMGP (0-50 ng/ml). As described above, MGP dose-dependently

increased VEGF-expression (Fig 7, middle). Finally, TGF-ß antibodies were added at 300 ng/ml

to BAEC treated with increasing amounts of hMGP (0-50 ng/ml). Results showed that the

neutralizing TGF-ß antibodies abolished MGP’s stimulatory effect on VEGF expression (Fig 7,

right), supporting that MGP increases VEGF expression by acting through TGF-ß1. These

experiments indicate that the effect of MGP in absence of exogenous TGF-ß1, is probably due to

endogenous TGF-ß1 expression. TGF-ß1 expression is detected by real-time PCR (Fig 8A), and

the TGF-ß1 protein is detected by immunoblotting (data not shown).

MGP does not affect expression of TGF-ß1, ALK1 or ALK5, or protein levels of TGF-ß1 LAP.

To determine whether changes in TGF-ß1, TGF-ß1 LAP, ALK1 or ALK5 would explain

the increased TGF-ß1 activity in presence of MGP, BAEC were treated with hMGP at

concentrations between 0 and 100 ng/ml, or transfected with increasing amount of hMGP

expression construct. After 24 hours, TGF-ß1 expression was determined using real-time PCR

and normalized to GAPDH expression. Results showed little effect of hMGP on TGF-ß1

expression in both hMGP-treated and hMGP-transfected cells (Fig 8A). MGP expression

increased significantly after transfection with the hMGP construct, similar to results in figure 3B

and 5C (data not shown). Expression of ALK1 and ALK5 was determined by semi-quantitative

RT-PCR using primers based on human ALK1 and ALK5 and normalized to GAPDH. The

bovine receptor genes have not been sequenced, and real-time PCR with human primers was less

consistent than semi-quantitative PCR. Results showed virtually no effect on ALK1 or ALK5

expression in hMGP-treated cells (Fig 8B). We also determined the TGF-ß1 latency associated


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

15

peptide (LAP) (37) by immunoblotting of the medium after hMGP-treatment, using an antibody

raised against human TGF-ß1 LAP. Changes in TGF-ß1 activation would be reflected in the

levels of TGF-ß1 LAP. However, the results showed little effect on protein levels of TGF-ß1

LAP in the hMGP-treated cells (Fig 8C). Together, these results do not explain the increased

TGF-ß1 activity, suggesting that MGP affects receptor-ligand interactions.

Stimulation of MGP Expression precedes that of VEGF expression after TGF-ß1 treatment

TGF-ß1 has been reported to stimulate both VEGF and MGP expression (26-28, 38-40).

In figure 4 we showed that TGF-ß1 does increase VEGF expression in BAEC after 24 hours of

treatment. To determine if TGF-ß1 also stimulates MGP expression, BAEC were treated with

TGF-ß1 (0-6 ng/ml) for 24 hours, after which MGP expression was determined using real-time

PCR and normalized to GAPDH expression. The results showed that TGF-ß1 significantly

increased MGP expression (Fig 9A).

Since both TGF-ß1 and MGP stimulated VEGF expression, and TGF-ß1 also stimulated

MGP expression, we treated BAEC with 0.5 ng/ml of TGF-ß1 and determined VEGF and MGP

expression by real-time PCR at different time points following the start of the treatment. The

results of this time course showed that MGP expression preceded VEGF expression (Fig 9B),

and thus, were consistent with a role for MGP in supporting VEGF expression.

MGP treatment Activates Smad1/5

TGF-ß1 activates the ALK1-Smad1/5 and ALK5-Smad2/3 pathway in EC (29-31).

ALK1 appears to have a stronger involvement with the activation phase of angiogenesis, while

ALK5 appears more involved with the resolution phase. Both receptors are expressed in our cells

(Fig 8C). To determine whether MGP activates SMAD1/5 or Smad2/3, we treated BAEC

without MGP or with 60 ng/ml of hMGP for time periods between one minute and four hours.

At each time point, cell lysates were prepared and immunoblotting for P-Smad1/5, P-Smad2/3,

and total Smad was performed. The results showed a clear Smad1/5 activation after one hour in


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16

samples treated with MGP compared to control cells (Fig 10). No activation or a mild inhibition

of Smad 2/3 was detected. This suggests that MGP selectively promotes TGF-ß signaling

through ALK1.

Constitutively active ALK1 mimics the effect of MGP on VEGF expression

To determine whether constitutively active (ca)ALK1 would mimic the effect of MGP on

VEGF expression, we transfected the BAEC with a caALK1 construct (transfection efficicency

10-20%). The VEGF expression was determined 24 hours after transfection by real-time PCR,

and normalized to GAPDH. The results showed that caALK1 increased VEGF expression

significantly (Fig 11A), thus mimicking the effect of MGP. Real-time PCR for ALK1

normalized to GAPDH was performed to ensure that the ALK1 concentration increased after

transfection with caALK1 construct (Fig 11B).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

17

DISCUSSION

MGP expression has been reported in vascular endothelium in species as different as

human and teleost fish (1,2), suggesting that MGP has a role in EC function. Several features in

MGP deficiency (3-8) suggest involvement of vascular endothelium including peripheral

pulmonary stenosis that may result from a failure in angiogenesis or vessel fusion (9,10), arterial

calcification that may relate to endothelial dysfunction during vascular maturation (11), and loss

of architecture and hypertrophic chondrocytes in the bone growth plate that may relate to

disturbed vascularization (12). Increased MGP expression has been reported in tube forming EC

as determined by subtractive hybridization (13), and in myometrial EC treated with VEGF as

determined by microarray analysis (14). Altered expression of MGP has also been reported in

several types of malignancies, including glioma, ovarian cancer, colorectal adenocarcinoma, and

urogenital malignancies (15-18), possibly related to vascularization.

In this study we demonstrated for the first time that MGP affects EC function and

promotes release of VEGF-A and bFGF. Focusing on VEGF, we found that MPG increased

VEGF expression through a previously unrecognized enhancement of TGF-ß1 signaling through

the ALK1-Smad1/5 pathway. The inhibitory effects on BMP-2 activity are consistent with our

previous results demonstrating that MGP is able to inhibit BMP-2 activity in cells of

mesenchymal origin, including pluripotent C3H10T1/2 cells (19), marrow stromal cells (20) and

calcifying vascular cells (21). BMP-2 belongs to the same superfamily of TGF-ß growth factors

as TGF-ß1 (22-25), and is critical for morphogenesis and bone formation. Together, our results

suggest that MGP affects several of the TGF-ß growth factors, thereby having the ability to alter

the overall response to TGF-ß growth factors. This concept would be consistent with the wide

range of vascular and non-vascular abnormalities seen in MGP deficiency (3-8), and may also be

consistent with a role for combined TGF-ß / BMP regulation in SMC differentiation. The

Krüppel-like transcription factor 4 (KLF4/GKLF) has been identified as a target of both BMP

and TGF-ß1 in regulation of vascular SMC phenotype (41), and may be an important mediator.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

18

Such a regulatory step would likely occur at a stage subsequent to the specification of arteries

and veins since only arterial calcification is seen in MGP deficiency (3,4).

TGF-ß1 is expressed in the vascular intima during development (42), where it could

affect both EC and SMC. Heterozygous knockout mice for TGF-ß1 with reduced levels of TGF-

ß1 in the aorta have an endothelium that is more easily activated by cholesterol-enriched diets,

and reduced SMC differentiation (43). TGF-ß1 has been shown to be affected by different forms

of fluid shear stress in BAEC (44), and may play a role in determining the vessel lumen or

caliber size (45). In addition, TGF-ß1 is a major modulator of angiogenesis involved in the

regulation of both the activation and the resolution phase of angiogenesis (29-31). The TGF-

ß/ALK5 pathway has been shown to lead to inhibition of cell migration and proliferation, while

the TGF-ß/ALK1 pathway induces EC migration and proliferation and can directly antagonize

signaling through ALK5 (30,31). However, EC lacking ALK5 are deficient in TGF-ß/ALK1

induced responses (31), demonstrating interdependence between the two receptors.

BMP-2 is expressed in the aorta when it is essentially a tube lined by a single layer of

cells (46), and is involved in interactions between ectodermal and mesodermal cells during

development (47,48). Furthermore, it has a role in EC differentiation; BMPER, a recently

described BMP antagonist in EC inhibits both BMP signaling and EC differentiation (49). BMP-

2 has been implicated in angiogenesis through osteoblast-derived VEGF-A (50), and BMP-2

stimulated angiogenesis has been reported in developing tumors (51).

Both TGF-ß1 and BMP-2 are in locations to potentially interact with MGP during

development since MGP is expressed throughout the developing vascular wall (3). Disturbances

in such interactions may yield different results depending on where in the vascular tree they

occur, e. g. stenoses in the peripheral pulmonary arteries, and calcification in the arteries (3-8).

To define the mechanism by which MGP enhances TGF-ß1 activity, we excluded that

expression of TGF-ß1, ALK1 and ALK5 was increased by MGP. We also excluded that MGP

decreased the level of TGF-ß1 LAP (37), which might have explained the enhancement.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

19

The effect of MGP on proliferation, migration, and tube formation would be most consistent with

an activation of ALK1-Smad1/5 signaling (29), and our immunoblots did show an increase in P-

Smad1 indicating that this was the case. In contrast, no increase was detected in P-Smad2/3

indicating that ALK5 signaling was not activated. The TGF-ß-responsive luciferase reporter gene

did not distinguish between ALK1 and ALK5 activation (31). Furthermore, transfection of

constitutively active ALK1 mimicked the effect of MGP on VEGF expression. Together, our

results suggest that MGP interferes in receptor-ligand interactions, which is now under further

investigation.

There are different ways in which MGP could interfere in receptor-ligand interactions. It

may activate TGF-ß by direct binding in the extracellular space, analogous to connective-tissue

growth factor (CTGF), another modulator of TGF-ß1 and BMP-2 (52). We and other

investigators have previously shown protein-protein interaction between BMP-2 and MGP

(20,53,54), and modulation of BMP-2 activity (19-21). Alternatively, it may target specific

ligand-receptor complexes analogous to endoglin (55) or betaglycan (51), or it may alter the

balance between signaling through the canonical SMAD-pathway and other, non-canonical

signaling pathways (25).

MGP may have a role in lung morphogenesis through TGF-ß and VEGF. MGP

expression is observed throughout lung morphogenesis. It has been localized to the submucosal

layers in the developing respiratory tract in mice (57), and has been associated with lung

branching (58,59). TGF-ß and VEGF are both involved in the development and maintenance of

lungs (10,60), where correct spatial and timely expression of TGF-ß, TGF-ß receptors, and

VEGF is crucial for morphogenesis. For instance, constitutively active TGF-ß1 perturbs

epithelial cell differentiation and formation of pulmonary vasculature (61), and misexpressed

VEGF increases pulmonary vasculature but disrupts branching in developing respiratory

epithelium (62).

In the growing bone, endothelial cells and pre-osteoblasts invade the calcifying zone of

the growth plate, and a balance exists between the osteoblastic differentiation, apoptosis of


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

20

hypertrophic chondrocytes, and vascularization (12). Low expression of MGP in hypertrophic

chondrocytes has been shown to induce apoptosis (63), and may explain the lack of these cells in

MGP deficiency. However, in light of our results, MGP deficiency could also explain poor

vascular invasion that may result from abnormal TGF-ß1 activity and low VEGF expression.

MGP is regarded as an inhibitor of vascular calcification (1,3-5). However, it is difficult

to define the mechanism of this protective role of MPG in atherosclerotic plaques. In addition to

endothelial expression, MGP expression has been detected in vascular medial cells and

macrophages (1,64), and as a secreted protein, it may affect neighboring cells. It may modulate

BMP-2 and inhibit BMP-2 induced osteogenesis as suggested by previous results (21), or it may

promote SMC differentiation or fibrosis through modulation of TGF-ß1 activity (65).

Alternatively, MGP may affect calcification through plaque angiogenesis (12).

Altogether, our results support a role for MGP in endothelial cell function, and in altering

the overall cellular response to TGF-ß growth factors.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21

ACKNOWLEDGEMENT

This work was funded in part by NIH grant HL04270, NIH grant HL030568, the

American Heart Association (National), and the Laubisch Fund.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

22

REFERENCES

1. Engelse, M. A., Neele, J. M., Bronckers, A. L. K. K., Pannekoek, H., and de Vries, C. J.

M. (2001) Cardiovasc. Res. 52,281-289.

2. Simes, D. C., Williamson, M. K., Ortiz-Delgado, J. B., Viegas, C. S. B., Price, P. A, and

Cancela, M. L. (2003) J. Bone Miner. Res. 18,244-259.

3. Luo, G., Ducy, P., McKee, M. D., Pinero, G. J., Loyer, E., Behringer, R. R., and

Karsenty, G. (1997) Nature 386,78-81.

4. Meier, M., Weng, L. P., Alexandrakis, E., Ruschoff, J., and Goeckenjan, G. (2001) Eur.

Respir. J. 17,566-569.

5. Munroe, P. B., Olgunturk, R. O., Fryns, J.-P., Van Maldergem, L. V., Ziereisen, F.,

Yuksel, B., Gardiner, R. M., and Chung, E. (1999) Nature Genet. 21,142-144.

6. Teebi, A. S., Lamber, D. M., Kaye, G. M., Al-Fifi, S., Tewfik, T. L., and Azouz, E. M.

Am. J. Med. Genet. 78,182-187.

7. Ziereisen, F., De Munter, C., and Perlmutter, N. (1993) Pediatr. Radiol. 23,314-315.

8. Cormode, E. J., Dawson, M., and Lowry, R. B. (1986) Am. J. Med. Genet. 24,289-294.

9. deMello, D. E., and Reid, L. M. (2000) Ped. Dev. Path. 3,439-449.

10. Warburton, D., Schwarz, M., Tefft, D., Flores-Delgado, G., Anderson, K. D., and

Cardoso, W. V. (2000) Mech. Dev. 92,55-81.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

23

11. Hirschi, K. K., Skalak, T. C., Peirce, S. M., and Little, C.D. (2002) Ann. N.Y. Acad. Sci.

961,223-242.

12. Gerber, H.-P., and Ferrara, N. (2000) Trends Cardiovasc. Med. 10,223-228.

13. Glienke, J., Schmitt, A. O., Pilarsky, C., Hinzmann, B., Weiß, B., Rosenthal, A., and

Thierauch, K.-H. (2000) Eur. J. Biochem. 267,2820-2830.

14. Weston, G. C., Havis, I., and Rogers, P. A. W. (2002) Mol. Human Reprod. 8,855-863.

15. van den Boom, J., Wolter, M., Kuick, R., Misek, D. E., Youkilis, A.S., Wechsler, D. S.,

Sommer, C., Reifenberger, G., and Hanash, S. M. (2003) Am. J. Path. 163,1033-1043.

16. Hough, C. D., Cho, K. R., Zonderman, A. B., Schwartz, D. R., and Morin, P. J. (2001)

Cancer Res. 61,3869-3876.

17. Fan, C.-W., Sheu, D.-L., Fan, H.-A., Hsu, K.-C., Chang, C. A., and Chan, E.-C. (2001)

Cancer Letters 165,63-69.

18. Levedakou, E. N., Strohmeyer, T. G., Effert, P. J., and Liu, E. T. (1992) Int. J. Cancer

52,534-537.

19. Boström, K., Kao, S.-C., Tsao, D., Shen, S., and Demer, L. L. (2001) J. Biol. Chem.

276,14044-14052.

20. Zebboudj, A. F., Imura, M., and Boström, K. (2002) J. Biol. Chem. 277,4388-4394.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

24

21. Zebboudj, A. F., Shin, V., and Boström, K. (2003) J. Cell. Biochem. 90,756-765.

22. Canalis, E., Economides, A. N., and Gazzerro, E. (2003) Endo. Rev. 24,218-235.

23. Shi, Y., and Massagué, J. (2003) Cell 113,685-700.

24. Chang, H., Brown, C. W., and Matzuk, M. M. (2002) Endo. Rev. 23,787-823.

25. von Bubnoff, A., and Cho, K. W. Y. (2001) Dev. Biol. 239,1-14.

26. Benckert, C., Jonas, S., Cramer, T., von Marschall, Z., Schäfer, G., Peters, M., Wagner,

K., Radke, C., Wiedenmann, B., Neuhaus, P., Höcker, M., and Rosewicz, S. (2003)

Cancer Res. 63,1083-1092.

27. Renner, U., Lohrer, P., Schaaf, L., Feirer, M., Schmitt, K., Onofri, C., Arzt, E., and

Stalla, G. K. (2002) Endocrinology 143,3759-65.

28. Pertovaara, L., Kaipainen, A., Mustonen, T., Orpana, A., Ferrara, N., Saksela, O., and

Alitalo, K. (1994) J. Biol. Chem. 269,6271–6274.

29. Goumans, M.-J., Lebrin, F., and Valdimarsdottir, G. (2003) Trends Cardiovasc. Med.

13,301-307.

30. Goumans, M.-J., Valdimarsdottir, G., Itoh, S., Rosendahl, A., Sideras, P., and ten Dijke,

P. (2002) EMBO J. 21,1743-1753.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

25

31. Goumans, M.-J., Valdimarsdottir, G., Itoh, S., Lebrin, F., Larsson, J., Mummery, C.,

Karlsson, J., and ten Dijke, P. (2003) Mol. Cell 12,817-828.

32. Relative quantitation of gene expression. (1997) User Bulletin #2: ABI Prism 7700

Sequence Detection System, PE Applied Biosystems.

33. Johnson, M. R., Wang, K., Smith, J. B., Heslin, M. J., and Diasio, R. B. (2000) Anal.

Biochem. 278,175-184.

34. Attisano, L., Carcamo, J., Ventura, F., Weis, F. M., Massagué, J., and Wrana, J. L. (1993)

Cell 19,671-680.

35. Korchynskyi, O., and ten Dijke, P. (2002) J. Biol. Chem. 277,4883-4891.

36. Shin, V., Zebboudj, A. F., and Boström, K. (2004) J. Vasc. Res. 41,193-201.

37. Zhu, H.-J., and Burgess, A. W. (2001) Mol. Cell. Biol. Res. Comm. 4,321-330.

38. Zhao, J., Sime, P. J., Bringas, P. Jr, Tefft, J. D., Buckley, S., Bu, D., Gauldie, J., and

Warburton, D. (1999) Eur. J. Cell. Biol. 78,715-725.

39. Zhao, J., and Warburton, D. (1997) Am. J. Physiol. 273,L282-287.

40. Zhou, H., Hammonds, R. G. Jr, Findlay, D. M., Martin, T. J., and Ng, K. W. (1993) J.

Cell. Physiol. 155,112-119.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

26

41. King, K. E., Iyemere, V. P., Weissberg, P. L., and Shanahan, C. M. (2003) J. Biol. Chem.

278,11661-11669.

42. Molin, D. G., Bartram U., Van der Heiden, K., Van Iperen, L., Speer, C. P., Hierck, B. P.,

Poelmann, R. E., Gittenberger-de-Groot, A. C. (2003) Dev. Dyn. 227, 431-444.

43. Grainger, D. J., Mosedale, D. E., Metcalfe, J. C., Bottinger, E. P. (2000) J. Cell Science

113, 2355-2361.

44. Lum, R. M., Wiley, L. M., Barakat, A. I. (2000) Int. J. Mol. Med. 5, 635-641.

45. Vargesson, N. (2003) J. Anat. 202, 93-103.

46. Shah, N. M., Groves, A. K., Anderson, D. J. (1996) Cell 85, 331-343.

47. Sugi, Y., Yamamura, H., Okagawa, H., Markwald, R. R. (2004) Dev. Biol. 269, 505-518.

48. Hall, B. K., Miyake, T. (2000) BioEssays 22, 138-147.

49. Moser, M., Binder, O., Wu, Y., Aitsebaomo, J., Ren, R., Bode, C., Bautch, V. L., Conlon,

F. L., Patterson, C. (2003) Mol. Cell. Biol. 16, 5664-5679.

50. Deckers, M. M. L., van Bezooijen, R. L., van der Horst, G., Hoogendam, J., van der Bent,

C., Papapoulos, S. E., Löwik, C. W. G. M. (2002) Endocrinology 143, 1545-1553.

51. Langenfeld, E. M., Langenfeld, J. (2004) Mol. Cancer Res. 2, 141-149.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

27

52. Abreu, J. G., Ketpura, N. I., Reversade, B., and De Robertis, E. M. (2002) Nat. Cell Biol.

4,599-604.

53. Wallin, R., Cain, D., Hutson, S. M., Sane, D. C., and Loeser, R. (2000) Thromb.

Haemost. 84,1039-1044.

54. Sweatt, A., Sane, D. C., Hutson, S. M., and Wallin, R. (2003) J. Thromb. Haemost.

1,178-85.

55. Barbara, N. P., Wrana, J. L., and Letarte, M. (1999) J. Biol. Chem. 274,584-594.

56. Gray, P. C., Bilezikjian, L. M., Vale, W. (2001) Mol. Cell. Endocrin. 180, 47-53.

57. Luo, G., D’Souza, R., Hogue, D., and Karsenty, G. (1995) J. Bone Min. Res. 10,325-334.

58. Gilbert, K. A., and Rannels, S. R. (2003) Am. J. Physiol. Lung Cell. Mol. Physiol.

285,L569-L577.

59. Gilbert, K. A., and Rannels, S. R. (2004) Am. J. Physiol. Lung Cell. Mol. Physiol.

286,L1179-1187.

60. Warburton, D., Bellusci, S., Del Moral, P.-M., Kaartinen, V., Lee, M., Tefft, D., and Shi,

W. (2003) Resp. Res. 4,5-21.

61. Zeng, X., Gray, M., Stahlman, M. T., and Whitsett, J. A. (2001) Dev. Dyn. 221,289-301.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

28

62. Zeng, X., Wert, S. E., Federici, R., Peters, K. G., and Whitsett, J. A. (1998) Dev. Dyn.

211,215-227.

63. Newman, B., Gigout, L. I., Sudre, L., Grant, M. E., and Wallis, G. A. (2001) J. Cell. Biol.

154,659-666.

64. Shanahan, C. M., Cary, N. R., Metcalfe, J. C., and Weissberg, P. L. (1994) J. Clin. Invest.

93,2393-2402.

65. Azhar, M., Schultz, J. E. J, Grupp, I., Dor II, G. W., Meneton, P., Molin, D. G. M.,

Gittenberger-de Groot, A. C., and Doetschman, T. (2003) Cytokine & Growth Factor

Rev. 14,391-407.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

29

FIGURE LEGENDS

Figure 1

(A) Proliferation of BAEC increases after exposure to medium from hMGP-treated BAEC.

Cell proliferation was determined using 3H-thymidine incorporation in quiescent BAEC exposed

to medium from BAEC treated with hMGP (0-50 ng/ml) for 24 hours. BAEC proliferation

increased significantly after exposure to medium from hMGP treated BAEC compared to

medium exposed to control cells (hMGP 0 ng/ml).

(B) Migration of BAEC increases after hMGP treatment.

Cell migration was determined using the endothelial wounding assay in confluent monolayers of

BAEC that had been treated for 24 hours with hMGP (0-100 ng/ml) prior to wounding. Results

showed a significant increase in migration after hMGP treatment.

**, *** indicate statistically significant differences compared to control (hMGP 0 ng/ml) (**

p<0.01, *** p<0.001, Scheffe’s test).

(C) BAEC tube formation on Matrigel was attenuated after hMGP treatment. BAEC were plated

at the density 2 x 104 cells/well on Matrigel in 12-well plates. Medium containing hMGP (60

ng/ml) or control medium was added to the Matrigel and the cells were incubated for 48 hours.

Original magnification 40X.

Figure 2

Release of VEGF-A and bFGF increases after hMGP treatment.

(A) Immunoblotting for VEGF and bFGF on culture medium and cell lysate was performed after

24 hours of hMGP treatment (0-100 ng/ml). VEGF was immunoprecipitated prior to

immunoblotting for improved detection. HMGP stimulated the release of both VEGF-A and

bFGF into the medium, while the levels in the cell extracts remained constant or decreased. MGP

containing medium not exposed to BAEC is included for comparison (100 pre).

(B) Relative expression of VEGF and bFGF.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

30

Figure 3

(A) VEGF expression in BAEC increases after hMGP treatment.

BAEC were treated for 24 hours with hMGP (0-100 ng/ml), after which VEGF expression was

determined using real-time PCR and normalized to GAPDH expression.

(B) VEGF expression in BAEC increases after transfection of hMGP.

BAEC were transiently transfected with an expression construct containing hMGP (0-400

ng/well) (transfection efficiency of 10-20%). Twenty-four hours after transfection, VEGF

expression was determined using real-time PCR and normalized to GAPDH expression.

(C) MGP expression increases after transfection of hMGP. Bovine and human MGP was

determined in the same samples as in (B) using real-time PCR and normalized to GAPDH

expression.

(D) The MGP concentration in media from the cells in (B) was determined using ELISA.

*, **, *** indicate statistically significant differences compared to control (hMGP 0 ng/ml, or no

plasmid) (* p<0.05, ** p<0.01, *** p<0.0001, Scheffe’s test).

Figure 4

TGF-ß1 and BMP-2 affects VEGF expression differently in BAEC.

BAEC were treated for 24 hours with TGF-ß1 (0-8 ng/ml) or BMP-2 (0-64 ng/ml) after which

VEGF expression was determined using real-time PCR and normalized to GAPDH expression.

VEGF expression increases after TGF-ß1 treatment, and decreases after BMP-2 treatment.

*, *** indicate statistically significant differences compared to control (* p<0.05, *** p<0.0001,

Scheffe’s test).

Figure 5

(A) MGP stimulates TGF-ß1 activity at constant levels of TGF-ß1.

A TGF-ß-responsive luciferase reporter gene construct was co-transfected into BAEC together

with increasing amounts of hMGP expression construct (transfection efficiency 10-20%), and the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

31

cells were subsequently incubated in the absence of exogenous TGF-ß1, or with TGF-ß1 (0.25 or

0.5 ng/ml). The luciferase activity was determined after 24 hours of TGF-ß1 treatment, and was

normalized to ß-galactosidase activity. The insert is an enlargement of the bars on the left, with

no added TGF-ß1.

(B) Human MGP increases VEGF expression at constant levels of TGF-ß1.

BAEC were transfected as described under (A), and VEGF expression was determined in cells

incubated in absence of exogenous TGF-ß1, or with 0.5 ng /ml of TGF-ß1 by real-time PCR and

normalized to GAPDH expression. The VEGF expression increased in parallel with the TGF-ß1

activity as determined in (A).

(C) MGP expression increased after transfection with hMGP construct. Bovine and human MGP

was determined in the same samples used in (B) by real-time PCR and normalized to GAPDH

expression.

*, **, *** indicate statistically significant differences compared to control (no hMGP plasmid)

for each TGF-ß1 concentration (* p<0.05, ** p<0.001, *** p<0.0001, Scheffe’s test).

Figure 6

HMGP inhibits BMP-2 activity at constant levels of BMP-2.

A BMP-2-reponsive luciferase reporter gene construct was co-transfected into BAEC together

with increasing amounts of hMGP expression construct (transfection efficiency 10-20%), and the

cells were subsequently incubated in the absence of BMP-2, or with BMP-2 (10, or 50 ng/ml).

The luciferase activity was determined after 24 hours of BMP-2 treatment, and was normalized

to ß-galactosidase activity. Increasing expression of hMGP inhibited BMP-2 activity up to 60-

70% at all levels of BMP-2. Expression of bovine and human MGP after transfection of the

hMGP construct was comparable to MGP expression shown in Fig 3B and 5C (data not shown).

*, *** indicate statistically significant differences compared to control (no hMGP plasmid) (*

p<0.05, *** p<0.0001, Scheffe’s test).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

32

Figure 7

Anti-TGF-ß antibodies inhibits hMGP induced VEGF expression.

BAEC were treated with anti-TGF-ß (0-600 ng/ml) (left), hMGP (0-50 ng/ml) (middle), or both

(right). After 24 hours, VEGF expression was determined using real-time PCR and normalized to

GAPDH expression. VEGF expression was inhibited by anti-TGF-ß antibodies, increased by

hMGP treatment, an increase that was abolished by anti-TGF-ß when added together with

hMGP.

**, *** indicate statistically significant differences compared to control (no hMGP, no anti-TGF-

ß) (** p<0.01, *** p<0.0001, Scheffe’s test).

Figure 8

(A) TGF-ß1 expression in BAEC does not increase after treatment or transfection with hMGP.

BAEC were treated with hMGP (0-100 ng/ml), or transiently transfected with an expression

construct containing hMGP (0-200 ng/well). Twenty-four hours after initiation of treatment or

transfection, TGF-ß1 expression was determined using real-time PCR and normalized to

GAPDH expression. No significant change was observed after hMGP treatment, but a mild

decrease was seen after hMGP transfection. Expression of bovine and human MGP after

transfection of the hMGP construct was comparable to MGP expression shown in Fig 3B and 5C

(data not shown).

* indicates statistically significant difference compared to control (no plasmid) (* p<0.05,

Scheffe’s test).

(B) TGF-ß1 LAP does not decrease after treatment with hMGP. Immunoblotting for TGF-ß1

LAP on culture medium was performed after 24 hours of hMGP treatment (0-100 ng/ml). HMGP

had minimal effect on TGF-ß1 LAP levels in the medium. MGP containing conditioned medium

not exposed to BAEC is included for comparison (100 pre). Relative protein levels of TGF-ß1

LAP are shown below the protein blot.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

33

(C) Expression of ALK1 and ALK5 does not increase after treatment with hMGP. Semi-

quantitative RT-PCR was performed after 24 hours of hMGP treatment (0-100 ng/ml) and

normalized to GAPDH. No change in expression of ALK1 and ALK5 was observed after hMGP

treatment. The relative expression of ALK1 and ALK5 is shown below the gels.

Figure 9

(A) TGF-ß1 increases MGP expression.

BAEC were treated with TGF-ß1 (0-6 ng/ml). After 24 hours, MGP expression was determined

using real-time PCR and normalized to GAPDH expression. MGP expression was increased by

TGF-ß1.

(B) Induction of MGP expression precedes VEGF expression in BAEC treated with TGF-ß1.

BAEC were treated with 0.5 ng/ml of TGF-ß1, and RNA was prepared at the indicated time

points after the start of the treatment. MGP and VEGF expression was determined by real-time

PCR and normalized to GAPDH expression. MGP expression precedes VEGF expression,

supporting a role for MGP in VEGF induction.

*, **, *** indicates statistically significant difference compared to control (no growth factor) (*

p<0.05, ** p<0.01,*** p<0.0001, Scheffe’s test).

Figure 10

HMGP stimulates Smad1 activation.

Immunoblotting for P-Smad1, P-Smad2/3, and total Smad was performed on cell lysates after the

indicated time points after the start of treatment with MGP (60 ng/ml) (left) or control medium

(right). HMGP stimulated phosphorylation of Smad1 in MGP-treated cells apparent after one

hour and later, suggesting that MGP stimulates TGF-ß1 signaling through ALK1. Smad2/3

phosphorylation was not activated by MGP. The bottom panel shows the relative band intensity

of P-Smad1 and P-Smad2/3 after normalization to total Smad.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

34

Figure 11

Constitutively active (ca)ALK1 mimics the effect of MGP on VEGF expression in BAEC.

(A) BAEC were transfected with an expression construct containing caALK1 (0-500 ng/well)

(transfection efficiency 10-20%). Twenty-four hours after transfection, VEGF expression was

determined by real-time PCR and normalized to GAPDH expression.

(B) Total ALK1 expression increases after transfection of caALK1 construct. ALK1 expression

was determined in the samples used in (A) by real-time PCR and normalized to GAPDH

expression.

*, *** indicate statistically significant differences compared to control (no caALK1 plasmid) (*

p<0.05, *** p<0.0001, Scheffe’s test).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure 10


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Kristina Boström, Amina F. Zebboudj, Yucheng Yao, Than S. Lin and Alejandra Torresin endothelial cells

1 activityβMatrix GLA protein stimulates VEGF expression through increased TGF-

published online September 27, 2004J. Biol. Chem.

10.1074/jbc.M406868200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M406868200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M406868200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/09/27/jbc.M406868200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/09/27/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/09/27/jbc.M406868200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Documents

Matrix GLA Protein Stimulates VEGF Expression through ... · protein-2 (BMP-2) (19-21), a member of the transforming growth factor (TGF)-ß superfamily of growth factors critical