Materials and Methods - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/29930/7/07_chapter 3.pdf · Materials and Methods (UP). For PEO patients the questionnaire having general

Materials and Methods

3. Materials and Methods

3.1. Population identification


Inclusion of sub populations in the present study was done following

consultations with anthropologists. Populations were identified with the attempt of

giving a fair representation of the extensive Indian population diversity.

Identification of populations in different parts of India for blood sample collection

was carried out with the help of trained social workers and community health

workers. Individuals fluent in the local language of the concerned populations were

consulted and involved actively in the study to get maximum authentic information

from the donors and help them to understand the purpose of the present

investigation.

Two panels namely discovery and validation were made keeping Indian

languages, morphological types, population size, religious fold and geography in

mind. Samples for discovery panel were collected on the basis of major linguistic

families/groups [Indo-European (IE), Tibeto-Burman (TB), Dravidian (DR) and

Austro-Asiatic (AA) populations], morphological types (Caucasoids, Mongoloids,

Australoids and Negritos), population size (large, small, isolated), geographical

distribution (east, west, north, north east, south, central), and Hindu religious fold

[four major caste classes viz. Brahmin (priestly class), Kshatriya (warrior class),

Vysya (business class), and Sudra (menial labour class)]. The populations for

validation panel were identified based on geographical zones, linguistic groups,

practice of endogamy, and presence of minority communities from different

religious groups and existence of populations of different sizes (large and small

populations). Populations were categorized as small if their size was <1 million

individuals and large if > 10 million. Major linguistic lineages and morphological

types were also considered as a criterion for sample collection. Blood samples were

drawn from unrelated distinct individuals of Indian sub populations so as to capture

the entire genetic diversity of the population. The term sub population was used for

the small part of or sub division of a population carrying a limited gene pool and

living in a changed environmental circumstances.

The questionnaire containing information regarding name, address, age, sex,

marital information, birth place, ear lobe, eye colour, height, weight, ethnicity, gotra,

marriage pattern, detail about the ancestral movement from one state to another,

parental and maternal family history related to different monogenetic and

27


polygenetic diseases, vaccination details, caste/tribe, tobacco chewing and smoking

habits, drinking habits, any medication, adverse reaction to any drug etc. were filled

at the time of blood sample collection.

Populations for discovery panel

A total of 40 samples were collected for composition of discovery panel and

SNP screening within genes C10orf2 and MPG. Forty discovery panel samples were

collected from six geographical zones of India namely east (8 populations), west (6),

north (14), north-east (2), south (7) and central India (3). All the collected samples

were named as discovery SNP panel or dSNP samples. These dSNP samples were

considered as representative samples oflndian population (Table I, Fig. 2).

Populations for validation panel

A total of fifty five (55) sub populations (approximately 2000 DNA samples)

were identified and collected for validation panel of C 1 Oorf2 gene. Validation panel

comprises 31 Indo-European (4 populations from east, 2 from north-east, 7 from

west, 17 from north and 1 from south); 4 Tibeto-Burman (all 4 populations from

north); 12 Dravidian (1 from east, 7 from central and 4 from south) and 8 Austro

Asiatic (3 from east, 1 from north-east, 3 from central and 1 from west) linguistic

sub populations of Indian origin (Table II). For each sub population of validation

panel maximum 46 and minimum 23 samples were collected.

In case ofMPG gene, a total of24 sub populations (approximately 550 DNA

samples) were identified and collected. Validation panel for MPG comprise 15 Indo

European (3 populations from east, 2 from north-east, 5 from west and 5 from

north); 3 Tibeto-Burman (2 from north and 1 from north-east); 4 Dravidian (3 from

south and 1 from central) and 2 Austro-Asiatic (1 from east and 1 from central) sub

populations (Table III). For each sub population of validation panel maximum 23

samples were collected in case ofMPG gene.

Samples for progressive external Ophthalmoplegia

For Association study of gene C10orf2 with Ophthalmoplegia patients were

identified from Sitapur eye hospital and Lucknow city, Lucknow, Uttar Pradesh

28


(UP). For PEO patients the questionnaire having general information's like name,

residential address, parents, sex, spouse, family history were recorded. The

symptoms of the disease like ptosis (single eye or both) at which age,

ophthalmoparesis, fundus examination, use of glasses with age of onset, specific

family history of eye disease, blurred vision, generalized fatigue, limitation of eye

movement, 3rd nerve palsy, cataract, age of onset of disease, histopathological

reportJCT/NMR scan etc. living setting and other symptoms (if any) were also

reordered along with few general body symptoms like external muscle pain/exercise

intolerance, palpitation, neurological disorder/sensory ataxic axonal neuropathy,

leodopa responsive parkinsonism, major depression, hypogonadism, progressive gait

disturbance/body balance, deafness etc (for patients details please see Table IV).

3.2. Blood sample collection from Indian sub populations

Prior to sample collection ethical clearance was obtained from the

Institutional Ethics Committee (IEC) following the guidelines of Indian Council of

Medical Research (ICMR) (http://icmr.nic.in). Several field trips were made to

collect samples. Participants were informed in the beginning about the purpose of

the study and data handling. It was also ensured that the participation is entirely

voluntary and no materialistic promises were made to the donors. An informed

written consent (Signed or thumb impressed) from the donors of the samples was

taken before collection of the blood. In case of child, parents consent was taken. A

uniform bar-coded detailed questionnaire was used containing information on

dietary habits, ethnicity, family history of disease and other phenotypic traits of the

donor.

Blood samples (8 ml) were collected by venipuncture and transferred to the

tube containing acid citrate dextrose (ACD) as anticoagulant agent (0.9 ml for each

5 ml of blood) and immediately mixed by inverting the tube (Vacutainers, Medigene

Co. Ltd) several times to prevent clotting. The vacutainers were kept on ice or at

4°C until processed for isolation of DNA. DNA isolation was done within a week of

the sample arrival in the laboratory.

The study protocol for association study was approved by Institutional Ethics

Committee of Central Drug Research Institute, Lucknow, UP. A total of 1 ml of

29

Table 1: Composition of discovery panel for genes C 1 Oorf2 and MPG of different Indian sub

populations with respective IDs.

Linguistics Caste ffribes Discovery ID Geographical location

West Bengal 11~-E-LP Rarhi Brahmin (c) dSNPI

Uttar Pradesh IE-N-LP Kanyakubj Brahmin (c) dSNP2

Himachal Pradesh IE-N-IP Kannet(T) dSNP3

West Bengal IE-E-LP Mahishya (c) dSNP4

Bihar IE-E-LP Bhumihar (c) dSNPS

Rajasthan IE-W-IP Bhil(n dSNP6

Rajasthan IE-W-LP Paliwal brahmin (c) dSNP7

Maharastra IE-W-LP Deshatha Brahmin (c) dSNP8

Rajasthan IE-W-SP Maheswaris (c) dSNP9

Maharastra IE-W-SP CKP(c) dSNPIO

Maharastra IE-W-SP Parsis (c) dSNPII

Maharastra IE-N-LP Koli (T) dSNPI2

Himachal Pradesh IE-N-LP Rajput(c) dSNPI3

Himachal Pradesh IE-N-LP Lohar (c) dSNPI4

West Bengal IE-N-LP Kayastha (c) dSNPIS

Uttar Pradesh IE-N-SP Shia(c) dSNP16

Haryana IE-N-SP Aggrawal (c) dSNP17

Punjab IE-N-SP Ramgaria sikh (c) dSNP18

Punjab IE-N-LP Khatri (c) dSNP19

Himachal Pradesh IE-N-LP Chamar(c) dSNP20

Karnataka IE-S-IP Hakki pikki (T) dSNP21

Maharastra IE-C-LP Chitpawan Brahmin (c) dSNP22

Meghalaya TB-NE-IP Khasi dSNP23

Andhra Pradesh DR-S-IP Kuruman<n dSNP24

Andhra Pradesh DR-S-LP Reddy (c) dSNP25

Karnataka DR-S-LP Gowda(c) dSNP26

Chattisgarh DR-C-LP Bison Hom Maria (c) dSNP27

West Bengal AA-E-IP Santhal (T) dSNP28

Jharkhand AA-E-IP Munda(T) dSNP29

Andaman &. Nicobar AA·S-IP Nicobaries (T) dSNP30

Andarnan &. Nicobar AA-S-IP Ongis(T) dSNP31

Maharastra AA-C-IP Kurku (T) dSNP32

Jharkhand IE-E-LP Chik Baraik (T) dSNP33

Uttar Pradesh IE-N-IP Tharu (T) dSNP34

Uttar Pradesh IE-N-SP Sunni (c) dSNP35

West Bengal IE-N-LP Bagdi (c) dSNP36

Meghalaya IE-NE-IP Hajong(T) dSNP37

West Bengal TB-E-IP Rabha(T) dSNP38

Bihar DR-E-IP Madia(T) dSNP39

Andhra Pradesh DR-S-IP Vaidiki Brahmin (c) dSNP40

Table II: Composition of validation panel for C1 Oorf2 gene of different Indian sub

populations with their respective IDs.

Serial No. Population name Population ID Three letter ID POP I ChikBaraik IE-E-LP CIB ern POP2 Kayastha (Wb) IE-E-LP KWB KWB POP3 Mahishya IE-E-LP MHA MHA POP4 Namsudra IE-NE-LP NSD NSD POPS Oriya Brahmin IE-E-LP ORB ORB POP6 Bhil IE-W-IP BHL BHL POP7 DongriBhil IE-W-IP DBH DBH POPS Deshastha Brahmins IE-W-LP DEB DEB POP9 Kokanastha Brahmins IE-W-LP KOB KOB POPIO Paliwal Brahmin IE-W-LP PAL PAL POPll Patidar IE-W-LP PTD PTD POP12 Siddi IE-W-LP SID SID POP13 Chamar(Hp) IE-N-LP CMR CMR POPI4 Jats IE-N-LP JAT JAT POPIS Kanyakubj Brahmin IE-N-LP KKB KKB POPI6 Kashmiri Pandit IE-N-LP KSP KSP POP17 Kayastha (Up) IE-N-LP KUP KUP POP18 Koli(Hp) IE-N-LP KOL KOL POP19 Rajput (Uttaranchal) IE-N-LP RJU RJU POP20 Rajput(Hp) IE-N-LP RJH RJH POP21 Saryuparin Brahmin IE-N-LP SPB SPB POP22 Khatri IE-N-LP KHT KHT POP23 Aggarwals IE-N-SP AGL AGL POP24 Rarngariah Sikh IE-N-SP RAM RAM POP25 Sunni IE-N-SP SUI SUI POP26 Shia IE-N-SP Sill sm POP27 Syed (Sunni) IE-N-SP_SYD SYD POP28 Hajong IE-NE-IP HJG HJG POP29 Kannet(Hp) IE-N-IP KNT KNT POP30 Tharu IE-N-IP THR THR POP31 Hakkipikki IE-S-IP HPK HPK POP32 Spiti (Hp) TB-N-IP SPT SPT POP33 Buddhists TB-N-SP BUD BUD POP34 Buddhist Heterogenous TB-N-SP BUH BUH POP35 Meitei TB-NE-LP MEl MEl POP36 Madia DR-E-IP MDA MDA POP37 Vaidiki Brahmin DR-S-LP VKB VKB POP38 Paniyan DR-S-IP PNY PNY POP39 Bison Hom Maria DR-C-LP BHM BHM POP40 Gond DR-C-IP GND GND POP41 Chenchu DR-S-IP CNC CNC POP42 Halakki DR-S-IP HLK HLK POP43 Kuruman DR-S-IP KRM KRM POP44 Naidu DR-S-LP NDU NDU POP45 Kallar DR-S-LP KLR KLR POP46 Karnataka Brahmin DR-S-LP KRB KRB POP47 Padaichi DR-S-LP PDC PDC POP48 Santhal AA-E-IP STL STL POP49 Munda AA-E-IP MUN MUN POP SO Juang AA-E-IP JNG JNG POPS I Kolis AA-W-IP KLS KLS POP 52 Khasi AA-NE-IP KHS KHS POP 53 Kurku AA-C-IP KKU KKU POP 54 Sahariya AA-C-IP SHY SHY POPSS Baiga AA-C-IP BAI BAI

Table Ill: Composition of validation panel for MPG gene of different Indian sub populations

with their respective IDs.

Serial No. Population name Population ID Three letter ID POP1 ChikBaraik IE-E-LP CIB CIB POP2 Kayastha (Wb) IE-E-LP KWB KWB POP3 Namsudra IE-NE-LP NSD NSD POP4 Oriya Brahmin IE-E-LP ORB ORB POPS Deshastha Brahmins IE-W-LP DEB DEB POP6 Kokanastha Brahmins IE-W-LP KOB KOB POP7 Paliwal Brahmin IE-W-LP PAL PAL POPS Patidar IE-W-LP PTD PTD POP9 Siddi IE-W-LP SID SID

POP10 Chamar(Hp) IE-N-LP CMR CMR POP 11 Kashmiri Pandit IE-N-LP KSP KSP POP12 Rajput(Hp) IE-N-LP RJH RJH POP13 Shia IE-N-SP SHI SHI POP14 Hajong IE-NE-IP HJG HJG POP15 Tharu IE-N-IP THR THR POP16 Spiti (Hp) TB-N-IP SPT SPT POP17 Buddhists TB-N-SP BUD BUD POP18 Meitei TB-NE-LP MEl MEl POP19 Gond DR-C-IP GND GND POP20 Kuruman DR-S-IP KRM KRM POP21 Naidu DR-S-LP NDU NDU POP22 Kallar DR-S-LP KLR KLR POP23 Juang AA-E-IP JNG JNG POP24 Baiga AA-C-IP BAI BAI

Table IV: Detailed Symptoms of Sporadic Ophthalmoplegia patients, with their symptoms,

age, sex,·marital status, onset of disease and living setting.

Patients Associated Age/sex/marital Onset of Living

of Ophthalmoplegia

symptoms status disease settings

Single eye ptosis, limited eye

16 year, female, At the age of First movement and Rural

symptoms of eye unmarried 6 month

ptosis Opthalmoparesis,

limited eye

Second movement in all 9 year, female, At the age of

Rural gazes except unmarried 2year

abduction, single eye ptosis

Single eye ptosis,

Third diplopia, limited eye 25 year, female, At the age of

Rural movement except married 25

down gaze

Fourth Single right eye 8 year, female,

Since birth Rural ptosis unmarried

Left eye ptosis since birth, eye muscle

Fifth pain, and limited 20 year, male,

Since birth Urban eye movement unmarried

except the down gaze


blood samples were collected from Ophthalmoplegia patients in 2 ml acid citrate

dextrose (ACD) buffer collection tubes and stored at 4°C till further use.

3.3. Isolation of DNA

High molecular genomic DNA isolation from blood using salting out procedure

8 ml of venous blood from each human subject was collected in a 10 ml

vacutainer followed by addition of 1.8 ml ACD buffer in order to prevent

coagulation and mixed well. To this 1 volume (10 ml) of ice cold cell lysis buffer or

C1 Buffer (4x) and 3 volumes (30 ml) of ice cold autoclaved distilled water was

added. Suspension was mixed by inverting the tubes several times until it became

translucent and incubated on ice for 10 min. Following incubation, the lysed blood

was centrifuged at 3200 rpm for 15 min at 4°C. The supernatant was discarded in

hypochlorite. 2 ml of ice cold C 1 buffer and 6 ml of ice cold distilled water was

added to the pellet. The pelleted nuclei were resuspended by vortexing and

centrifuged again at 3200 rpm for 15 min at 4°C. The supernatant was discarded in

hypochlorite. Finally 12 ml of nuclei lysis buffer was added to it and mixed well by

brief vortexing. To this 0.8 ml of 10% SDS and 50J.1l of Proteinase-K were added

and incubated at 65°C for 2-3 hours.

After 3 hours of incubation, 4 ml of saturated NaCl (6M) solution was added

and shaken vigorously for 15 sec. and immediately the tubes were spun at 2500 rpm

for 15 min at room temperature. The supernatant was taken and the DNA was

precipitated using two volumes of absolute ethanol kept at room temperature. The

DNA was precipitated by inverting the tubes 10 to 20 times. The precipitated DNA

was transferred to a micro centrifuge tube containing 1.0 ml of 70% ethanol at room

temperature. The tubes were vortexed briefly and centrifuged at 13,000 rpm for 10

min at 4°C. The supernatant was carefully removed without disturbing the pellet.

The pellet was air-dried and resuspended in 0.5 ml of Tris EDTA (TE) buffer (pH

8.0). Finally DNA was dissolved at 65°C for 2 hours and stored at -20°C (Miller et

al., 1988).

Reagents used in salting out procedure

Acid Citrate Dextrose (ACD) as an anti-coagulant

0.48g citric acid, 1.32g sodium acetate, 1.47g glucose, dissolved in water to a final

volume of 100 ml, autoclaved and stored at 4°C

30


4X Cell Lysis Buffer (Buffer Cl)

1.28 M Sucrose, 40 mM Tris-Cl, pH 7.5, 20mM MgCh, 4% Triton X- 100

(For 400 ml C1 buffer): Sucrose (M.W. 342.3) -175.25g, 1M Tris. HCl, pH 7.5- 16

ml, MgCh (M.W. 203.31)- 1.626g, Triton- 16 ml mixed and final volume made

upto 400 ml, autoclaved and stored at 4°C

Nuclei Lysis Buffer <NLB)

1 OmM Tris-HCl, 400mM NaCl, 2mM Na2EDTA (pH 8.0)

(For 400 ml NLB): 1M Tris-HCl (pH 8.0)- 4 ml, 5M NaCl- 32 ml, 0.5M EDTA

(pH 8.0) - 1.6 ml mixed and final volume was made upto 400 ml, autoclaved and

stored at room temperature.

Proteinase K solution (20mglml)

20mg of Proteinase K was dissolved in autoclaved distilled water. 200).11 was aliquoted

in eppendorfs and stored at -20°C for further use.

10%SDS

For 100 ml of SDS, 1 Og of SDS was dissolved in autoclaved distilled water and final

volume made upto 100 ml and stored at room temperature.

6M Saturated NaCl solution

For 100 ml of 6M NaCl, 35.064g NaCl was dissolved in distilled water and final

volume made upto 100 ml.

Alcohol for Precipitation

70% ethanol used for DNA precipitation at room temperature.

Tris EDTA (TE) Buffer

(For 200 ml): 10mM Tris (pH 8.0) and 1mM EDTA (pH 8.0) mixed, autoclaved and

stored at 4°C.

Mitochondrial DNA isolation

The blood (1 ml) was collected from patients diagnosed with

Ophthalmoplegia. It was centrifuged at 600 x g for 5 min at 4° C. Cells were washed 0

with 5-l 0 ml of ice-cold PBS buffer and centrifuged at 600 x g for 5 min at 4 C

following removal of supernatant. The cells were resuspended in 1.0 ml of 1X CEB

and incubated on ice for 10 min. Homogenate of cells were transferred to a 1.5 ml

tube, and centrifuged at 700 x g for 10 min at 4°C. This step was able to remove

nuclei and intact cells (in pellet). Supernatant was transferred to a fresh 1.5 ml tube,

31


and centrifuge at 10,000 x g for 30 min at 4°C. The supernatant was discarded and

the remaining pellet resuspended in 1 ml lX cytosol extraction buffer (CEB).

Following centrifugation at 10000 x g for 30 min at 4°C and isolated mitochondria

were recovered as the pellet. The isolated mitochondria were lysed in 40J.Ll of the

mitochondrial lysis buffer and kept on ice for 10 min. Subsequently the enzyme B

mix 5J.1.l was added to the sample tube and incubated at 50°C for 60 min, or until the

solution became clear. Following incubation the sample was precipitated with lOOJ!l

absolute ethanol at -20°C for 10 min. After precipitation the sample was centrifuged

in micro centrifuge at top speed for 5 min at RT and supernatant was removed. The

pellet was isolated mtDNA. The DNA pellet was washed twice with 1 ml of 70%

ethanol followed by removal of trace ethanol using pipette tip. The pellet was air

dried for 5 min and resuspended in 20J.1.l TE buffer and stored at -20°C till future

use.

Reagents used in mtDNA isolation

mtDNA isolation kit was procured from Bio Vision Research Product, CA, USA.

5X cytosol extraction buffer (CEB, 20 ml)

lX cytosolic extraction buffer was prepared by mixing 1 ml of the 5X buffer with 4

ml Milli Q H20.

Enzyme B mix (lyophilized 1 vial)

TE buffer 275J.Ll was added to enzyme B mix, aliquoted and refreezed immediately

at -70 ° C. All the buffers were kept on ice at all times during the experiment.

Concentrated wash solution (Isreal Kit Reagents for PCR product purification)

Before the first use, 22.5 ml of sterile Milli-Q water was added to 2.5 ml of

concentrate followed by 25 ml of absolute ethanol and was stored at -20°C.

PEG/Sodium acetate solution

After weighing 13.3g of PEGSOOO, it was dissolved in sterile water. Additional

333.0J.Ll of 1M MgCh and 10.0 ml of 3M Sodium acetate (pH 4.8) was added to the

PEG solution and final volume was made up to 50 ml with Milli-Q water.

Lambda DNA dilution

lOJ.lg/ml ofLambda DNA was diluted to a working concentration of lJ.Lg/ml.

32


Buffer PE (Concentrate)

PE buffer (wash buffer) 6 ml concentrates were diluted with 24 ml absolute alcohol to

make it as working stock.

Nuclease free water

Molecular grade water (nuclease free) was procured from Sigma and aliquots 0

prepared and stored at -20 C for further use during PCR set up or primer dilution.

3.4. Primer designing

Primers for C10orf2 and MPG genes

Primers for C 1 Oorf2 and MPG genes were designed using PrimerSelect

module of Lasergene v6.0 software (DNA STAR ™) and synthesized at The Centre

for Genomic Application {TCGA), Delhi and Sigma. Total 10 pair primers were

used for the amplification of C 1 Oorf2 and MPG genes (Table V). The nucleotide

sequences of the genes were downloaded from NCBI websites and these sequences

were used as templates sequence. Following primer characteristics as well as default

settings were used during primer design in PrimerSelect module of DNA STAR.

Primer lengths of minimum 17 and maximum 24 bp, Tm of the primers based on the

template(s) range (55-60°C) were used during primer design. Primer sequences were

checked for their self-complementary properties and avoided. Primers were also

checked for false priming, hairpins or dimers, self-dimer.

Primers for mtDNA

The primers for amplification of mitochondrial tRNA genes (tRNA-Leu,

tRNA-Asn and TRNL2) were used as described in Rieder et al., 1998. Three pair of

primers (tRNA-Leu, tRNA-Asn and tRNA-Leu TRNL2) were used for amplification

of mitochondrial tRNA genes (Rieder et al., 1998; Table VI). All the primer pairs

were procured from Sigma with PAGE purified specification.

The primers for mitochondrial tRNA genes were chosen in order to achieve

maximum coverage at both sides of the selected genes. Consequently, primers of

tRNA-Leu amplified RNR2 and ND1 genes. Similarly, primers for tRNA-Asn

amplified tRNA-Ala, tRNA-Trp, tRNA-Cys, tRNA-Try and ND4 gene; while

primers oftRNA-Leu TRNL2 amplified tRNA-His, tRNA-Ser and ND5 genes.

33

Table V: Primers for amplification of exonic regions of genes C10orf2 and MPG.

Primer sequence Ex on Amplicons Product length Gene Ex on Tm (bp) '

[S' .................................. 3') Start End Start End i

lA FP: 5'GGGGCCAGGGAGGGGTITCT3' 65.3 1181 1889 1049 RP: 5'GGCAGGGGGTAAGCAGGTCGTT3' 65.75

1525 477

ClOorfl lBb FP: 5'GGCTGCCTACCCTTACTCTACCC3' 65.64

1181 1889 1476 1957 RP: 5' AACCCACTTGCTTTTGTCACCTG3' 60.43

482

2 FP:5' AGATCAGGTGACAAAACAAGTGG3' 60.63

2080 2320 1931 RP:5'GGATATGTCTGGGAAAGCAAGGTG3' 62.3

2365 435

3 FP: 5'GAACTCCCCCATCTCCTTAG3' 49.3 RP: 5'TGTGGACAGCTGCTCGTGACC3' 58.4 2872 2979 2407 2974 568

4 FP:5'GGTTGTGGTAGTITGTGGGGAGAT3' 62.3

3305 3446 3204 3648 RP:5'CTGGGGGACAAGAACAGCAT AAGA3' 62.3

445

s FP:5' ACCCAGCCCCTCTCCCCATTCTTA3' 65.63 5626 5946 5514 5964

451 RP:5' ACCAGCTCTGCACGGCCTTCACTT3' 65.63

1 FP:5' AAAGGGCAGGGCTCCAGAAACCAG-3' 65.63

2280 2318 2006 RP:-5'CCCCATCCGTCGGCAAAACT-3' 2424 419

61.30 MPG

2 FP:5'CCGACGGATGGGGCAAAAg-3' 60.56 2412 2687 2412 2896 485 RP:-5'TGGGCAAGCAGCACTGACAATCT-3' 62.17 ...

3 FP: 5'CTGAGCTGGGGAGATGAGGT3' 61.30 5981 6185 5889 6489 RP: 5'CCGAAGTGCTGGGATGACA3' 58.45

541

4 FP:5'CAGGGGAAGCCAGGTGGAAAGGAACTGA-3' 69.16

8330 8706 8012 8609 598 RP:-5'CAGGGGACCACGCTCCAGCCATACAGC-3' 71.97

Table VI: Primers for mitochondrial gene amplification.

Amplicon Primer Product mtDNAgenes Primer sequence (5' •••• .3')

(Start-End) length length

FP:TACTTCACAAAGCGCCTTCC 20

tRNA-Leu 3230-3304 832

RP:ATGAAGAATAGGGCGAAGGG 20

FP:CTAACCGGCTTTTTGCCC 18 tRNA-Asn 5657-5729 814

RP:ACCTAGAAGGTTGCCTGGCT 20

FP:TATCACTCTCCTACTTACAG 20 tRNA-Leu

12266-12336 866 TRNL2 RP:AGAAGGTTATAATTCCTACG 20


3.5. PCR standardization and amplification

All the PCR reactions were performed in 0.2 ml transparent PCR tubes

(Axygen) using thermal cycler (MJ Research). The PCR reagents including PCR

buffer, nucleotide mix (dNTPs) and Taq DNA Polymerase were procured (Promega

and Sigma) and used for the standardization and amplification of the DNA samples.

Gradient PCR reactions were performed for each primer pairs and annealing

temperature was optimized. The annealing temperature for all the exons of the

C10orf2, MPG and mitochondrial tRNA genes (tRNA-Leu, tRNA-Asn and TRNL2)

was 58.3°C.

Reaction components Stock concentration Final concentration Volume

Taq Polymerase Buffer lOX IX 5.01-11

with MgCh (25mM)

Forward Primer (FP) lOOpmol/ 1-11 15pmolllll 3.01-11

Reverse Primer (RP) lOOpmol/ 1-11 15pmolllll 3.01-11

Genomic DNA lOOng/ Ill lng/1-11 1.01-11

dNTPsmix 2mM 2001-lM 1.01-11

Taq DNA Polymerase 3U/lll 0.03U/lll 0.251-11

Sterile water (MQ) - - Up to 501-11

Thermal cycling parameters consisted of 10 min initial denaturation at 95°C

followed by 30-35 cycles of 1min denaturation at 94°C, 1 min annealing at 58°C and

1 min extension at 72°C. Final extension at 72°C for 4 min was allowed before

holding the reaction at 4°C for 30 min. Similar PCR conditions were used for

mitochondrial DNA amplification in tRNA genes namely, tRNA-Leu, tRNA-Asn

and TRNL2. Reaction products were stored at 4°C prior to electrophoresis. TotalS~

of amplified product was mixed with l/5th volume of gel loading buffer (analytical

grade water containing 30% glycerol, 0.25% bromophenol blue, 0.25% xylene

cynole) and resolved on 1.2% agarose gel iii TAE buffer at 80 volts for 2 hour. DNA

markers (100bp, New England Biolabs) were run along with amplified product.

34


3.6. PCR product clean up for sequencing

The PCR products were purified using isolation kits and PEG protocol

(Biological Industries, Israel), polyethylene glycol methods or Qiagen MinElute gel

extraction kit.

Gel purification protocol using Israel kit

PCR product was electrophoresed on 2% agarose gel and the DNA band was

excised from ethidium bromide stained gel with a razor using 312nm UV light.

Three volumes of 6M Nai solution per gel slice volume were added to the excised

agarose piece and incubated at 55°C for 5-10 min with occasional mixing till the gel

piece dissolved completely. 6J.Ll of homogeneous glass powder suspension was

added to the agarose: DNA: Nai solution and mixed thoroughly and again incubated

at 55°C for 5-10 min with occasional mixing at interval of 1-2 min. DNA adsorbed

on glass powder suspension was pelleted at maximum speed for 10 sec and the pellet

was washed thrice with 300J.Ll (50 volumes of the glass powder) ofthe wash buffer.

The glass pellet was resuspended in 12-15J.Ll of autoclaved distilled water and

incubated for 10-15 min at 55°C. Following this, the glass powder was pelleted at

maximum speed for 30 sec and supernatant containing the eluted DNA was

transferred to a fresh collection tube.

Polyethylene glycol (PEG) purification protocol

Two volumes of PEG/sodium acetate solution was added to the PCR product

and mixed properly by vortexing and incubated for 10 min at room temperature. The

DNA was pelleted at 3,200 rpm for 30-60 min depending on the amplicon size. The

supernatant was removed by inverting the PCR reaction plate on tissue paper and

centrifuging up to 500 rpm. Pellet was washed twice with two volumes of 70%

ethanol by centrifuging at 3,200 rpm for 10 min. Ethanol was completely removed

and the pellet was air-dried and resuspended in 5-15J.Ll sterile Milli-Q H20.

Gel extraction kit protocol using a micro centrifuge

In case ofmtDNA sequencing, the PCR products oftRNA-Leu, tRNA-Asn and

TRNL2 were eluted from the agarose gel using Qiagen MinElute gel extraction

protocol. The PCR products (amplified DNA fragments) were excised from the

agarose gel with a clean, sharp scalpel and the size of gel slices were minimized by

35


removing extra agarose. The gel slices were weighed in a colorless tube and 3

volumes of buffer QG was added to 1 volume of gel (approximately 100 mg or

lOOJll). The gel slices were incubated at 50°C for 10 min to help dissolve the gel,

with intermittent mixing at every 2-3 min.

After complete dissolution of gel slice, the color of the mixture was checked

as yellow (similar to buffer QG without dissolved agarose), which was indicator of

pH 9.5 indicating efficient adsorption of DNA to the membrane. Additionally, 1

gel volume of isopropanol was added to the sample and mixed by inverting the tube

several times. Following isopropanol addition, MinElute columns were placed in a 2

ml collection tube and samples were loaded to facilitate DNA binding. The column

was centrifuged at 13000 rpm for 1min. All the centrifugation steps were done at

13000 rpm at room temperature. The flow through was discarded and 500Jll buffer

QG was dispensed in the MinElute column with the same collection tube. It was

centrifuged at 13000 rpm for 1 min. Flow through was discarded and washed with

750Jll of buffer PE. The flow through was discarded and MinElute column

centrifuged for an additional 1 min. After washing the MinElute columns were

placed into a clean 1.5 ml microcentrifuge tubes and centrifuged at 13000 rpm for 1

min after addition of 10Jll buffer EB (10 mM Tris-Cl, pH 8.5) or water to the center

of the column membrane. The average DNA eluted volume was 9Jll from 1 OJJ.l

elution buffer volume.

3.7. PCR for DNA sequencing

Sequencing was carried out using specific primers on an ABI 3100 capillary

sequencer (Applied Biosystems). Purified PCR product was gel quantitated prior to

sequencing. Briefly, sequencing primer (2pmoVJJ.l) and 50-150ng amplicons were

added to 4J,tl reaction mix, and volume made up to 10J,tl with autoclaved Milli-Q

water as per the Big Dye Terminator kit instructions (version 3.1, Applied

Biosystems). Dilution buffer was composed of 200mM Tris-HCl (pH 9) and 5mM

MgCh. The reaction was carried out for 30 cycles of denaturation at 96°C for 10 sec

followed by annealing for 5 sec and an extension at 60°C for 4 min. The annealing

temperatures were 50°C, 55°C or 60°C depending on the primer utilized for

sequencing.

36


Composition of the reaction mix (4JLI)

S. No. Big dye terminator reaction mix (2.5X) SX dilution buffer Milli-Q

I 2~1 ·~ ·~ II ·~I 1.5~1 1.5~1

III 0.5~1 1.75~1 1.75~1

Purification of sequencing products

After sequencing reaction, the products were precipitated using ethanol,

EDTA and sodium acetate to remove unincorporated primers and fluorescent

ddNTPs. Briefly, 2J.tl of 150mM EDTA and lOJ.tl of water were added to lOJ.tl of the

sequencing product and mixed well. To this mix, 2J.tl of 3M sodium acetate (pH 4.6)

and 50J.tl of absolute ethanol were added and incubated for 10 min at room

temperature. The pellets were washed twice with 1 OOJ!l of 70% ethanol by

centrifugation at 4,000 rpm for 5 min. The pellets were air-dried and resuspended in

IOJ.ll of 100% Hi-Di formamide (Applied Biosystems). The tubes were incubated at

94°C for 5 min and snap freezed on ice before loading onto the 3100 Automated

Sequencer (Applied Biosystem).

3.8. Procedure for picogreen estimation of DNA for validation panel

The genotype data used for validation was quantified with the help of

Picogreen estimation. Picogreen Dye is a fluorescent dye specific for dsDNA and

RNA and very sensitive at lower concentration (Singer et al., 1997). Picogreen bind

with dsDNA quantitatively i.e., as we increases the dilution the binding efficiency is

enhanced proportionately.

On the day of the experiment, an aqueous working solution of the Picogreen

reagent was prepared by making 1 :400 dilutions to the cone. solution in IX TE. The

solution was prepared in a plastic container as the reagent may stick to glass

surfaces. Working solutions was protected from light by covering it with foil, as the

Picogreen reagent is susceptible to photo degradation. To get the best result, the

solution was used within few hours of its preparation.

Briefly, a total of 25J.tl of diluted DNA was added into 384 well black plate

followed by addition of 25J!l of the aqueous working solution of Picogreen reagent

37


(diluted in 1: 400 ratio) to each well (standard + samples) as shown below. The

volume for diluted DNA and Pi co green dye was 25 J.Ll in each dilution. DNA and dye

were mixed well and incubated for 5 min at room temperature and covered with the

aluminum foil to protect from light. After incubation, samples fluorescence was

measured using a spectrofluoremeter microplate reader (BMG Labtech) at 260nm and

280nm. A standard curve of fluorescence Vs. DNA concentration was drawn for the

range (800pmoiiJ.Ll to 50pmoiiJ.Ll). Regression coefficient values were checked for

the standard, which was more than 0.98. The lambda DNA was used for preparation

of standard, as it was preferable to prepare the standard curve using the double

standard DNA. Essential dilution of the lJ.Lg/J.Ll of lambda DNA (standard DNA) was

done into a 384 well black plate as per the following:

Lambda DNA cone. Lambda DNA (in Jll) Picogreen (1:400)

(in pg/Jll) (in Jll)

800 25 25.0

600 25 25.0

400 25 25.0

200 25 25.0

100 25 25.0

50 25 25.0

00 25 25.0

During serial dilution of the dye, the initial lambda DNA concentration was

lOOOpg/J.Ll in 150J.Ll volume, it was diluted to 800pg/J1l after adding 120J.Ll of

1000pg/J1l DNA to next well and the volume was made upto 150J.Ll in each

successive dilution. Similarly, the 112.5J.Ll DNA sample was transferred to new well

from 800pg/J.Ll DNA well and concentration was made upto 600pg/J1l. Similar

process was continued for dilution upto the last dilution of 50pg/J1l.

38


Serial dilution of Picogreen Dye

3.9. SNP validation using Sequenom MassARRAY system

For the bulk of SNP validation, the Sequenom MassARRA Y system

(Applied Biosystem) was used as this system utilizes matrix assisted laser

desorption ionization (MALDI) time-of-flight (TOF) mass spectroscopy (MS)

technology and especially suited for high throughput genotyping (Jurinke et al.,

2002). The SNPs were selected for validation on the basis of their occurrence in

discovery panel, spacing between the markers, heterozygosity, frequency and their

validation status in different populations. The SNPs fulfilling a minimum of 3

criteria were chosen for validation.

The principle of hME assay is based upon the annealing of a MassEXTEND

primer adjacent to the polymorphic site of interest. The addition of a DNA

polymerase, plus a cocktail mixture of nucleotides (dNTPs) and terminators

(ddNTPs), allows extension of the primer through the polymorphic site. The

resultant mass of the primer extension product was then analyzed and used to

determine the sequence of the nucleotides at the polymorphic site. The accuracy of

the determined sequence was maintained through the application of four levels of

stringency i.e.,

(1). Proper hybridization of primers and amplification ofthe target region

(II). The specific hybridization of the MassEXTEND primer in the reaction mixture

39


(III). Extension through the polymorphic site and finally

(IV).Correlation between mass of measured primer extension product and calculated

values.

Briefly, primer (oligonucleotide) base extension was combined with MALDI

TOF mass spectrometry in the MassEXTEND assay. In assay a post-PCR primer

extension reaction was carried out in the presence of one or more di-deoxynucleotides

(ddNTPs) resulting in allele specific terminated extension products. Primers were

designed to anneal adjacent to the SNPs of interest. The addition of a DNA

polymerase, plus a cocktail of nucleotides and terminators, allows extension of the

primer through the polymorphic site. The resultant mass of the primer extension

products were then analyzed and used to determine the sequence of the nucleotides at

the polymorphic site. A homozygous genotype leads to one extension product of

defined mass. In heterozygous samples, two products of distinguishable masses were

generated. Process ofhME assay includes following steps:

Template amplification

2~1 of the DNA sample (2.5ng/~l) was added to the wells of a 384 well PCR

plate and then dried at 850C for 15 min in a PCR. A 50nM primer mix (of the forward

and reverse primers) was made from IOO~M stock. 2.5~1 of this primer mix was added

to the DNA containing wells (384 well plate). Again the plate was dried at 850C for 15

min in a thermal cycler. PCR mix was then made as follows:

Reagent Stock Working Volume (for 384 concentration concentration reactions)

HPLC grade water - - 955.9,.11

Red Dye - - 12.0J,11

HotStart Taq polymerase IOX,l5mM IX,l.5mM 120.0J.1l buffer with MgCI2

MgCh 25mM 2mM 96.0J,11

dNTPs 25mM 200J.1M 9.6J.1l

HotStart Taq Polymerase 5units/J.1l 0.07U/reaction 6.5J.1l

2.5 ~I of the PCR Mix was aliquoted to each of the wells of the PCR plate.

The sample plate was sealed with a plate sealing film. PCR reactions were carried

out in a two step reaction as follows:

40

94°C 15 min 94°C 20 sec} 56°C 1 min 10 cycles 72°C 1 min 94°C 20 sec} 56°C 30 sec 35 cycles 72°C 1 min


The PCR product was checked on 3% agarose gel and remaining amount of PCR

products was dried at 85°C for 15 min in a PCR machine.

Dephosphorylation of residual amplification nucleotides

Shrimp alkaline phosphatase (SAP) was added to the samples to

dephosphorylate/ neutralize the remaining, unincorporated dNTPs and to prevent

their further incorporation and interference with the primer extension assay. SAP

enzyme cleaves a phosphate from the unincorporated dNTPs, converting them to

ddNTPs and rendering them unavailable for future reaction.

The SAP enzyme solution was prepared as follows with the reagents added

in a serial order:

Reagent Stock concentration Working Volume (for 384 concentration reactions)

HPLC grade water - - . 779.5J1l

HotStart Taq buffer lOX o.sx 42.0J1l

SAP IU/Jtl 0.0440/reaction 18.5J1l

The solution was vortexed for 5sec to ensure proper mixing and then

centrifuged for 10 sec at 5000 rpm. 2JJ.l of SAP enzyme solution was added to the

dry PCR product using the Multimek liquid handler (Beckman). The sample plate

was sealed properly and kept in thermal cycler at the conditions with initial heating

at 3rC for 40 min followed by 85°C for 4 min before holding at 4°C.

37°C 40 min

85°C 4 min

4°C Hold

Homogeneous MassEXTEND (hME) reaction

This reaction generates allele-specific primer extension products that are

generally 1-4 bases longer than the original MassEXTEND primer. The hME primer

mix was prepared ( 400nM) and adjusted as per the multiplex reaction. 1 JJ.l of this

41


hME primer mix was added to the PCR product post SAP treatment. The hME mix

was then prepared as follows with the reagents added in a serial order:

Reagents Stock Working Volume (for concentration concentration 384 reactions)

HPLC grade water - - 880!-11

Red Dye - - 9.6!-11

TriMix 2.25mM 20!-'M 21.6!-11

MassEXTEND Enzyme 320/!-11 0.320/rxn 4.8!-11 (Thermo Sequenase)

The MassEXTEND enzyme was kept at -200C till the reaction cocktail was

prepared. 2J.ll of the hME mix was then added to the PCR plate. The plate was

properly sealed with a sealing film and kept in a thermal cycler with following

cycling conditions:

94°C 30 sec

94°C S sec } 20 cycles

S2°C Sse:} 80°C

S cycles Sse

72°C 3 min

4°C Hold

Sample conditioning and transfer

Following the extension reaction, MassEXTEND® clean resin was added to

the reaction to remove extraneous salts that interfere with MALDI-TOF analysis.

l6J.1.l of resin/water solution was added to each well of the sample plate. The

contents of the plate were mixed by repeated aspiration and dispensing (40 times).

The hME reaction product was centrifuged for 3 min at S13g. Furthermore, lSnl of

sample was transferred from the 384 well plate and spotted onto the pad of the 384-

SpectroCHIP bioarray.

Genotype calling and data analysis

The SpectroCHIP was placed into the Sequenom's platform and the mass

and correlating genotype were determined with MassARRA Y R'J"TM software.

42


3.10. Sequence alignment

DNA sequences were analyzed with the help of Lasergene v6.0 software

(DNA STAR) to fish out potential SNPs in discovery panel and mutations in case of

mtDNA. The homozygous and heterozygous calls were scored manually after alignment

of the sequences. SeqMan II module of Lasergene was used as an alignment tool,

which provides facilities to assemble two to tens ofthousands of reads into contigs.

Criteria for sequence inclusion into alignment programme

Prior to the assembly of sequences in SeqMan poor quality data vector

sequence and contaminating data from poor sequences were eliminated. Most

importantly, for our sequences we used the data from automated sequencers in the

form of chromatogram file, EditSeq DNA sequence file and .phd files. SeqMan

includes DNASTAR's unique Trace Quality Evaluation system, which evaluates the

quality of the underlying trace data, and then generates the most accurate consensus

sequence possible. Before assembling the sequences, SeqMan's preassembly option

was used in which poor sequencing data in beginning (30-50bp) and end of the

sequence (20-40bp) was trimmed depending on the sequencing quality/poor-quality

data. After assembly of the data, the tabular reports and graphic views were

reviewed to summarize results, which helped us to determine, whether additional

coverage may be needed or not. If coverage seems unsatisfactory, more sequences

were added and reassembled. The alignment view provided us more detailed picture

of the assembly, and allow editing and trimming constituent and consensus

sequences.

Entry order of sequence into the alignment programme

Sequences were assembled in SeqMan module of Lasergene v6.0, in a

sequential order to get the appropriate comparable alignment. Order of sequence

entry into the SeqMan was as follow: - First, entry of the total NCBI contig

sequence or freeze sequence followed by the sequence of the coding region/strand of

DNA on which both forward and reverse primer were designed and finally all the

forward and reverse sequences amplified within all the selected Indian populations

i.e. discovery panel. After alignment of the entire discovery panel sequences (i.e.

forward and reverse sequences) into the alignment project, the conflict base is

considered as potential SNP after its scoring in forward and reverse sequences.

43


3.11. Statistical analysis

For genotype data analysis, softwares like GENCOUNT, ALLHET (written

by Sujit Maiti, Center for Population Genetics, Indian Statistical Institute, Kolkata);

MAXLIKI (http://www-fp.mcs.anl.gov/otc/Guide/Blurbs/maxlik.html), DISPAN

(http://mep.bio.psu.edu/resdme.html/downloads/dispan.zip) and CONVERT

(http://www.agriculture.purdue.edu/fnrlhtml/faculty/Rhodes/Students%20and%20St

afflglaubitz/software.html) were used.

Preparation of standard genotype data set for SNPs of gene ClOortl

The genotypic data for four SNPs within the gene C 1 Oorf2 was tabulated in

excel sheet against 55 population and 1597 DNA samples excluding 60 positive

control samples and two negative control samples. The excel sheet was arranged

vertically having POP_ID (Population ID like PI, P2, P3 .... P55); IND_ID

(Individual ID like 1, 2, 3-upto 46) and SNPs reported in the gene C10orf2,

rs3740485 (SNPI), rs3740486 (SNP2), rs3740487 (SNP3) and rs3824783 (SNP4),

in separate column respectively. Each genotype for the particular SNP was filled

vertically and the missing genotype in the data was filled with a sign of interrogation

(?). This was a standard data set for the GENCOUNT, MAXLIKI, ALLHET,

CONVERT and DISPAN softwares used in the present study to analyze C10orf2 in

detail.

Gencount

Gencount calculates genotype frequencies for SNPs. To run the Gencount

programme the data set for C10orf2 was saved as fn.csv, where fn is file name and

csv is comma delimited file type. It gives descriptive frequency table and a file

named INFILE, which was used as input file for MAXLIKI.

Maxlikl

MAXLIKI a computer programme was used to calculate maximum

likelihood estimates of allele frequencies and their standard deviations for biallelic

and co-dominant loci. INFILE of the GENCOUNT was used as an input file for

MAXLIKI programme. MAXLIKl generates two output files called OUTFILE and

OUTFILEI. Both of these files are text files and can be opened under DOS-Edit or

using Notepad/Wordpad. The MAXLIKI output gives total number of

44


heterozygous, standard deviation and HW Chi-square. The OUTFILE 1 was used for

DISP AN input.

Allhet

ALLHET was used to test the null hypothesis that allele frequencies at 4-

SNP loci among 41-populations were equal. OUTFILE1 of the MAXLIK1 was used

as input file for ALLHET. To run the programme the input file name, number of

population and SNP loci were filled and resulting file was as ALLHET.txt. The

result was generated in the form of chi square and degree of freedom.

CONY _M_D (Convert_Maxlikl_Dispan)

CONVERT was used to convert the MAXLIK1 file for DISPAN use or to

prepare input file for DISPAN. OUTFILE1 ofMAXLIK1 was used as an input file

for the conversion of the MAXLIK1 to DISPAN. During run of the programme the

inputs information like number of loci, numbers of populations as well as name of

the populations were filled. Finally the output file was DISPAN.dat.

Dis pan

Dispan

downloadable

is a genetic distance and phylogenetic analysis programme,

from http://mep.bio.psu.edu/readme.htmVdownloadsldispan.zip.

DISPAN was used to calculate average heterozygosity and its standard error for

each population under study, genetic diversity (Ht) and its associated parameters Hs

and Gst. Output file of CONY _M_D was used as an input file for running the

DISPAN. The output file of CONV _M_D contains information regarding the

population name, n.o of monomorphic loci, and n.o of alleles in the locus, number of

chromosome sampled, locus name and allelic frequency. For running DISPAN

firstly the programme was started followed by filling the command as: (GNKDST

da-ds -fDISPAN.DAT-g r1000 -s516 -tn -tu) inside the programme. The cases

used in the commands were case sensitive and can be included and excluded

according the need. Here -da: DA distance, -ds: standard genetic distance, -

fDISPAN.DAT: input file -g: Hs, Ht and Gst for each locus, -r1000: Bootstrap tests

(The number after -r is the number of bootstrap replications), -s516: This is seed

number for random number generator which was randomly used (can not be zero). -

tn: NJ tree, -tu: UPGMA tree. After completion of the run the results were obtained

from GNKDST.DST file and interpreted.

45

Documents

Materials and Methods - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/29930/7/07_chapter 3.pdf · Materials and Methods (UP). For PEO patients the questionnaire having general