Markers for OLN-93 oligodendroglia differentiation

www.elsevier.com/locate/devbrainres

Developmental Brain Resea

Research report

Markers for OLN-93 oligodendroglia differentiation

Marieke E. van Meeterena, Marleen A. Koetsiera, Christine D. Dijkstrab, Eric A.F. van Tola,TaNumico Research B.V., Biomedical Research Department, PO Box 7005, 6700 CA Wageningen, The Netherlands

bVU University Medical Center, Department of Molecular Cell Biology and Immunology, PO Box 7057, 1007 MB Amsterdam, The Netherlands

Accepted 4 February 2005

Available online 29 March 2005

Abstract

Oligodendrocytes are target cells in the pathogenesis of multiple sclerosis (MS), a chronic demyelinating disease of the central nervous

system (CNS). During the course of the disease, inflammatory mediators may damage oligodendrocytes and their myelin sheaths.

Differentiation of oligodendrocyte progenitors is an important step in the process of remyelination. In the present study, OLN-93

differentiation was studied in co-culture with C6 astrocytes as a natural source of growth and differentiation factors as well as after exposure

to insulin-like growth factor-I (IGF-I). Morphological evaluation showed an increased degree of differentiation of OLN-93 cells after IGF-I

administration, but not after co-culture with astrocytes. During early differentiation, 2V, 3V-cyclic nucleotide 3V-phosphohydrolase (CNP) andzonula occludens-1 (ZO-1) tight junction protein expression were significantly increased. However, neither astrocyte co-culture nor exposure

to IGF-I further increased the expression of these markers. Although reverse transcriptase-polymerase chain reaction revealed myelin basic

protein (MBP) mRNA expression not to be affected during differentiation, we did find increased MBP protein expression by Western

blotting. ZO-1 protein and DM20 mRNA levels were increased during the course of differentiation and after IGF-I administration. The

present findings suggest that ZO-1 may be used as a marker for OLN-93 oligodendroglia differentiation.

D 2005 Elsevier B.V. All rights reserved.

Theme: Development and regeneration

Topic: Cell differentiation and migration

Keywords: Oligodendrocytes; Differentiation; IGF-I; ZO-1; Astrocytes

1. Introduction

Multiple sclerosis (MS) is a chronic demyelinating

disease of the central nervous system. Myelin sheaths are

produced by oligodendrocytes and surround axons thus

promoting saltatory conduction. In active MS lesions,

inflammatory mediators produced by activated T cells and

macrophages contribute to myelin breakdown [26]. Macro-

phages subsequently phagocytose the damaged myelin,

which may lead to direct cell death of oligodendrocytes

via apoptotic or necrotic pathways [26]. Axonal demyeli-

nation leads to impaired axonal signal transduction and

increased vulnerability of axons to inflammatory mediators

[5,13]. Recent data suggest that oligodendrocyte cell death

0165-3806/$ - see front matter D 2005 Elsevier B.V. All rights reserved.

doi:10.1016/j.devbrainres.2005.02.005

T Corresponding author. Fax: +31 317 466500.

E-mail address: [email protected] (E.A.F. van Tol).

may even be a primary event in the pathogenesis of MS [2],

hence not a consequence but rather a cause of the cellular

infiltration and myelin phagocytosis.

Spontaneous remyelination occurs during the early phase

of disease in some lesions, but it is rare during more chronic

stages of MS [19]. Progenitor oligodendrocytes at the

proximity of the lesion have been identified to be the

source of new myelin-forming oligodendrocytes (reviewed

in Ref. [20]). During remyelination, these progenitor cells

are thought to migrate into the oligodendrocyte-depleted

area, where they first proliferate and subsequently diffe-

rentiate to remyelinate the demyelinated axons (reviewed in

Ref. [11]). In MS, such progenitor cells are present, but they

do not seem to differentiate into remyelinating cells [36]. At

present, it is still unclear why remyelination is so limited in

MS lesions, while experimental models have shown

progenitors of myelinating cells to be sufficiently present

rch 156 (2005) 78 – 86

M.E. van Meeteren et al. / Developmental Brain Research 156 (2005) 78–86 79

near oligodendrocyte-depleted areas [7,30]. Therefore, it is

important to further unravel the process of oligodendrocyte

maturation and the mediators involved.

The process of oligodendrocyte differentiation from an

immature progenitor to a mature myelin-forming oligoden-

drocyte is strictly regulated, along a specific lineage pathway

characterized by the expression of specific proteins and

lipids. Mature oligodendrocytes express myelin proteins such

as myelin basic protein (MBP), proteolipid protein (PLP),

myelin oligodendrocyte glycoprotein (MOG), 2V, 3V-cyclicnucleotide 3V-phosphohydrolase (CNP), and myelin-associa-

ted glycoprotein (MAG). Recently, it has been established

that certain tight junction proteins are expressed by mature

oligodendrocytes as well [4,14]. Besides claudin-11 [3],

formerly known as oligodendrocyte specific protein (OSP),

the expression of ZO-1 tight junction protein was observed in

oligodendrocytes [9]. ZO-1 is known as a phosphoprotein

associated with tight junctions of epithelial and endothelial

cell types. ZO-1 protein expression has also been described

on olfactory sensory neurons and glial cells [28]. Tight

junctions located in compact myelin have been described in

oligodendrocytes [10] but ZO-1 expression and function

during the course of maturation in these cells is unknown.

It has been documented that oligodendrocyte diffe-

rentiation can be promoted by various growth factors

[12,15,34]. Studies using transgenic mice overexpressing

IGF-I reveal that this growth factor is a potent inducer of

myelination [6]. In vitro studies have shown that IGFs may

act at different levels: by promoting proliferation of

oligodendrocytes and oligodendrocyte precursors, by induc-

ing immature oligodendrocyte precursors to develop into

oligodendrocytes, and by regulating myelin gene expression

and production [23–25]. Activated astrocytes and macro-

phages, as well as neurons, can be local producers of IGF-I

[34]. Moreover, IGF-I administration is an accepted method

to promote oligodendrocyte differentiation in vitro and to

stimulate myelin production [22,23,35].

In the present study, we evaluated OLN-93 oligoden-

droglia differentiation in co-culture with C6 astrocytes as a

natural source of differentiation promoting and inhibiting

factors [1,16,18,34]. To further elucidate the expression of

maturation markers during OLN-93 differentiation, we

investigated the effect of IGF-I on MBP, DM20, CNP, and

ZO-1 expression using various techniques.

2. Materials and methods

2.1. Chemicals

All cell culture reagents were purchased from Invitrogen

Life Technologies (Merelbeke, Belgium), unless indicated

otherwise. To promote oligodendrocyte differentiation,

recombinant human insulin-like growth factor-I (IGF-I,

Santacruz Biotechnology, Santa Cruz, CA, USA) was used.

For Western blot analysis, a mouse monoclonal against

human ZO-1 (Zymed, South San Francisco, CA, USA),

human CNP (Chemicon International, Inc., Temecula, CA,

USA), and human MBP (MBP22), a kind gift from N.

Groome (School for Biological and Molecular Sciences,

Oxford, UK), were used as primary antibodies. Horseradish

peroxidase (HRP) conjugated anti-mouse IgG (Santacruz

Biotechnology, Santa Cruz, CA, USA) was used as a

secondary antibody.

For immunofluorescence staining, the same mouse

monoclonal antibody against human ZO-1 and MBP was

used as for Western blotting, and a mouse monoclonal

antibody against human CNP (Sigma, St. Louis, MO, USA)

was used. As secondary conjugate, Alexa FluorR 594-

labeled goat anti-mouse IgG was used (Molecular Probes,

Eugene, OR, USA). To improve immunofluorescence stain-

ing, cells were permeabilized by using saponin (Riedel-de

Haen, Seelze, Germany).

2.2. Cell culture

OLN-93, rat oligodendroglia cells [32] were kindly

provided by Dr. H. de Vries (Department of Membrane Cell

Biology, University of Groningen, The Netherlands) with

permission of Dr. C. Richter-Landsberg (Department of

Biology, Molecular Neurobiology, University of Oldenburg,

Oldenburg, Germany). The cells were cultured in Dulbecco’s

modified Eagle’s medium (DMEM) with high glucose and

supplemented with 10% heat-inactivated fetal calf serum

(FCS), 100 U/ml penicillin, and 100 Ag/ml streptomycin. Rat

astrocyte C6 cells (CCL-107; ATCC, Maryland, USA) were

cultured in HAM’s F-10 and supplemented with 10% heat-

inactivated horse serum (HS), 100 U/ml penicillin, and 100

Ag/ml streptomycin. Cells were passaged twice a week and

grown in a humidified incubator at 37 8C with 5% CO2.

2.3. Differentiation of OLN-93 cells in the presence of C6

astrocytes

Astrocytes of the C6 cell line were seeded at a density of

0.5 � 106 cells on 24-mm inserts with 0.4 Am pore size

(Transwell-Clear Polyester Membrane; Corning Inc., NY,

USA) in co-culture medium, containing DMEM/HAM’s F-

10 (1:1) and supplemented with 10% FCS/HS (1:1), 100 U/

ml penicillin, and 100 Ag/ml streptomycin. The astrocytes

were allowed to grow confluent overnight. Then, OLN-93

cells were seeded below the astrocyte containing inserts at a

density of 0.2 � 106 cells per well in the poly-d-lysine-

coated 6-well compartments. Cells were seeded in co-

culture medium with 0.5% FCS/HS (1:1). After overnight

attachment of the OLN-93 cells, both compartments were

gently washed and subsequently cultured with serum-free

co-culture medium for three additional days. Replacement

of the medium with serum-free culture medium will induce

differentiation of the OLN-93 cells through cell cycle arrest

[32]. Control wells contained OLN-93 cells differentiated in

the absence of C6 astrocytes. For Western blot analysis,

M.E. van Meeteren et al. / Developmental Brain Research 156 (2005) 78–8680

samples were isolated of the OLN-93 cells at t = 0 before

seeding and after 1, 2 and 3 days of differentiation in mono-

or co-culture with C6 astrocytes.

2.4. Differentiation of OLN-93 cells in the presence of IGF-I

To promote differentiation, OLN-93 cells were seeded at

low density on poly-d-lysine (Sigma, St. Louis, MI, USA)-

coated dishes (0.2 � 106 cells per 50-mm dish) in DMEM

with 0.5% FCS. After overnight attachment, cells were

gently washed and subsequently cultured with serum-free

DMEM for 3 or 6 days in the presence or absence of 100 ng/

ml IGF-I. After 3 days, the culture medium was changed

and fresh IGF-I was added. Samples for Western blot and

RT-PCR analysis were taken at 3 and 6 days of OLN-93

differentiation. For immunofluorescence staining of IGF-I

differentiated OLN-93 cells, poly-d-lysine-coated 8-well

glass tissue chamber slides (Nalge Nunc International,

Naperville, IL, USA) were used. Cells were seeded at a

density of 0.2 � 106 cells per 0.8 cm2 chamber and treated

as described above. Three-day IGF-I differentiated OLN-93

cells were stained by immunofluorescence staining for

maturation markers and compared to non-treated cells.

2.5. Sample collection for protein and mRNA detection

To determine the protein and mRNA expression, cells

were washed three times with prewarmed phosphate buffered

saline (PBS) at the indicated time points. Total protein was

collected using Laemmli lysis buffer containing 2% SDS,

25% glycerol, and 63 mM Tris–HCl, pH 6.8. Total RNAwas

isolated with a RNeasy kit following the manufacturer’s

protocol (Qiagen/Westburg, Leusden, The Netherlands).

Protein and RNA samples were stored at �20 8C until

analysis.

2.6. Western blot

Total protein was determined with the Bio-Rad DC

protein assay (Hercules, CA, USA). Samples were equally

loaded, normalized for protein content; 10 Ag/lane for ZO-1,5 Ag/lane for CNP, and 30 Ag/lane for MBP. A cell lysate of

human epithelial T84 cells (ATCC, Maryland, USA) was

used as a positive control for ZO-1 protein expression, while

rat myelin (a kind gift of J.J.A. Hendriks, VU University

Medical Center, Amsterdam, The Netherlands) was used as

a positive control for CNP protein expression. The proteins

were resolved by SDS-PAGE and gel percentage was

adjusted for the myelin protein to be detected; 6% gels for

ZO-1, 10% gels for CNP, and 12% gels for MBP protein.

The resolved proteins were transferred to PVDF membranes

(Roche Diagnostics, Mannheim, Germany) in transfer buffer

(25 mM Tris, 192 mM glycine, and 20% (v/v) methanol)

containing 0.02% SDS. Membranes were blocked overnight

at 4 8C in 10 mM Tris pH 8, 150 mM NaCl, and 0.05%

Tween 20 (TBS-T) containing 5% Protifar Plus milk powder

(Nutricia, Cuijk, The Netherlands). Monoclonal anti-ZO-1

(1:500), anti-CNPase (1:250), and anti-MBP (1:1000) anti-

bodies were used and incubated for 1 h at room temperature

in TBS-T. Membranes were subsequently washed with

TBS-T and incubated for 1 h at room temperature with a

goat anti-mouse-IgG HRP-labeled secondary antibody at a

dilution of 1:7000. Blots were washed with TBS-T,

followed by two sequential wash steps using TBS without

Tween 20 and then incubated with ECL chemiluminiscence

reagents (Roche Diagnostics, Mannheim, Germany). Protein

bands of ZO-1 (210 kDa), CNP (46/48 kDa), and MBP

(¨14 kDa) were visualized using the Lumi-Imagerisystem (Boehringer, Mannheim, Germany). Changes in

protein expression were analyzed by densitometry and

expressed as arbitrary units.

2.7. Reverse transcriptase-polymerase chain reaction

(RT-PCR)

Yield and purity of total RNA was determined spectro-

photometrically by measuring the A260 and A280 optical

densities. Primers were synthesized by Biolegio (Malden,

The Netherlands). The PCR reaction was performed with a

Peltier Thermal Cycler (PTC-200; MJ Research Inc., Water-

town, MA). The following primers were used: PLP forward

primer 5V GGCCGAGGGCTTCTACACCAC 3V (position383–403) and reverse primer 5V CAGGAGCCCACTGTG-GAGCAA 3V (position 1154–1174). The primers for PLP are

matching sequences in exon 3 and exon 7 of the PLP gene and

yield besides the PLP product (791 bp) also the DM20 (756

bp) splice product [27]. The use of MBP forward 5VACTGC-GGATAGACAGG 3V (position 761–776) and reverse pri-

mers 5VGATGGTGACCTTCGGC 3V (position 1114–1129)

results in a 368-bp product. The h-actin forward primer 5VACCACAGCTGAGAGGGAAATC 3V (position 2393–

2418) and reverse primer 5V GGTCTTTACGGATGTCA-ACG 3V (position 2739–2759) yielded a 280-bp product. By

using the Titan one-tube RT-PCR system (Roche Diagnos-

tics, Mannheim, Germany), 0.5 Ag of total RNAwas reversed

transcribed, and the resulting cDNA was amplified by PCR

for PLP/DM20 at 27 cycles and MBP at 35 cycles. The

housekeeping gene h-actin was used as a control and

amplified at 23 cycles. All RT-PCR products were analyzed

by gel electrophoresis. In short, 2 Al of the sample was

separated on 1.5% agarose gels along with a molecular

weight marker for reference. Resultant bands were stained

with ethidium bromide and visualized by using the Lumi-

Imageri system (Boehringer, Mannheim, Germany).

Changes in expression were analyzed by densitometry and

expressed as arbitrary units. All values were normalized to

the constitutive expression of the housekeeping gene h-actin.

2.8. Immunofluorescence staining

For immunofluorescence, OLN-93 cells cultured on

poly-d-lysine-coated 8-well glass tissue chamber slides


were washed with prewarmed PBS and subsequently fixed

with 4% paraformaldehyde for 15 min. After washing with

PBS, the cells were pre-incubated with 10% normal rat

serum (NRS) in PBS containing 1% (w/v) bovine serum

albumin (BSA) (PBS/BSA) for 10 min to prevent a specific

binding. To allow antibodies and blocking agents to enter

the fixed cells, 0.1% saponin was added to the blocking–

and all the consecutive wash– and incubation steps. Cells

were washed three times for 5 min in PBS and then

incubated overnight at 4 8C with a mouse monoclonal

antibody against ZO-1 (IgG1; 1:25 dilution), CNP (IgG1;

1:100 dilution), or MBP (IgG2b; 1:100 dilution) in PBS/

BSA. After three times washing for 5 min in PBS, cells were

incubated with the secondary antibody in PBS/BSA con-

taining 1% NRS for 1 h at room temperature. A goat anti-

mouse IgG Alexa FluorR 594 (1:400) was used as a

conjugate for ZO-1, CNP, and MBP staining. After three

times washing for 5 min in PBS/BSA, cells were incubated

with Hoechst 33258 (1:5000 of a 10 ng/10 ml stock

solution; Sigma-Aldrich Chemie, Germany) for 1 min to

stain the nuclei. The slides were washed in PBS, covered

and mounted with Fluorostab (ICN Pharmaceuticals,

Aurora, Ohio, USA). Omission of the primary antibodies

served as negative control. The cells were examined with a

fluorescence microscope (Nikon Eclipse E800) and record-

ings were made with a digital camera (NIKON DXM1200).

2.9. Statistics

Statistical analyses were performed using SPSS statistical

package (11.5.0; SPSS Inc., Chicago, IL). Data obtained

from the IGF-I differentiation experiments are expressed as

mean T standard error of the mean (SEM) and analyzed

using univariate analysis of variance (Unianova) followed

by a least significant difference (LSD) post hoc test to make

pairwise multiple comparisons between groups. Western

blot data from the oligodendrocyte/astrocyte co-culture

experiment are expressed as mean % of control T SEM

and were analyzed with Unianova followed by Dunnett’s

post hoc test to compare groups against the control mean. To

make pairwise comparisons between group means of mono-

and co-cultures, a Bonferroni post hoc test was used. In all

cases, a P value <0.05 was considered significant.

Fig. 1. CNP (A) and ZO-1 (B) protein expression determined by Western

blotting in samples of OLN-93 cells differentiated in serum-free medium in

the absence (mono-culture) or presence (co-culture) of C6 astrocytes for 1–3

days. Data are expressed as percentage of control at t = 0 (mean T SEM; n =

3). **P < 0.01 and *P < 0.05 versus control at t = 0, #P < 0.05 versusOLN-93

mono-culture.

3. Results

3.1. Co-culture of OLN-93 oligodendroglia with C6

astrocytes

OLN-93 cells maintained in culture with 10% serum,

proliferate and reveal a bipolar morphology [32]. How-

ever, when these cells were grown under serum-free

conditions at low density, they spontaneously start to

differentiate [32]. To study OLN-93 differentiation in the

presence of astrocytes as a source of growth factors, a

co-culture system with C6 cells was used. Morphological

evaluation of OLN-93 cells grown in the absence of C6

astrocytes for 3 days showed a mixture of bipolar

undifferentiated and some process bearing differentiating

OLN-93 cells (data not shown). However, the appearance

of the latter differentiation stage was not so abundant as

compared to cells differentiated in the presence of IGF-I

in our follow-up experiments. After 3 days co-culture

with C6 astrocytes, the morphological appearance of the

OLN-93 cells was not changed compared to differentiated

mono-cultures. At the protein level, differentiated OLN-

93 cells cultured in the absence of C6 astrocytes showed

a significant increase of both CNP and ZO-1 expression

compared to non-differentiated cells (Figs. 1A and B,


respectively). In contrast, differentiating OLN-93 cells in

the presence of C6 astrocytes showed marked inhibition

of CNP expression (P < 0.05; mono-culture versus co-

culture at d3), while the expression of ZO-1 was not

changed during the co-culture with astrocytes compared

to OLN-93 mono-cultures. These results show that OLN-

93 cells mature well in serum-free medium and that both

CNP and ZO-1 are suitable markers for this initial stage

of maturation. Astrocytes do not promote this maturation

and in further studies we therefore examined in our

further studies the effect of the most appropriate growth

factor IGF-I.

3.2. Effect of IGF-I on morphology of differentiating

OLN-93 cells

OLN-93 cell morphology was evaluated during diffe-

rentiation in the absence or presence of IGF-I. When

cultured under serum-free conditions in the absence of

IGF-I, some differentiating cells appeared to have a multi-

polar shape, while the majority of cells appeared to be

bipolar (Figs. 2A and B). Addition of IGF-I to the OLN-93

cultures resulted in a higher degree of differentiation

reflected by the increased numbers of cells with extended

process branching and the formation of extensive membrane

networks (Figs. 2C and D). Quantification of the number of

bipolar and more differentiated cells was not possible

because of the crossover of cells. Therefore, we determined

other maturation markers by immunofluorescence orWestern

blot analysis for protein expression, and RT-PCR for mRNA

expression.

Fig. 2. (A–D) Cell morphology of OLN-93 oligodendrocytes cultured on

poly-d-lysine-coated dishes in serum-free medium in the absence or presence

of IGF-I (100 ng/ml) for 3–6 days. Control cultures containedmainly bipolar

oligodendrocytes, whereas IGF-I-treated cultures showed oligodendrocytes

with multiple processes and extended membrane network formation

(arrows).

3.3. Immunofluorescence staining of OLN-93

oligodendroglia

To further characterize the effect of IGF-I on diffe-

rentiating OLN-93 cells, we studied the expression and

localization of ZO-1 tight junction protein, CNP, and MBP

differentiation markers. It was observed that ZO-1 and CNP

were mainly found in the cell cytoplasm and primary

processes of 3-day differentiated OLN-93 oligodendroglia.

Moreover, there was no difference between cells incubated

with or without IGF-I (data not shown), which is in line

with our findings obtained by Western blot analysis.

Similarly, MBP expression was present in the cytoplasm

and the primary processes, but could also be found in

secondary processes (Figs. 3). Immunofluorescence stain-

ing for MBP was increased in IGF-I-treated cells as

compared to non-treated controls with an increased amount

of MBP positive myelin deposits. This result was also

supported by quantification of our data after MBP Western

blot analysis.

3.4. Effect of IGF-I on CNP and ZO-1 protein expression in

differentiated OLN-93 cells

Kinetics and the effect of IGF-I incubation on OLN-93

differentiation was also determined by measuring CNP, ZO-

1, and MBP protein expression (Fig. 4A). In the absence of

IGF-I, the protein expression of CNP and ZO-1 was not

altered after 6 days of culture, whereas MBP protein

expression was significantly increased in 6-day cultures as

compared to 3-day cultures. However, incubation with IGF-I

did not significantly affect CNP or ZO-1 protein expression

during 3- to 6-day culture follow-up as compared to their

respective controls. In addition, after 6 days of culture in the

presence of IGF-I, ZO-1 expression was significantly

enhanced when compared to non-treated 3-day cultures.

Moreover, after 3 days, culture incubation with IGF-I

significantly increased MBP protein expression as compared

to the non-treated controls, thus confirming our immuno-

fluorescence data.

3.5. Effect of IGF-I on MBP and PLP/DM20 mRNA

expression in OLN-93 cells

The effect of IGF-I on OLN-93 differentiation was also

evaluated by measuring the mRNA expression of myelin-

specific proteins using RT-PCR (Fig. 4B). The mRNA of

MBP and DM20, a splice product of PLP, are both

expressed in differentiating OLN-93 cells. The expression

of MBP mRNA did not change during 3- to 6-day culture,

nor did IGF-I administration enhance its expression. The

expression of DM20 mRNA however was significantly

increased in both control and IGF-I-incubated cultures after

6-day differentiation. Moreover, DM20 mRNA levels were

also significantly higher after 6 days in the cultures exposed

to IGF-I as compared to non-treated 3-day controls.

Fig. 4. CNP, ZO-1, and MBP protein expression (A) and MBP and DM20 mRNA

absence or presence of IGF-I (100 ng/ml) for 3–6 days. Protein and mRNA data

*P < 0.05 versus 3-day differentiated cultures T IGF-I.

Fig. 3. Effect of 3 days of IGF-I (100 ng/ml) administration on MBP

immunostaining in OLN-93 oligodendroglia (400�). MBP staining in

control cultures (A) and after IGF-I administration (B). MBP protein

expression is present in the cytoplasm, primary and secondary processes.

Overall immunofluorescence staining for MBP was increased in IGF-I-

treated cells as compared to non-treated controls. Note the increased

abundance of MBP deposits in IGF-I-treated cells (white arrows). Staining

with the MBP-specific antibodies is represented by red fluorescence where

nuclei were counterstained by blue fluorescence (Hoechst).


Although we detected PLP and MOG mRNA expression

in control material of adult rat brain using RT-PCR, PLP and

MOG mRNA expression were very weak or undetectable in

samples of OLN-93 cells after 3- or 6-day differentiation

(data not shown). This observation supported earlier

findings that differentiating OLN-93 cells do not fully

mature in vitro, but remain between a stage of immature and

mature differentiated cells [32]. Fig. 5 shows a schematic

representation of the proposed time course of OLN-93

morphological and biochemical differentiation.

4. Discussion

Understanding the factors that promote oligodendrocyte

development and myelination is of particular importance to

expression (B) in OLN-93 cells differentiated in serum-free medium in the

are expressed as mean of arbitrary units T SEM (n = 3–4). **P < 0.01 and

Fig. 5. A schematic overview of themorphologic and biochemical markers of maturation and differentiation during the course of OLN-93 oligodendroglia culture.


demyelinating diseases, such as MS. Astrocytes have been

described as local sources of IGF-I and basic fibroblast

growth factor (bFGF) in the CNS [21,34,37,38]. These are

growth factors capable of stimulating oligodendrocyte

differentiation and subsequent myelin production. We

therefore set up a co-culture system of confluent grown

C6 astrocytes together with differentiating OLN-93 oligo-

dendroglia. Both cell types were physically separated and

grown in different compartments of a 6-well co-culture

system with permeable inserts. In such a system, direct

cell–cell contact is excluded, but soluble factors can be

exchanged through the micropores of the insert. The OLN-

93 cells differentiated in serum-free medium in the absence

of C6 astrocytes and this differentiation was reflected in a

gradual increase of CNP and ZO-1 protein expression over

time. Our results further revealed that co-culture of diffe-

rentiating OLN-93 cells with C6 astrocytes did not promote

differentiation of the oligodendroglia as judged by mor-

phology or CNP and ZO-1 protein expression.

These findings are different from those reported by Oh

and Yong [29], who observed that process outgrowth of adult

human oligodendrocytes is promoted by soluble growth

factors produced by astrocytes. This effect was related to the

excretion of bFGF in the culture medium, while direct

contact with the astrocyte extracellular matrix promoted the

oligodendrocyte process extension even further. On the other

hand, it has also been reported that MBP mRNA trans-

location, an important event in oligodendrocyte diffe-

rentiation, can be inhibited by astrocytes in vitro [1]. This

inhibition did not appear to be mediated through soluble

factors secreted by astrocytes or by its extracellular matrix,

but rather through direct physical contact between oligoden-

drocytes and astrocytes. From these studies, it can be

concluded that the modulatory role of astrocytes in

oligodendrocyte differentiation may vary depending on the

direct cell–cell contact between those two cell types.

Astrocytes can play a dual role in oligodendrocyte diffe-

rentiation and are capable to either promote or inhibit this

process through direct contact or by the release of soluble

factors. The C6 cell line has been described to express

multiple growth factors at the mRNA level [39], like IGF-I

[8,17] and bFGF [31], and both proteins are synthesized and

secreted as well [8,17]. Whereas IGF-I and bFGF have been

recognized as promoters of oligodendrocyte maturation

[24,29], it cannot be excluded that C6 cells also secrete

other (growth) factors that are unfavorable for CNP protein

expression during OLN-93 differentiation. To further illu-

minate these astrocyte/oligodendrocyte interactions, exten-

sive research is recommended. For our current study, we

focused on IGF-I and its effect on OLN-93 differentiation.

Following our finding that CNP and ZO-1 protein

expression were increased after induction of OLN-93

differentiation under serum-free conditions, we investigated

the effect of IGF-I on further differentiation. Insulin-like

growth factors, including IGF-I, IGF-II, and insulin, play an

important role in development and myelination in the central

nervous system. In mice overexpressing IGF-I, brain weight

and myelin content were significantly increased which was

associated with an increased amount of myelin produced per

oligodendrocyte [6]. Morphological evaluation of diffe-

rentiating OLN-93 cells revealed that IGF-I administration

induced a high degree of differentiation reflected by

increased numbers of process-bearing cells with extended

branches and formation of an extensive membrane network.

Non-treated cultures on the other hand consisted of

predominantly bipolar and poorly differentiated OLN-93

cells. At the protein level, CNP and ZO-1 expression were

not significantly increased during this further IGF-I-induced

differentiation. From this, we conclude that CNP and ZO-1

are excellent markers for early OLN-93 differentiation, but

not for further OLN-93 differentiation induced by IGF-I.

The mRNA expression of MBP, a major myelin protein,

was not increased during differentiation and not altered by

IGF-I administration. However, immunostaining for MBP

and Western blot analysis revealed an increased MBP

protein expression after IGF-I incubation after 3 days.

These data are confirmed by Saneto et al. [33]. According to

their study, IGF-I exposure increased MBP protein expres-

sion in isolated oligodendrocyte progenitor cells down-

stream from transcription, which may explain why in our

hands clearly morphological differentiated OLN-93 cells did

not express increased MBP mRNA levels. Furthermore,


these findings further support the results that were obtained

with other maturation markers, e.g., DM20. The mRNA

expression pattern of DM20, a splice variant of PLP, showed

a time-dependent and significant increase during further

OLN-93 differentiation in the presence of IGF-I. Thus, IGF-

I growth factor administration is also required for further

OLN-93 differentiation as determined by increased DM20

mRNA expression. Future research should further elucidate

the relation between protein and mRNA expression of

differentiation markers during oligodendroglia maturation.

At present, the function of ZO-1 tight junction protein

expression in oligodendrocytes is unclear. Our data show

that ZO-1 expression was increased in differentiating OLN-

93 oligodendroglia. ZO-1 protein expression was even

further increased after 6 days of differentiation in the

presence of IGF-I, indicating ZO-1 protein to be a potential

marker of early oligodendrocyte differentiation. It has been

suggested in literature that ZO-1 plays a role in fencing

plasma and myelin membrane domains in mature oligoden-

drocytes [9]. Other published data suggested that a primary

function of myelin tight junctions is to perfuse the peri-

axonal space [10]. Whether ZO-1 proteins are involved in

this function remains to be elucidated and further inves-

tigation is required to establish the precise role of ZO-1

during oligodendrocyte differentiation.

In conclusion, these studies show that increase of CNP

and ZO-1 protein expression reflects early differentiation of

OLN-93 cells. During further IGF-I-stimulated maturation,

there are other features like morphology, MBP protein, and

DM20 mRNA expression that can be relevant markers.

Acknowledgment

The authors wish to thank Dr. R.V. Verdooren for

assisting with the statistical data analysis.

References

[1] S. Amur-Umarjee, T. Phan, A.T. Campagnoni, Myelin basic protein

mRNA translocation in oligodendrocytes is inhibited by astrocytes in

vitro, J. Neurosci. Res. 36 (1993) 99–110.

[2] M.H. Barnett, J.W. Prineas, Relapsing and remitting multiple

sclerosis: pathology of the newly forming lesion, Ann. Neurol. 55

(2004) 458–468.

[3] J.M. Bronstein, K. Chen, S. Tiwari-Woodruff, H.I. Kornblum,

Developmental expression of OSP/claudin-11, J. Neurosci. Res. 60

(2000) 284–290.

[4] J.M. Bronstein, S. Tiwari-Woodruff, A.G. Buznikov, D.B. Stevens,

Involvement of OSP/claudin-11 in oligodendrocyte membrane

interactions: role in biology and disease, J. Neurosci. Res. 59

(2000) 706–711.

[5] W. Bruck, C. Stadelmann, Inflammation and degeneration in multiple

sclerosis, Neurol. Sci. 24 (2003) S265–S267.

[6] M.J. Carson, R.R. Behringer, R.L. Brinster, F.A. McMorris, Insulin-

like growth factor I increases brain growth and central nervous system

myelination in transgenic mice, Neuron 10 (1993) 729–740.

[7] D.M. Chari, W.F. Blakemore, Efficient recolonisation of progenitor-

depleted areas of the CNS by adult oligodendrocyte progenitor cells,

Glia 37 (2002) 307–313.

[8] S.D. Chernausek, Insulin-like growth factor-I (IGF-I) production by

astroglial cells: regulation and importance for epidermal growth

factor-induced cell replication, J. Neurosci. Res. 34 (1993) 189–197.

[9] H. de Vries, D. Hoekstra, On the biogenesis of the myelin sheath:

cognate polarized trafficking pathways in oligodendrocytes, Glyco-

conj. J. 17 (2000) 181–190.

[10] C.A. Dyer, The structure and function of myelin: from inert membrane

to perfusion pump, Neurochem. Res. 27 (2002) 1279–1292.

[11] R.J. Franklin, G.L. Hinks, Understanding CNS remyelination: clues

from developmental and regeneration biology, J. Neurosci. Res. 58

(1999) 207–213.

[12] R.J. Franklin, G.L. Hinks, R.H. Woodruff, M.T. O’Leary, What roles

do growth factors play in CNS remyelination? Prog. Brain Res. 132

(2001) 185–193.

[13] F. Giuliani, V.W. Yong, Immune-mediated neurodegeneration and

neuroprotection in MS, Int. MS J. 10 (2003) 122–130.

[14] A. Gow, C.M. Southwood, J.S. Li, M. Pariali, G.P. Riordan, S.E.

Brodie, J. Danias, J.M. Bronstein, B. Kachar, R.A. Lazzarini, CNS

myelin and sertoli cell tight junction strands are absent in Osp/claudin-

11 null mice, Cell 99 (1999) 649–659.

[15] J.B. Grinspan, J. Stern, B. Franceschini, T. Yasuda, D. Pleasure,

Protein growth factors as potential therapies for central nervous

system demyelinative disorders, Ann. Neurol. 36 (1994) S140–S142

(Suppl.).

[16] D. Gveric, M.L. Cuzner, J. Newcombe, Insulin-like growth factors

and binding proteins in multiple sclerosis plaques, Neuropathol. Appl.

Neurobiol. 25 (1999) 215–225.

[17] W. Kiess, L. Lee, D.E. Graham, L. Greenstein, L.Y. Tseng, M.M.

Rechler, S.P. Nissley, Rat C6 glial cells synthesize insulin-like growth

factor I (IGF-I) and express IGF-I receptors and IGF-II/mannose 6-

phosphate receptors, Endocrinology 124 (1989) 1727–1736.

[18] S. Komoly, L.D. Hudson, H.D. Webster, C.A. Bondy, Insulin-like

growth factor I gene expression is induced in astrocytes during

experimental demyelination, Proc. Natl. Acad. Sci. U. S. A. 89 (1992)

1894–1898.

[19] H. Lassmann, W. Bruck, C. Lucchinetti, M. Rodriguez, Remyelination

in multiple sclerosis, Mult. Scler. 3 (1997) 133–136.

[20] J.M. Levine, R. Reynolds, J.W. Fawcett, The oligodendrocyte

precursor cell in health and disease, Trends Neurosci. 24 (2001) 39–47.

[21] X. Liu, D.L. Yao, C.A. Bondy, M. Brenner, L.D. Hudson, J. Zhou,

H.D. Webster, Astrocytes express insulin-like growth factor-I (IGF-I)

and its binding protein, IGFBP-2, during demyelination induced by

experimental autoimmune encephalomyelitis, Mol. Cell. Neurosci. 5

(1994) 418–430.

[22] B.A. Masters, H. Werner, C.T. Roberts Jr., D. LeRoith, M.K. Raizada,

Insulin-like growth factor I (IGF-I) receptors and IGF-I action in

oligodendrocytes from rat brains, Regul. Pept. 33 (1991) 117–131.

[23] F.A. McMorris, M. Dubois-Dalcq, Insulin-like growth factor I

promotes cell proliferation and oligodendroglial commitment in rat

glial progenitor cells developing in vitro, J. Neurosci. Res. 21 (1988)

199–209.

[24] F.A. McMorris, R.W. Furlanetto, R.L. Mozell, M.J. Carson, D.W.

Raible, Regulation of oligodendrocyte development by insulin-like

growth factors and cyclic nucleotides, Ann. N. Y. Acad. Sci. 605

(1990) 101–109.

[25] F.A. McMorris, R.L. Mozell, M.J. Carson, Y. Shinar, R.D. Meyer,

N. Marchetti, Regulation of oligodendrocyte development and

central nervous system myelination by insulin-like growth factors,

Ann. N. Y. Acad. Sci. 692 (1993) 321–334.

[26] J.E. Merrill, N.J. Scolding, Mechanisms of damage to myelin and

oligodendrocytes and their relevance to disease, Neuropathol. Appl.

Neurobiol. 25 (1999) 435–458.

[27] R.J. Milner, C. Lai, K.A. Nave, D. Lenoir, J. Ogata, J.G. Sutcliffe,

Nucleotide sequences of two mRNAs for rat brain myelin proteolipid

protein, Cell 42 (1985) 931–939.


[28] F. Miragall, D. Krause, U. de Vries, R. Dermietzel, Expression of the

tight junction protein ZO-1 in the olfactory system: presence of ZO-1

on olfactory sensory neurons and glial cells, J. Comp. Neurol. 341

(1994) 433–448.

[29] L.Y. Oh, V.W. Yong, Astrocytes promote process outgrowth by adult

human oligodendrocytes in vitro through interaction between bFGF

and astrocyte extracellular matrix, Glia 17 (1996) 237–253.

[30] J. Penderis, S.A. Shields, R.J. Franklin, Impaired remyelination and

depletion of oligodendrocyte progenitors does not occur following

repeated episodes of focal demyelination in the rat central nervous

system, Brain 126 (2003) 1382–1391.

[31] P.P. Powell, M. Klagsbrun, Regulation of basic fibroblast growth

factor mRNA expression in rat C6 glioma cells, Exp. Cell Res. 209

(1993) 224–230.

[32] C. Richter-Landsberg, M. Heinrich, OLN-93: a new permanent

oligodendroglia cell line derived from primary rat brain glial cultures,

J. Neurosci. Res. 45 (1996) 161–173.

[33] R.P. Saneto, K.G. Low, M.H. Melner, J. de Vellis, Insulin/insulin-like

growth factor I and other epigenetic modulators of myelin basic protein

expression in isolated oligodendrocyte progenitor cells, J. Neurosci.

Res. 21 (1988) 210–219.

[34] H.D. Webster, Growth factors and myelin regeneration in multiple

sclerosis, Mult. Scler. 3 (1997) 113–120.

[35] H.C. Wilson, C. Onischke, C.S. Raine, Human oligodendrocyte

precursor cells in vitro: phenotypic analysis and differential response

to growth factors, Glia 44 (2003) 153–165.

[36] G. Wolswijk, Oligodendrocyte precursor cells in the demyelinated

multiple sclerosis spinal cord, Brain 125 (2002) 338–349.

[37] D.L. Yao, X. Liu, L.D. Hudson, H.D. Webster, Insulin-like

growth factor I treatment reduces demyelination and up-regulates

gene expression of myelin-related proteins in experimental auto-

immune encephalomyelitis, Proc. Natl. Acad. Sci. U. S. A. 92

(1995) 6190–6194.

[38] D.L. Yao, N.R. West, C.A. Bondy, M. Brenner, L.D. Hudson, J.

Zhou, G.H. Collins, H.D. Webster, Cryogenic spinal cord injury

induces astrocytic gene expression of insulin-like growth factor I and

insulin-like growth factor binding protein 2 during myelin regene-

ration, J. Neurosci. Res. 40 (1995) 647–659.

[39] A. Zaheer, W. Zhong, E.Y. Uc, D.R. Moser, R. Lim, Expression of

mRNAs of multiple growth factors and receptors by astrocytes and

glioma cells: detection with reverse transcription-polymerase chain

reaction, Cell Mol. Neurobiol. 15 (1995) 221–237.

Documents

Markers for OLN-93 oligodendroglia differentiation