1

Misidentification of Saprochaete clavata as Magnusiomyces capitatus in clinical isolates: 1

Utility of ITS sequencing, MALDI-TOF and Importance of reliable databases 2

3

Marie Desnos-Ollivier,a,b Catherine Blanc,a,b Dea Garcia-Hermoso,a,b Damien Hoinard,a,b 4

Alexandre Alanio,a,b,c,d Françoise Dromera,b* 5

Institut Pasteur, Unité de Mycologie Moléculaire, Centre National de Référence Mycoses 6

Invasives et Antifongiques, Paris, Francea, CNRS URA3012b, Laboratoire de Parasitologie-7

Mycologie ; Groupe Hospitalier Saint-Louis-Lariboisière-Fernand-Widal, Assistance 8

Publique-Hôpitaux de Parisc, Université Paris-Diderot, Sorbonne Paris-Citéd 9

Address correspondence to 10

Françoise Dromer : 11

Unité de Mycologie Moléculaire, 12

Institut Pasteur, 13

28, rue du Dr. Roux, 75724 Paris Cedex 15, France. 14

Phone: +33 1 40 61 32 50. Fax: +33 1 45 68 84 20. E-mail: dromer@pasteur.fr 15

16

Running title 17

Misidentification of Geotrichum spp. clinical isolates 18

Abstract 19

Saprochaete clavata and Magnusiomyces capitatus are human pathogens, frequently mistaken 20

for each other due to similar phenotypes and erroneous or limited databases. Based on ITS 21

sequences, we propose species-specific carbon assimilation patterns and MALDI-TOF 22

JCM Accepts, published online ahead of print on 2 April 2014J. Clin. Microbiol. doi:10.1128/JCM.00039-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

2

fingerprints that allow identification of S. clavata, M. capitatus and Galactomyces candidus to 23

the species level. 24

Short Form Paper 25

Saprochaeta clavata (de Hoog, Smith & Guého) de Hoog & Smith (2004) (synonym 26

Geotrichum clavatum de Hoog, Smith & Guého 1986) is an ascomycetous fungus (1, 2). 27

Colonies are white farinose, dry and consist of true hyphae that branch at acute angles and 28

disarticulate into arthroconidia. This species has rarely been isolated from human samples. Its 29

ecology, reservoir and importance in agriculture and food are unknown (3). This species is 30

closely related to a known human pathogen Magnusiomyces capitatus (de Hoog, Smith & 31

Guého) de Hoog & Smith (2004) (formerly known as Geotrichum capitatum) (4). 32

Magnusiomyces capitatus is reported causing invasive infections especially in patients with 33

hematological malignancies (5, 6) and has even been involved in several outbreaks often 34

associated with contaminated dairy products (7-9). Initially, De Hoog et al. (1986) described 35

the new species G. clavatum to distinguish strains identified as G. capitatum but with a 36

distinct growth on cellobiose, salicin and arbutin (2). However, commercially available strips 37

lack salicin and arbutin, and are thus useless for an accurate identification. Furthermore, the 38

databases coming with the automated platforms for microbial identification based on sugar 39

assimilation patterns or mass-spectrometry profiles lack this species (10) or even show low 40

discrimination for M. capitatus (11, 12). 41

From analysis of D1/D2 sequence divergence, Phaff et al. mentioned the apparent 42

conspecificity of G. clavatum, Dipodascus spicifer and G. capitatum (13). In fact, the D1/D2 43

sequences of the three species have 99% of similarity. But Kurtzman and Robnett, considered 44

only G. clavatum and D. spicifer to be synonymous (14). Based on the ITS sequence analysis 45

it was demonstrated that G. clavatum differed from G. capitatum (96% of similarity) and that 46

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

3

it belongs to the Saprochaete/Magnusiomyces clade and therefore G. clavatum was 47

transferred to the anamorph genus Saprochaete (1). Despite the use of ITS regions 48

sequencing, the majority of clinical isolates of S. clavata are identified as M. capitatus 49

because nucleotide sequences of S. clavata available in the public database such as Genbank 50

are either misidentified or too short (163 bp). In order to provide clues for species 51

identification that could be apart from ITS sequencing, we analyzed phenotypic 52

characteristics of clinical isolates identified as Geotrichum sp. based on techniques on profiles 53

generated by routinely available techniques (sugar assimilation pattern (ID32C, BioMérieux) 54

or MALDI-TOF). 55

For the 101 clinical isolates received as Geotrichum spp. since 2003 at the National Reference 56

Center for Mycoses and Antifungals (NRCMA), purity was checked by using chromogenic 57

medium (BBL™ CHROMagar™, Becton-Dickinson, USA). Urease activity (urea-indole 58

medium, bioMérieux, Marcy-l’Etoile, France) and carbon assimilation patterns (ID32C and 59

50CH, bioMérieux) were determined. The D1/D2 and ITS1-5.8S-ITS2 regions of the 60

ribosomal DNA were sequenced by using universal primers (NL1/NL4 (15) and V9D/LS266 61

(16, 17), respectively). The sequences of the ITS1-5.8S-ITS2 regions were delimited by the 62

sequences of the primers ITS1 and ITS4 (TCCGTAGGTGAACCTGCGG / 63

GCATATCAATAAGCGGAGGA) and sequences were compared with the nucleotide 64

sequence of the type strain of S. clavata CBS425.71 (Genbank accession number KF984489), 65

M. capitatus CBS 162.80 (Accession number KF984490) and Galactomyces candidus 66

(teleomorph of Geotrichum candidum) CBS 178.71 (Accession number KF984491). For all 67

clinical isolates and type strains, PCR fingerprinting technique was performed with the core 68

sequence of phage M13 (5’-GAGGGTGGCGGTTCT-3’) and OPE4 (5’-GTGACATGCC-3’) 69

as a single primer (7, 18). For 19 clinical isolates (15 S. clavata, 4 M. capitatus) and the 3 70

type strains, MALDI-TOF fingerprints were obtained using mass spectrometry technology on 71

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

4

the Vitek® MS automate (bioMérieux) after 24h and 48h growth on malt extract agar plates 72

with gentamycin and chloramphenicol (Merck) and on Sabouraud agar slants with gentamycin 73

and chloramphenicol (Biorad) and analyzed using the Vitek MS version 2.0 reference strain 74

database. 75

Based on ITS regions sequencing, 59/101 isolates were eventually identified as S. clavata, 27 76

as M. capitatus and 15 as G. candidus. Delimited sequences of ITS and D1/D2 regions 77

between S. clavata (464pb) and M. capitatus (454pb) have 96% and 99% of similarity, 78

respectively. RAPD analysis suggests that species-specific fingerprintings may be obtained 79

(Figure 1). This technique however cannot be envisioned as a routine means for species 80

identification. Comparison of ID32C profiles allowed differentiating species-specific carbon 81

assimilation profiles (Table), with 10 codes specific for M. capitatus, 8 for S. clavata and 4 82

for G. candidus. Using Vitek® MS and the corresponding database, identification was 83

confirmed for the 4 clinical isolates and the type strain of M. capitatus, but no identification 84

was obtained for the other 17 isolates in the v. 2.0 database. However, when analyzing 85

MALDI-TOF profiles of the 22 isolates, three groups corresponding to the three species could 86

be delineated based on specific peaks (Figure 2). 87

These results underline the importance of using specialized databases such as that of the 88

Centraalbureau voor Schimmelcultures (CBS, 89

http://www.cbs.knaw.nl/collections/BioloMICSSequences.aspx?file=all) where taxonomy is 90

more reliable than in public repositories as pointed out by Nilsson and colleagues (19). It also 91

shows the importance of incrementing databases according to the latter developments of 92

fungal taxonomy. 93

This work was supported by Institut Pasteur and Institut de Veille Sanitaire. 94

Acknowledgments 95

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

5

The technical help of the sequencing facility and specifically that of Laure Diancourt, Anne-96

Sophie Delannoy, Jean-Michel Thiberge (Genotyping of Pathogens and Public Health, Institut 97

Pasteur) is gratefully acknowledged. We thank members of the French Mycoses Study Group, 98

who provided the isolates used in the present study, in alphabetical order of the cities: 99

Nathalie Brieu, Evelyne Lagier (Aix-en-Provence); Jean-Philippe Bouchara, Marc Pihet, 100

(Angers); Cécile Jensen (Avignon), Frédéric Grenouillet (Besançon) ; Christian Chochillon 101

(Hôpital Bichat, Paris) ; Isabelle Accoceberry, Olivier Albert (Bordeaux); Julie Bonhomme 102

(Caen); Nathalie Fauchet (Créteil) ; Philippe Poirier, Monique Cambon (Clermont-Ferrand); 103

Pierre Cahen (Foch); André Paugam, Marie-Thérèse Baixench (Hôpital Cochin, Paris) ; 104

Dominique De Briel (Colmar) ; Frédéric Dalle (Dijon); Bernadette Lebeau (Grenoble); 105

Françoise Botterel (Hôpital Henri Mondor, Paris) ; Muriel Cornet (Hôpital de l’Hôtel Dieu, 106

Paris); Odile Eloy (Le Chesnay), Boualem Sendid (Lille); Stéphane Ranque (Marseille) ; 107

Nathalie Bourgeois, Philippe Rispail (Montpellier); Malik Al Nakib (Montsouris, Paris) ; 108

Marie Machouart (Nancy); Florent Morio (Nantes) ; Marie-Elisabeth Bougnoux (Hôpital 109

Necker Enfants Malades, Paris); Martine Garri-Toussaint (Nice) ; Didier Poisson (Orléans); 110

Marie-Francoise David, Najiby Kassis-Chikhani Liliana Mihaila (Villejuif), Charles Soler 111

(Percy, Clamart); Anne Gaschet, Philippe Geudet (Perpignan); Annick Datry, Sophie Brun 112

(Hôpital de la Pitié-Salpêtrière, Paris); Christine Chaumeil (Quinze-Vingt, Paris), Dominique 113

Toubas (Reims); Jean-Pierre Gangneux (Rennes); Stéphane Bonacorsi (Hôpital Robert Debré, 114

Paris); Loïc Favennec, Gilles Gargala (Rouen); Hélène Raberin (St Etienne) ; Stéphane 115

Bretagne (Hôpital Saint-Louis, Paris) ; Valérie Letscher-Bru (Strasbourg); Sophie Cassaing 116

(Toulouse) and our Europeans colleagues Konrad Mühlethaler, Stefan Zimmerli (Institute for 117

Infectious Diseases, University of Bern, Bern, Switzerland); Polona Zalar (Biology 118

Department, Biotechnical Faculty, University of Ljubljana, Ljubljana, Slovenia); Ferran 119

Sánchez-Reus, Merce Gurgui (Hospital de la Santa Creu i Sant Pau, Barcelona, Spain). 120

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

6

References 121

1. De Hoog G.S.,Smith M.T. 2004. The ribosomal gene phylogeny and species 122

delimitation in Geotrichum and its teleomorphs. . Studies in Mycology. 50:489-515. 123

2. De Hoog G.S., Smith M.T.,Guého E. 1986. A revision of the genus Geotrichum and 124

its teleomorphs. . Stud. Mycol. 29:1-131. 125

3. de Hoog G.S.,Smith M.T. 2011. Saprochaete Coker & Shanor ex D.T.S. Wagner & 126

Dawes (1970). In The Yeasts, a taxonomic study. J.W.F.a.T.B. Kurtzman C.P., editor: 127

Elsevier. 1317. 128

4. de Hoog G.S.,Smith M.T. 2011. Magnusiomyces Zender (1977). In The Yeasts, a 129

taxonomic study. J.W.F.a.T.B. Kurtzman C.P., editor: Elsevier. 565. 130

5. Garcia-Ruiz J.C., Lopez-Soria L., Olazabal I., Amutio E., Arrieta-Aguirre I., 131

Velasco-Benito V., Ponton J.,Moragues M.D. 2013. Invasive infections caused by 132

Saprochaete capitata in patients with haematological malignancies: Report of five 133

cases and review of the antifungal therapy. Rev Iberoam Micol 30:248-255. 134

6. Girmenia C., Pagano L., Martino B., D'Antonio D., Fanci R., Specchia G., Melillo 135

L., Buelli M., Pizzarelli G., Venditti M.,Martino P. 2005. Invasive infections caused 136

by Trichosporon species and Geotrichum capitatum in patients with hematological 137

malignancies: a retrospective multicenter study from Italy and review of the literature. 138

J Clin Microbiol 43:1818-1828. 139

7. Ersoz G., Otag F., Erturan Z., Aslan G., Kaya A., Emekdas G.,Sugita T. 2004. An 140

outbreak of Dipodascus capitatus infection in the ICU: three case reports and review 141

of the literature. Jpn J Infect Dis 57:248-252. 142

8. Gurgui M., Sanchez F., March F., Lopez-Contreras J., Martino R., Cotura A., 143

Galvez M.L., Roig C.,Coll P. 2011. Nosocomial outbreak of Blastoschizomyces 144

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

7

capitatus associated with contaminated milk in a haematological unit. J Hosp Infect 145

78:274-278. 146

9. Martino P., Venditti M., Micozzi A., Morace G., Polonelli L., Mantovani M.P., 147

Petti M.C., Burgio V.L., Santini C., Serra P., Mandelli F. 1990. Blastoschizomyces 148

capitatus: an emerging cause of invasive fungal disease in leukemia patients. Rev 149

Infect Dis 12:570-582. 150

10. Bader O., Weig M., Taverne-Ghadwal L., Lugert R., Gross U.,Kuhns M. 2011. 151

Improved clinical laboratory identification of human pathogenic yeasts by matrix-152

assisted laser desorption ionization time-of-flight mass spectrometry. Clin Microbiol 153

Infect 17:1359-1365. 154

11. Lohmann C., Sabou M., Moussaoui W., Prevost G., Delarbre J.M., Candolfi E., 155

Gravet A.,Letscher-Bru V. 2013. Comparison between the Biflex III-Biotyper and 156

the Axima-SARAMIS systems for yeast identification by matrix-assisted laser 157

desorption ionization-time of flight mass spectrometry. J Clin Microbiol 51:1231-158

1236. 159

12. Giacchino M., Chiapello N., Bezzio S., Fagioli F., Saracco P., Alfarano A., 160

Martini V., Cimino G., Martino P.,Girmenia C. 2006. Aspergillus galactomannan 161

enzyme-linked immunosorbent assay cross-reactivity caused by invasive Geotrichum 162

capitatum. J Clin Microbiol 44:3432-3434. 163

13. Phaff H.J., Blue J., Hagler A.N.,Kurtzman C.P. 1997. Dipodascus starmeri sp. 164

nov., a new species of yeast occurring in cactus necroses. Int J Syst Bacteriol 47:307-165

312. 166

14. Kurtzman C.P.,Robnett C.J. 1998. Identification and phylogeny of ascomycetous 167

yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. 168

Antonie Van Leeuwenhoek 73:331-371. 169

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

8

15. O'Donnell. 1993. Fusarium and its near relatives. In The fungal holomorph : Mitotic, 170

Meiotic and Pleiomorphic speciation in Fungal Systematics. D.R.R.a.J.W. Taylor, 171

editor. Wallingford, UK: CAB. 226. 172

16. de Hoog G.S.,Gerrits van den Ende A.H. 1998. Molecular diagnostics of clinical 173

strains of filamentous Basidiomycetes. Mycoses 41:183-189. 174

17. Masclaux F., Gueho E., de Hoog G.S.,Christen R. 1995. Phylogenetic relationships 175

of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS 176

rRNA sequences. J Med Vet Mycol 33:327-338. 177

18. Gadea I., Cuenca-Estrella M., Prieto E., Diaz-Guerra T.M., Garcia-Cia J.I., 178

Mellado E., Tomas J.F.,Rodriguez-Tudela J.L. 2004. Genotyping and antifungal 179

susceptibility profile of Dipodascus capitatus isolates causing disseminated infection 180

in seven hematological patients of a tertiary hospital. J Clin Microbiol 42:1832-1836. 181

19. Nilsson R.H., Ryberg M., Kristiansson E., Abarenkov K., Larsson K.H.,Köljalg 182

U. 2006. Taxonomic reliability of DNA sequences in public sequence databases: a 183

fungal perspective. PLos ONE 1:e59. 184

185

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

9

Table 1: ID32C profiles for the 101 Geotrichum spp. clinical isolates identified by ITS 186

regions sequencing 187

Isolates with the corresponding profile

Species Number (%) ID32 profile

Magnusiomyces capitatus (n=27)

6 (22.2) 20000100010 6 (22.2) 32000100030 3 (11.1) 22000100010 3 (11.1) 22000100030 3 (11.1) 32000100010 2 (7.4) 30000100010 1 (3.7) 20000100020 1 (3.7) 22000100011 1 (3.7) 30400100030 1 (3.7) 32001100031

Saprochaete clavata (n=59)

23 (38.9) 30100100031 16 (27.1) 30100100011 9 (15.2) 32100100031

3 (5) 30000100030 3 (5) 30000100031

2 (3.4) 30000100011 2 (3.4) 30100100010 1 (1.6) 32100100011

Galactomyces candidus (n=15)

6 (40) 32003100130 6 (40) 32003100131

2 (13.3) 32003100031 1 (6.6) 32003100150

188

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

10

189

Figure 1: Examples of PCR fingerprintings obtained by using M13 primer for clinical isolates 190

of Saprochaete clavata (#1,3,4,5 and 7), Magnusiomyces capitatus (#2, 6, 8 and 9) and type 191

strains of S. clavata (CBS 425.71), M. capitatus (CBS 162.80) and Galactomyces candidus 192

(CBS 178.71). 193

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from

11

194

Figure 2: MALDI-TOF raw spectra for 19 clinical isolates and the type strains (CBS 425.71 195

type strain of Saprochaete clavata, CBS 178.71 type strain of Galactomyces candidus, CBS 196

162.80 type strain of Magnusiomyces capitatus) after 24 hours subculture on 2% Malt 197

dextrose agar plates plus gentamicin and chloramphenicol. 198

on February 11, 2018 by guest

http://jcm.asm

.org/D

ownloaded from