Biological Control 61 (2012) 32–39

Contents lists available at SciVerse ScienceDirect

Biological Control

journal homepage: www.elsevier .com/ locate/ybcon

Management of black rot in cabbage by rhizospheric Pseudomonas species andanalysis of 2,4-diacetylphloroglucinol by qRT-PCR

Shruti Mishra, Naveen K Arora ⇑Department of Microbiology, Institute of Biosciences & Biotechnology, C. S. J. M. University, Kanpur, U.P., India

h i g h l i g h t s

" One of the very few reports onbiological control of black rot incabbage.

" Rhizospheric microbes efficientlymanaged black rot both in vitro andin vivo.

" Root dip treatment was better thansoil and foliar, in black rotmanagement.

" Detection of 2,4-DAPG as one of theseveral metabolite responsible forbiocontrol.

" It’s production was monitored byqRT-PCR of phlD gene in variousconditions.

1049-9644/$ - see front matter � 2012 Elsevier Inc. Adoi:10.1016/j.biocontrol.2011.12.011

⇑ Corresponding author. Present address: Departmbiology, School of Environmental Sciences, Babasahesity, Lucknow, Uttar Pradesh 226025, India. Fax: +91

E-mail addresses: shrucancerian@gmail.com (S.mail.com (N.K Arora).

g r a p h i c a l a b s t r a c t

a r t i c l e i n f o

Article history:Received 27 April 2011Accepted 27 December 2011Available online 2 January 2012

Keywords:2,4-DAPGBiological controlBlack rotPseudomonasqRT-PCRXanthomonas campestris pv campestris

a b s t r a c t

Black rot, an important and potentially destructive bacterial disease of crucifers, is caused by Xanthomo-nas campestris pv campestris (Xcc). The intent of this study was to evaluate rhizospheric bacterial antag-onists to suppress black rot disease in cabbage. Fifty-four rhizosphere bacteria were screened againstvirulent strain of Xcc. Three isolates (TO7, SA3 and CA9) with inhibition diameter > 14 mm were selectedand studied further in greenhouse. In greenhouse study, strains were evaluated for their effect in reduc-ing number of lesions, vein discoloration, necrosis and chlorotic lesions. The TO7 strain was most effec-tive in controlling the disease symptoms than SA3 and CA9. Further, TO7 strain was tested in the field andwas very effective in controlling black rot in cabbage, when applied through root dip method. Based onnucleotide homology and phylogenetic analysis TO7 was identified as nearest homolog of Pseudomonasfluorescens. This strain produced 2,4-diacetylphloroglucinol (2,4-DAPG) which was analyzed in differentphysiological conditions through qRT-PCR analysis of phlD gene, followed by its subsequent effect onantagonistic activity. The TO7 culture of mid log and extended stationary growth phase with shakinghad a maximum phlD expression. Growth temperature and pH had shown direct effect on phlD expres-sion with maximum production at 16 �C and at alkaline pH 8.5. Various carbon sources influenced phlDproduction by different degrees while iron had no significant effect on mRNA expression of phlD. Thestudy demonstrated effective biological control by TO7, thereby indicating the possibility of applicationof rhizobacteria producing 2,4-DAPG for control of black rot.

� 2012 Elsevier Inc. All rights reserved.

ll rights reserved.

ent of Environmental Microb Bhimrao Ambedkar Univer522 2440821.Mishra), nkarora_net@rediff

1. Introduction

Black rot, caused by Xanthomonas campestris pv campestris (Xcc)affects cruciferous crop and are accountable for major agricultureloss worldwide. Xcc, may be seed borne, can infect the plant

S. Mishra, N.K Arora / Biological Control 61 (2012) 32–39 33

through roots, wounds, hydathodes and leaf stomata (Schaad andAlvarez, 1993). Characteristic disease symptoms of black rot areV-shape lesions commencing from leaf margins with blackenedveins, chlorosis of surrounding tissue and discolouration, leadingto leaf fall and plant death.

Some methods for black rot management include the use ofresistant varieties, cultural practices and physical and chemicaltreatment of seeds (Kocks and Ruissen, 1996; Kocks and Zadoks,1996; Taylor et al., 2002). However, the management of black rotis difficult in tropical environments, giving greater importance todevelopment of other control measures such as biocontrol withantagonistic microorganisms. Biological control by rhizosphericbacteria offers an alternative to the use of pesticides. Antagonisticbacteria are considered ideal biological control agents owing totheir rapid growth, easy handling and aggressive colonization ofrhizosphere. Specifically, rhizospheric fluorescent pseudomonadshave received particular attention because of their catabolic versa-tility, excellent root colonizing ability and their capacity to producea wide range of enzymes and metabolites (Saravanakumar andSamiyappan, 2006). There are several modes of action known bythe applied rhizobacteria in controlling plant diseases. Pseudomo-nas spp. exert a protective effect on the roots through antagonismtowards phytopathogenic bacteria by producing metabolites thatinclude hydrogen cyanide (Schippers et al., 1991; Voisard et al.,1989), b-1,3 glucanase, protease (Berg, 1996; Friendlender et al.,1993), auxins, indole-3-acetic acid (Loper and Schroth, 1986), gib-berellins (Ramamoorthy and Samiyappan, 2001), 1-aminocyclo-propane-1-carboxylate deaminase (Jacobson et al., 1994),pyoverdins, pseudobactin and pyochelin (Duijff et al., 1994; Dwiv-edi and Johri, 2003; Leong, 1986), phenazines (Thomashow et al.,1990), pyoluteorin (Dwivedi and Johri, 2003), pyrrolnitrin (Défagoand Haas, 1990), and 2,4-diacetylphloroglucinol (Haas and Keel,2003; Raaijmakers and Weller, 1998; Ran et al., 2005).

A primary mechanism of pathogen inhibition is by the produc-tion of antibiotics. 2,4-diacetylphloroglucinol (DAPG), produced byfluorescent Pseudomonas spp. have the ability to suppress one ormore root and seedling diseases of crop plants caused by soil-bornepathogens. It has been reported that 8-kb cluster involved in thebiosynthesis, regulation, export, and degradation of 2,4-DAPG con-sists of eight genes, phlHGFACBDE, and is conserved at the organi-zational level in 2,4-DAPG-producing strains (Abbas et al., 2004,2002; Bangera and Thomashow, 1999; Bottiglieri and Keel, 2006;Delany et al., 2000; Keel et al., 1996; Schnider-Keel et al., 2000).The key biosynthetic gene is phlD, which displays interesting sim-ilarity to genes for plant chalcone synthases. The utility of phlD as amarker of genetic diversity and population structure among 2,4-DAPG producers has been studied earlier (De La Fuente et al.,2006; Mavrodi et al., 2007, 2001).

Currently there is very limited knowledge available regardingthe biological suppression of black rot in cabbage by the applica-tion of rhizospheric bacteria. The aim of this study is therefore toisolate bacteria from crucifer rhizosphere and screen the organismfor in vitro, in pot and in field antagonistic activity against Xcc. Fur-ther, the study extends to identification and analysis of possiblemetabolite responsible for antagonistic activity by PCR and qRT-PCR. This study may contribute to the introduction of rhizosphericbacteria in biological control of black rot and in better understand-ing of the role of metabolite, 2,4-DAPG.

2. Materials and methods

2.1. Isolation, selection and identification of rhizospheric bacteria

The bacteria were isolated from 18 soil samples collected fromrhizospheric region of different cruciferous plants from various

regions of India, using King’s B (KB) and Luria Bertani (LB) medium.To isolate rhizosphere bacteria, roots were aseptically removedfrom Brassica plant samples by cutting with a sterilized razor blade.Root samples were shaken vigorously to remove loosely adheringsoil. Each root sample was added to 20 ml of sterile phosphate buf-fered saline (PBS) in a polyethylene Ziploc bag. The samples wereserially diluted and spread on LB/KB plates. The plates were incu-bated at 28 �C for 2 days, and individual colonies from each samplewere randomly selected to screen for antibacterial phenotypes. Theantagonist activity of 54 isolates against Xcc was tested accordingto the method of Mitchell and Carter (2000). The 100 ll suspensionof Xcc containing 108 CFU/ml was spread on KB medium and fourwells of 9 mm diameter were punched into agar. In these wells30 ll supernatant, obtained after centrifugation and filtration by0.45 lm filter of 48 h grown culture of each test antagonist(�109 CFU/ml) was added and the plates were incubated at 28 �Cfor 48 h. The experiment was performed in triplicate and repeatedtwice. Bacterial isolates were selected based on inhibition zoneagainst Xcc. The isolated bacteria were tested for their physiologi-cal and biochemical characters according to Bergey’s Manual ofSystematic Bacteriology (Garrity, 2005). All strains were kept at�80 �C in tryptic soya broth (TSB, Difco) amended with glycerol(25%). Further identification of potential isolate was done by 16SrRNA gene amplification, sequencing and analyzed for finding theclosest homologs for the microbe using combination of NCBI Gen-Bank (http://www.ncbi.nlm.nih.gov) and Ribosomal Database Pro-ject. The phytopathogen, X. campestris pv campestris (Xcc) (MTCC2286) was procured from Microbial Type Culture Collection, Insti-tute of Microbial Technology Chandigarh, India.

2.2. Preparation of talc-based formulation of TO7, CA9 and SA3

A loopful of bacteria were inoculated into the KB broth andincubated in a rotary shaker at 150 rpm for 48 h at room temper-ature (28 ± 1 �C). To the 400 ml of bacterial suspension, 1 kg ofthe purified talc powder (sterilized at 105 �C for 12 h), calcium car-bonate 15 g (to adjust the pH to neutral) and carboxymethyl cellu-lose (CMC) 10 g (adhesive) were mixed under sterile conditions,following the method described by Vidhyasekaran and Muthami-lan (1995). The product was shade dried to reduce the moisturecontent (less than 20%), packed in polypropylene bag and sealed.At the time of application, the population of bacteria in the talc for-mulation was 2.5–3 � 109 CFU/g.

2.3. Efficacy of bio-formulations on black rot of cabbage in pot study

A pot culture study was undertaken with the seedlings dip, soiland foliar treatments by using completely randomized design(CRD) with four replicates. Fifteen days old seedlings were takenand the roots alone were dipped in water containing talc formula-tion (20 g/l) for 2 h and then transplanted in pots. For soil applica-tion, 2 g of talc-based formulation per pot was added 10 days afterplanting. The foliar spray was given by dissolving talc based prod-ucts in water (20 g/l) and spraying the filtrate 30 days after plant-ing. The spraying was repeated once every 15 days on threeoccasions. Application of formulation without antagonistic bacteriaon Xcc treated plants was served as control for each class of treat-ment. Four replicates were maintained in each treatment and theexperiment was conducted in CRD. For assessing the black rot inci-dence, Xcc suspension was thoroughly mixed with 20 ml of steriledistilled water, concentration was adjusted to 108 CFU/ml and wassprayed. The efficacy of the bio-formulations on various growthparameters viz., average number of lesions, vein discolouration,necrosis and chlorotic lesions were recorded in all the treatments.

34 S. Mishra, N.K Arora / Biological Control 61 (2012) 32–39

2.4. Efficacy of TO7 bio-formulation on black rot of cabbage in field

The experimental design employed in field study was a split-plot design with four replicates to examine the ability of TO7 incontrolling black rot. One day before transplanting of seedlings, abasal fertilizer (NPK 20:10:10; w:w:w) at 400 kg per ha was ap-plied to soil. Field was furrow irrigated, to supplement rainfall,and kept weed-free by hand hoeing. Four week old seedlings wereplanted on the sides of 30 cm high ridges spaced 60 cm betweenrows and 45 cm within rows. Prior to plantation, seedlings werepicked-up from the pots and washed with tap water to eradicatethe loose soil. Irrigation was carried out once in 15 days. The meth-od of application of the bio-formulation was followed as describedfor pot study in Section 2.3.

The biocontrol effect was quantified by assessing disease sever-ity index (DSI) three months after transplantation. DSI was mea-sured by valuation of external black rot index (EBRindex), andinternal black rot index (IBRindex) as described by Wulff et al.(2002).

EBRindex ¼ ð0aþ 1bþ 2cþ 3dþ 4eÞ=T

Where 0 = none, 1 = > 0–10%, 2 = 11–20%, 3 = 21–30%, 4 = >30%(% describes the surface area of a leaf showing black rot symp-toms); a–e relate to the number of leaves in the infection category;T is the total number of external leaves.

IBRindex was measured by cutting the cabbage plants intoquarters vertically and the internal symptoms were examined asfollows: 0 = No discolouration, no symptoms on the heart leaves;1 = vein discolouration extends <1/2 of the stem, no symptomson heart leaves; 2 = vein discolouration extends >1/2 of the stem,no symptoms on heart leaves; 3 = vein discolouration of the stemand 1–3 of heart leaves and 4 = vein discolouration of the stemand on more than 3 heart leaves.

2.5. Identification of 2,4-DAPG

Bacteria were grown on King’s B medium for 48 h at 27 �C, cen-trifuged and suspended in 100 ml lysis solution and incubated for10 min at 99 �C. The suspension was centrifuged for 1 min at5000 rpm, then it was frozen (�20 �C) for 30 min and after thaw-ing, 4 ml of the supernatant was carefully taken and used for PCRreaction. Production of 2,4-DAPG, intervening sequence-specificprimers Phl2a 20-mer (50-GAGGACGTCGAAGACCACCA-30) andPhl2b 20-mer (50-ACCGCAGCATCGTGTATGAG-30) confirmed bythe method of Raaijmakers et al. (1999), validated the phlD se-quence of Pseudomonas. The 2,4-DAPG production was also con-firmed by thin layer chromatography of ethyl acetate extract ofthe culture fluid with reference sample of 2,4-DAPG. The ethyl ace-tate extract and purified 2,4-DAPG fraction were tested for antag-onistic activity against Xcc.

2.6. Analysis of 2,4-DAPG production by qRT-PCR of phlD gene

2.6.1. Preparation of different physiological and growth conditionsFor the analysis of shaking condition, TO7 culture was kept in a

shaker at 150 rpm until late log phase (�11 h). To prepare cultureof different growth phases, bacteria was grown to late log phaseand diluted 1:500 in 100 ml King’s B broth at 28 �C. The cultureswere withdrawn from early log phase (OD600 of 0.2, �4.5 h), midlog phase (OD600 of 0.5, �8 h), stationary phase (OD600 of 1.2,�16 h) and extended stationary phase (�48 h), with shaking. Toanalyze the effect of various carbon source on phlD expression80 mM solutions of a range of carbon sources were prepared andadded in M9 minimal medium. Iron-rich conditions were obtainedby adding 10, 50, 100, and 200 lM FeCl3, and iron-poor conditionswere obtained by adding 0, 10, and 100 lM ethylenediamine-di

(O-hydroxyphenyl) acetic acid in minimal media. For acid stress,the bacterial culture (OD600 � 0.6), grown in M9 minimal media(pH 7.2) was harvested, washed twice with PBS and suspendedin 60 ml of PBS. The suspended culture was divided in three partsof 20 ml. These cultures were centrifuged and resuspended in PBSof desired pH. The pH was adjusted with 2 N HCl and 2 N NaOHacross the pH range 4.5–9.5. After 8 h of incubation with shaking(50 rpm) at 28 �C, the cells were harvested by centrifugation. Totest the effect of temperature on DAPG production, six 100-mlErlenmeyer flasks each containing 25 ml of King’s B broth wereinoculated with strain TO7 and incubated with shaking at 28 �Cfor 18 h. The flasks were removed and incubated stationary atthe desired temperatures (16, 20, 25, 37 and 45 �C) for 8 h. Thecells were harvested from each condition by centrifugation andtreated with RNAprotect bacteria reagent and processed for RNAisolation.

2.6.2. RNA isolationRNA was isolated using Qiagen RNAeasy kit. For RNA isolation

from in vitro samples, the bacterial cells were pelleted at 8000gand suspended in TE buffer. Two volumes of RNAprotect was addedto the suspension, vortexed and kept at room temperature for5 min. The cells were again pelleted by centrifugation at 10,000gfor 10 min and the pellet was resuspended in TE + lysozyme(1 mg/ml) and kept for 5 min at room temperature. The 3.5 vol-umes of RLT buffer (Qiagen) was added to the suspension and pro-ceeded with the Qiagen kit protocol. Each RNA sample was treatedwith RNase-free DNase I (Fermentas) and heat inactivated accord-ing to manufacturer’s instructions. RNA integrity was checked byrunning 1.2% formaldehyde agarose gel electrophoresis. Afterstaining with ethidium bromide three sharp bands of 23S, 16Sand 5S rRNA with mRNA background as smear were seen. DNAcontamination was checked by no-RT PCR (no DNA template) foreach RNA sample in a gradient cycler (Eppendorf) using 16S rRNAgene primer. No amplification was seen after 30 cycles ofamplification.

2.6.3. cDNA synthesis300–400 ng RNA was taken for cDNA synthesis using random

hexamer primers by RevertAid™ first strand H-minus cDNA syn-thesis kit (Fermentas, cat. No. #K1631). Reaction mixture con-tained RNA template, random hexamer primer (0.2 lg), 1�reaction buffer, 20 U RiboLock RNase inhibitor, 1 mM dNTP, en-zyme RevertAid H-minus M-MuLV reverse transcriptase (200 unit)and incubated at 25 �C for 5 min followed by 60 min at 42 �C. Thereaction was terminated by heating at 70 �C for 5 min. Real-timequantitative PCR was performed in LightCycler 480II instrument(Roche) using LightCycler 480 SYBR Green I Master kit (Roche).

2.6.4. Primer designing, PCR efficiency and qRT-PCRWith the similarity of TO7 strain to P. fluorescens strain, the phlD

gene (EMBL-Bank CDS-AAB48106) expression study was plannedto understand the DAPG role in biocontrol. Primers were designedusing DNASTAR primer design software and purchased from Sig-ma–Aldrich (Table 1). All primer sets were optimized for annealingtemperature and concentration to ensure that only a single productof the correct size should be amplified. The optimum annealingtemperature and primer concentration was found to be 58 �C and0.5 lM. Amplification efficiency for each primer set was calculatedby serially diluting cDNA of exponential phase. Efficiency valueswere calculated by the software in LightCycler 480II and werefound in the optimum range (1.87–1.96). For Light Cycler reaction,a master mix of the following components was prepared: 7.0 llPCR grade water, 1.0 ll (0.5 lM) forward primer, 1.0 ll (0.5 lM)reverse primer, 10 ll 2� master mix (LightCycler 480 SYBR GreenI), 1.0 ll cDNA (50–100 ng). Amplification was performed in

Table 1Primers used for real-time PCR.

Primer name Sequence (50—30) Optimum Tm Product length

phlD Fa ccgtacaattgccgatcgct 58.0 196phlD Ra gagacggcatcgccgaacag16S Fb ccgtacaattgccgatcgct 58.0 19616S Rb gagacggcatcgccgaacag

a Primers designed by using phlD gene (EMBL-Bank CDS-AAB48106) of P.fluorescens.

b Primers designed by using 16S rRNA gene (GenBank Accession No.: HQ457044)of TO7 strain.

S. Mishra, N.K Arora / Biological Control 61 (2012) 32–39 35

triplicate wells for each sample analyzed; control reaction consist-ing of no template (water) was run with all reactions. In each set ofreaction, 16S rRNA gene was used as a reference gene (GenBankAccession No.: HQ457044) for normalization of cDNA amount.Real-time PCR analysis was performed using the following opti-mized assay conditions. Denaturation program (95 �C for 5 min.),amplification and quantification program repeated for 45 cycles(95 �C for 15 s, 58 �C for 20 s, 72 �C for 30 s with a single fluores-cent measurement), melting curve program (95 �C for 5 s, 65 �Cfor 1 min and continuous fluorescence measurement at 97 �C)and finally cooling of multiwell plate at 40 �C for 30 s. All the dataanalysis was done using LightCycler 480 II software version 1.5.The experiments were performed in triplicate and the relativeexpression ratio was calculated from triplicate normalized ratiofor each gene with SD. Paired ‘t’ test was performed using Graph-Pad Prism version 5.00 for Windows, GraphPad Software for signif-icance of relative expression ratio, p < 0.05 was consideredsignificant (⁄), p < 0.01 was considered highly significant (⁄⁄) andp > 0.05 was considered not significant.

3. Results

3.1. Isolation, selection, identification and antagonistic activity ofrhizospheric microbes

3.1.1. Isolation, selection and screening of isolates against Xcc in vitroThe crucifer rhizospheric bacterial isolates were screened

against Xcc and 3 isolates out of 54 namely TO7, SA3 and CA9exhibited antagonism towards Xcc ranged from 14.0 ± 2.1,15.6 ± 2.3 and 21.0 ± 1.1 mm diameter of inhibition zone, respec-tively. These three strains were fluorescent, gram negative, non-fastidious motile rod, oxidase and catalase positive indicating amember of the Pseudomonas species as suggested in Bergey’s Man-ual of Systematic Bacteriology (Garrity, 2005). Further, these bacte-rial strains were evaluated in greenhouse assay for the ability toreduce the severity of black rot.

3.1.2. Greenhouse experimentAs shown in Table 2, in two independent trials involving three

types of application methods, the TO7 strain produced better con-trol on black rot symptoms namely number of lesions, vein discol-ouration, necrosis and chlorotic lesions caused by Xcc. The SA3strain produced moderate control on black rot in cabbage com-pared to TO7 strain whereas effect of CA9 strain was not statisti-cally significant. The TO7 strain produced better control whenmode of application was root dip although it was effective in blackrot control by soil and foliar, also. There was no significant differ-ence observed with SA3 and CA9 in respect to mode of application.

3.1.3. Identification of TO7 strain and its bio-formulation efficacy onblack rot in field study

One of the most promising strains TO7 from pot study wasfurther evaluated and based on nucleotides homology and

phylogenetic analysis, it was detected to be Pseudomonas strain(GenBank Accession No: HQ457044). Nearest homolog of TO7strain was Pseudomonas fluorescens (Accession No. KNUC346;EU239161). As shown in Table 3, in two independent trials involv-ing three types of application methods in the field, strain TO7 sig-nificantly reduced black rot symptoms on cabbage leaves(EBRindex) when co-inoculated with the pathogen compared tothe plants treated with the pathogen alone. Considering the inter-nal black rot symptoms (IBRindex) of plants, plants treated withTO7 showed significantly less symptoms compared to the patho-gen only control. Similar to the observation made during pot study,root dip treatment further revealed better management of blackrot of cabbage compared to soil treatment and foliar spray treat-ment. However no significant difference was observed in betweensoil and foliar treatment during field study.

3.2. Analysis of metabolite

3.2.1. Identification of 2,4-DAPG metaboliteThe predicted 745-bp fragment of phlD gene was amplified from

genomic DNA of Pseudomonas TO7 strain. Further, thin layer chro-matogram has shown identical Rf values of �0.54 for the 2,4-DAPGextract from the TO7 strain and for the reference DAPG. The ethylacetate extract and purified antibiotic 2,4-DAPG inhibited thegrowth of Xcc on King’s B plates in laboratory assays (data notshown).

3.2.2. Quantitation of 2,4-DAPG through transcription profiling of phlDgene in various physiological conditions and its effect on in vitroinhibition of Xcc

The effect of shaking, various growth phases and carbon sourceson expression of phlD gene of TO7 and in vitro growth inhibition ofXcc were studied (Fig. 1). The shaking of culture stimulated thephlD transcription with a little enhancement in growth inhibitionof Xcc. The level of transcription of phlD gene varied with growthphases and there was a significant difference in antagonistic activ-ity of early log phase and extended stationary phases. The phlD wastranscribed more in mid log phase and during extended stationaryphase. The phlD transcription was upregulated in presence of fruc-tose, sucrose, mannitol, glycerol and maltose. The upregulationwas maximum with mannitol whereas glucose and sarbose as acarbon source down-regulated the mRNA expression of phlD.Antagonistic activity also varied with maximum inhibition inmannitol supplemented medium. The iron concentrations in therange of 0 to 200 lM FeCl3 did not affect phlD expression. Similarly,no change was observed in presence of EDTA (0 to 100 lM) and thedifferences in antagonistic activity were not significant. The effectof pH and temp was shown in Fig. 2. Transcript profile of phlD geneand antagonistic activity in acidic condition showed no changeswhile in alkaline conditions (pH 8.5 and 9.5) the mRNA expressionof phlD and the inhibition diameter were enhanced. To test the ef-fect of temperature on mRNA expression of phlD gene, pre-growncells were incubated at temperatures ranging from 16 to 45 �C.Maximum expression was observed at 16 �C and negligible expres-sion of phlD was observed at 45 �C, even though all cells remainedviable. Similar to enhanced expression of phlD at 16 �C, we ob-served maximum antagonistic activity with culture grown at16 �C but we did not observed significant reduction in antagonisticactivity of cultures grown at 37 �C and 45 �C.

3.3. Optimization of TO7 strain for maximum antagonistic activityagainst Xcc

As shown in Fig. 3, the bacteria were inoculated in M9 minimalmedia containing mannitol (80 mM) of pH 8.5 and incubated at16 �C with shaking for 72 h (extended stationary phase). It was

Table 2Efficacy of rhizospheric isolates against black rot of cabbage in pot study.

Treatment No. of lesions Vein discolouration (%) Necrosis (%) Chlorotic lesions (%)

Exp I Exp II Exp I Exp II Exp I Exp II Exp I Exp II

Control – – – – – – – –

Root dipXcc 7.35 (0.5) a 7.5 (0.62) 82.5 (6.0) 76.5 (7.42) 57.25 (6.34) 57.1 (7.65) 29.4 (5.0) 32.13 (4.0)Xcc + TO7 1.74 (0.46) 1.9 (0.44) 19.25 (2.2) 17.28 (2.4) 7.22 (2.0) 7.42 (1.87) 6.32 (2.0) 6.68 (1.5)Xcc + SA3 4.27 (0.52) 4.32 (0.62) 49.65 (6.6) 51.5 (8.65) 32.2 (4.7) 34.0 (9.2)b 22.3 (4.1)b 20.5 (1.7)Xcc + CA9 6.6 (0.47)b 6.3 (0.63)b 68.35 (7.9)b 66.7 (6.2)b 49.6 (10.4)b 49.2 (9.8)b 21.5 (4.6)b 21.0 (3.24)

SoilXcc 7.27 (0.55) 7.48 (0.52) 81.5 (5.37) 78.6 (7.96) 59.25 (5.7) 59.0 (9.0) 28.5 (4.4) 29.0 (2.3)Xcc + TO7 3.15 (0.32) 2.92 (0.55) 30.35 (6.3) 26.9 (5.88) 7.47 (2.3) 7.9 (2.44) 7.92 (1.6) 8.0 (1.9)Xcc + SA3 4.65 (0.4) 4.5 (1.2) 52.15 (5.5) 56.4 (3.4) 32.75 (5.1) 30.25 (7.4) 20.25 (1.1) 20.25 (3.4)Xcc + CA9 6.7 (0.26)b 6.5 (0.46)b 67.1 (8.73)b 66.0 (7.4)b 42.75 (5.85) 43.1 (4.56) 20.5 (5.4)b 19.25 (3.7)

FoliarXcc 7.4 (0.51) 7.17 (0.72) 80.0 (8.37) 76.25 (7.4) 60.25 (5.0) 58.0 (3.1) 31.5 (4.77) 29.5 (5.5)Xcc + TO7 4.02 (0.62) 4.57 (0.55) 31.3 (7.1) 34.05 (3.0) 7.95 (2.0) 7.2 (1.71) 9.75 (2.58) 10.13 (2.0)Xcc + SA3 4.75 (0.7) 5.2 (0.68)b 52.92 (8.0) 54.25 (8.1) 31.5 (5.97) 34.0 (5.58) 22.8 (2.3)b 20.7 (1.8)b

Xcc + CA9 6.15 (0.8)b 6.47 (0.8)b 66.6 (7.15)b 62.8 (4.8)b 42.0 (5.24) 45.25 (4.3) 23.8 (5.3)b 22.7 (4.7)b

Control represents healthy plant without any treatment while Xcc represents plant infected with Xanthomonas campestris pv campestris, pathogen. The (Xcc + TO7), (Xcc + SA3)and (Xcc + CA9) represent treatment of pathogen infected plant with TO7, SA3 and CA9 respectively. Means are compared within treatment in the same experiment by theNewman-Keuls test at 5%. Data was recorded from five leaves/plant of four plants.

a Standard errors in brackets.b Non-significant values.

36 S. Mishra, N.K Arora / Biological Control 61 (2012) 32–39

observed that the expression of phlD enhanced and antagonisticactivity increased by �1.8 times compared to culture (keepingCFU same �105) grown in M9 medium of pH 7.2, containing ace-tate as carbon source, at 28 �C, without shaking and of early logphase (4.5 h).

4. Discussion

In this report, we have demonstrated the potential of rhizo-spheric Pseudomonas strains in black rot management. We ob-served that the Pseudomonas TO7 strain isolated from Brassicaplant with prior infection of Xcc was significantly inhibiting Xccgrowth in vitro as well as in vivo, black rot of cabbage. WhereasSA3 and CA9 strains, which were, isolated from rhizosphere regionof healthy Brassica plants were not significantly effective in vivo

Table 3Biocontrol effect of TO7 strain against black rot of cabbage in field experiment.

Treatment Root dip application Soil appli

EBRindexa IBRindexb EBRindex

Exp IControl 0.0 0.0 0.0TO7 0.01 0.0 0.0Xcc 2.7 (0.17)c⁄⁄ 1.35 (0.09)⁄⁄⁄ 2.7 (0.12)Xcc + TO7 0.75 (0.09)⁄⁄ 0.19 (0.005)⁄ 1.4 (0.14)

Exp IIControl 0.0 0.0 0.0TO7 0.0 0.0 0.0Xcc 2.85 (0.2)⁄⁄⁄ 1.45 (0.09)⁄⁄⁄ 2.9 (0.12)Xcc + TO7 0.8 (0.11)⁄⁄ 0.3 (0.05)⁄ 1.4 (0.08)

Control represents healthy plant without any treatment.TO7 represents treatment of healthy plant with TO7 strain while Xcc represents planrepresents treatment of pathogen-infected plant with TO7. Means are compared withireplicates per treatment is four. ⁄, ⁄⁄, ⁄⁄⁄ significant at P = < 0.05, <0.01 and <0.001 proba

a EBRindex for external black rot index based on symptoms on leaves.b IBRindex for internal black rot index based on symptoms in stem and heart leaves.c Standard errors in brackets.

despite producing better inhibition in vitro. This indicated thatdue to better adaptability in competitive environment the strainsisolated from rhizosphere of infected plant are good biocontrolagent. It was suggested that selection of microorganisms for usein biocontrol solely based on an in vitro method such as testingfor antibiosis on agar plates might lead to disappointing resultsin the in vivo study (Knudsen et al., 1997). Moreover, an interestingobservation was encouraging that the root-dip method providedsignificant black rot reduction possibly due to their applicationduring transplanting.

The 16S rRNA gene sequencing allowed the identification ofantagonist at species level with an identity from 98% to 100% com-paring the sequences to those from the GenBank databases. On thebasis of morphological, physiological and biochemical features, aswell as 16S rRNA gene analysis, strain TO7 was classified as a strainof P. fluorescens.

cation Foliar application

IBRindex EBRindex IBRindex

0.0 0.0 0.00.0 0.01 0.0

⁄⁄⁄ 1.4 (0.08)⁄⁄⁄ 2.7 (0.2)⁄⁄⁄ 1.45 (0.05)⁄⁄⁄⁄⁄⁄ 0.85 (0.12)⁄⁄ 1.5 (0.12)⁄⁄⁄ 0.95 (0.12)⁄⁄

0.0 0.0 0.00.0 0.01 0.0

⁄⁄⁄ 1.4 (0.08)⁄⁄⁄ 3.0 (0.08)⁄⁄⁄ 1.5 (0.05)⁄⁄⁄⁄⁄⁄ 0.85 (0.17)⁄⁄ 1.6 (0.08)⁄⁄ 0.85 (0.12)⁄⁄

t infected with Xanthomonas campestris pv campestris, pathogen. The (Xcc + TO7)n treatment in the same experiment by the Newman-Keuls test at 5%. Number ofbility level, respectively.

Fig. 1. The phlD gene transcript profile of TO7 and its correlation with in vitrogrowth inhibition of Xcc in various conditions. (A) Shaking of culture enhanced thephlD expression and Xcc inhibition, when compared with non-shaking culture. (B)Taking early log phase culture as standard control, phlD gene was upregulated inmid log and extended stationary phase. Similarly, Xcc inhibition was alsoinfluenced. (C) The transcript of phlD and Xcc growth inhibition varied in differentcarbon sources, when compared with the culture grown in minimal mediumsupplemented with acetate. The results (filled bars) represent mean relativeexpression values of triplicate experiment with SD values (error bars) from one ofthe three experiments. The values in parenthesise, above the bars, representthe mean diameter (mm) of inhibition zone of triplicate experiment with SDvalues from one of the two experiments. p < 0.05 was considered significant (⁄),p < 0.01 was considered highly significant (⁄⁄) and p > 0.05 was considered notsignificant.

Fig. 2. Effect of various pH and temperatures on phlD gene expression of TO7 andon in vitro growth inhibition of Xcc. (A) Acid stress had no effect while alkalineenvironment caused the up-regulation of phlD and increase in inhibition diameter.Culture treated at pH 7.2 was used as standard control. (B) The increase intemperature gradually reduces the mRNA expression of phlD when compared withculture grown at 28 �C. The results (filled bars) represent mean relative expressionvalues of triplicate experiment with SD values (error bars) from one of the threeexperiments. The values in parenthesise, above the bars, represent the meandiameter (mm) of inhibition zone of triplicate experiment with SD values from oneof the two experiments. p < 0.05 was considered significant (⁄), p < 0.01 wasconsidered highly significant (⁄⁄) and p > 0.05 was considered not significant.

S. Mishra, N.K Arora / Biological Control 61 (2012) 32–39 37

It could be possible that the control of black rot observed in thecabbage might have been due, among other mechanism, to induc-tion of resistance in the host and production of metabolites. It wassupported by the identification of metabolite 2,4-DAPG from TO7strain. The study was further extended to investigate the favorableconditions for DAPG production by the strain TO7. Phloroglucinolshave previously been investigated chromatographically by usinggas–liquid chromatography (Pyysalo and Widen, 1979), HPLC(Widen et al., 1980) and Real time PCR (Mavrodi et al., 2007).However, in this study, we have used internal primers of phlD toanalyze the mRNA expression in various conditions which willindirectly quantify the 2,4-DAPG as phlD is essential for its produc-tion. As the TO7 strain was closest homolog of P. fluorescens strain,the phlD gene (EMBL-Bank CDS-AAB48106) expression study wasplanned to understand the DAPG role in biocontrol. The upregula-tion of phlD transcript and stimulation in antagonistic activity

Fig. 3. Optimization of enhanced phlD gene expression of TO7 and its effect onin vitro growth inhibition of Xcc. M9 medium of pH 8.5 containing mannitolenhanced the expression of phlD and subsequently increased the inhibitionpotential of TO7 when grown at 16 �C for 72 h with shaking compared to controlmedium. Here the control medium was M9 containing acetate as carbon source ofpH 7.2 and grown at 28 �C for 4 h without shaking. The results (filled bars)represent mean relative expression values of triplicate experiment with SD values(error bars) from one of the three experiments. The values in parenthesise, abovethe bars, represent the mean diameter (mm) of inhibition zone of triplicateexperiment with SD values from one of the two experiments. p < 0.05 wasconsidered significant (⁄), p < 0.01 was considered highly significant (⁄⁄) andp > 0.05 was considered not significant.

38 S. Mishra, N.K Arora / Biological Control 61 (2012) 32–39

observed in shaking condition could be due to the increased sur-face and oxygen availability to the bacteria. This suggests that oxy-gen rich environment and probably increased surface areasupported the DAPG production. The increased mRNA level of phlDin mid log and extended stationary phase was further supported byincrease in inhibition of Xcc from corresponding culture superna-tant. Due to the scarcity of nutrients in most soils, antibiotic pro-duction is generally restricted. In this study we have tried todemonstrate the selective enhancement of 2,4-DAPG from a fluo-rescent pseudomonad by certain carbon sources. We observed thatDAPG production by strain TO7 might be influenced by the avail-ability of fructose, maltose, sucrose, glycerol and mannitol as sug-gested by varied mRNA expression of phlD. The results alsosuggested the importance of optimum temperature and pH as theyinfluenced the phlD transcript and antagonistic behavior as well.These results strongly indicate that prior knowledge of plant exu-date composition and the ability of different carbon sources to in-duce a particular antibiotic are essential in selecting suitablebacterium-plant combinations for biocontrol purposes.

In conclusion, the study demonstrated that microbes isolatedfrom rhizospheric region of crucifers could help in black rot man-agement. Moreover, the study will enhance our understanding ofthe 2,4-DAPG-producing P. fluorescens strains towards biocontrolspecifically black rot and quantification strategy of 2,4-DAPGthrough phlD gene, one of the several responsible gene for 2,4-DAPG biosynthesis.

Acknowledgments

We thank Vice Chancellors of C. S. J. M. University, Kanpur andBBA University, Lucknow for providing facilities and support. Wealso thank director of C. D. R. I., Lucknow for providing Real-Timerelated facilities. The study was supported by Department of Bio-technology (DBT) Grant BT/PR10276/GBD/27/89/2007.

References

Abbas, A., McGuire, J.E., Crowley, D., Baysse, C., Dow, M., O’Gara, F., 2004. Theputative permease PhlE of Pseudomonas fluorescens F113 has a role in 2,4-diacetylphloroglucinol resistance and in general stress tolerance. Microbiology150, 2443–2450.

Abbas, A., Morrissey, J.P., Marquez, P.C., Sheehan, M.M., Delany, I.R., O’Gara, F., 2002.Characterization of interactions between the transcriptional repressor PhlF andits binding site at the phlA promoter in Pseudomonas fluorescens F113. Journal ofBacteriology 184, 3008–3016.

Bangera, M.G., Thomashow, L.S., 1999. Identification and characterization of a genecluster for synthesis of the polyketide antibiotic 2,4-diacetylphloroglucinolfrom Pseudomonas fluorescens Q2–87. Journal of Bacteriology 181, 3155–3163.

Berg, G., 1996. Rhizobacteria of oil seed rape antagonistic to Verticillium dahliae.Journal of Plant Diseases and Protection 103, 20–30.

Bottiglieri, M., Keel, C., 2006. Characterization of PhlG, a hydrolase that specificallydegrades the antifungal compound 2,4-diacetylphloroglucinol in the biocontrolagent Pseudomonas fluorescens CHA0. Applied and Environmental Microbiology72, 418–427.

De La Fuente, L., Mavrodi, D.V., Landa, B.B., Thomashow, L.S., Weller, D.M., 2006.PhlD-based genetic diversity and detection of genotypes of 2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens. FEMS (Federationof European Microbiological Societies) Microbiology – Ecology 56, 64–78.

Défago, G., Haas, D., 1990. Pseudomonas as antagonists of soil-borne plantpathogens: modes of action and genetic analysis. Marcel Dekker, Inc., New York.

Delany, I., Sheehan, M.M., Fenton, A., Bardin, S., Aarons, S., O’Gara, F., 2000.Regulation of production of the antifungal metabolite 2,4-diacetylphloroglucinol in Pseudomonas fluorescens F113: genetic analysis ofphlF as a transcriptional repressor. Microbiology 146 (Pt 2), 537–543.

Duijff, B.J., de Kogel, W.J., Bakker, P.A.H.M., Schippers, B., 1994. Influence ofpseudobactin 358 on the iron nutrition of barley. Soil Biology and Biochemistry26, 1681–1688.

Dwivedi, D., Johri, B.N., 2003. Antifungals from fluorescent pseudomonads:biosynthesis and regulation. Current Science 85, 1693–1703.

Friendlender, M., Inber, J., Chet, I., 1993. Biological control of soil-borne plantpathogens by a b-1,3-glucanase producing Pseudomonas cepacia. Soil Biologyand Biochemistry 25, 1211–1221.

Garrity, G.M., 2005. Bergey’s Manual of Systematic Bacteriology, second ed., vol. 2,part B Springer, New York, pp. 323–379.

Haas, D., Keel, C., 2003. Regulation of antibiotic production in root-colonizingPseudomonas spp. and relevance for biological control of plant disease. Annualreview of Phytopathology 41, 117–153.

Jacobson, C.B., Pasternack, J.J., Glick, B.R., 1994. Partial purification andcharacterization of 1-aminocyclopropane-1-carboxylate deaminase from theplant growth promoting rhizobacterium Pseudomonas putida GR 12–2. CanadianJournal of Microbiology 40, 1019–1025.

Keel, C., Weller, D.M., Natsch, A., Defago, G., Cook, R.J., Thomashow, L.S., 1996.Conservation of the 2,4-diacetylphloroglucinol biosynthesis locus amongfluorescent Pseudomonas strains from diverse geographic locations. Appliedand Environmental Microbiology 62, 552–563.

Knudsen, I.M.B., Hockenhull, J., Funck Jensen, D., Gerhardson, B., Hökeberg, M.,Tahvonen, R., Teperi, E., Sundheim, L., Henriksen, B., 1997. Selection of biologicalcontrol agents for controlling soil and seed-borne diseases in the field. EuropeanJournal of Plant Pathology 103, 775–784.

Kocks, C.G., Ruissen, M.A., 1996. Measuring field resistance of cabbage cultivars toblack rot. Euphytica 91, 45–54.

Kocks, C.G., Zadoks, J.C., 1996. Cabbage refuse piles as sources of inoculum for blackrot epidemics. Plant Disease 80, 789–792.

Leong, J., 1986. Siderophores: their biochemistry and possible role in the biocontrolof plant pathogens. Annual review of Phytopathology 24, 187–209.

Loper, J.E., Schroth, M.N., 1986. Influence of bacterial sources of indole-3-acetic acidon root elongation of sugar beet. Phytopathology 76, 386–389.

Mavrodi, O.V., Mavrodi, D.V., Thomashow, L.S., Weller, D.M., 2007. Quantification of2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens strains in theplant rhizosphere by real-time PCR. Applied and Environmental Microbiology73, 5531–5538.

Mavrodi, O.V., McSpadden Gardener, B.B., Mavrodi, D.V., Bonsall, R.F., Weller, D.M.,Thomashow, L.S., 2001. Genetic diversity of phlD from 2,4-diacetylphloroglucinol-producing fluorescent Pseudomonas spp. Phytopathology 91, 35–43.

Mitchell, J.K., Carter, W.E., 2000. Modeling antimicrobial activity of Cloroxusing an agar-diffusion test: a new twist on an old experiment. BioScience 26,9–13.

Pyysalo, H., Widen, C.J., 1979. Glass capillary gas chromatographic separation ofnaturally occurring phloroglucinols. Journal of Chromatography 168, 246 and172, 446.

Raaijmakers, J.M., Bonsall, R.F., Weller, D.M., 1999. Effect of population density ofPseudomonas fluorescens on production of 2,4-diacetylphloroglucinol in therhizosphere of wheat. Phytopathology 89, 470–475.

Raaijmakers, J.M., Weller, D.M., 1998. Natural plant protection by 2,4-diacetylphloroglucinol-producing Pseudomonas spp. in Take-All decline soils.Molecular Plant Microbes Interaction 11, 144–152.

Ramamoorthy, V., Samiyappan, R., 2001. Induction of defense related genes inPseudomans fluorescens treated chilli plants in response to infection byColletotrichum capsici. Journal of Mycology and Plant Pathology 31, 146–155.

S. Mishra, N.K Arora / Biological Control 61 (2012) 32–39 39

Ran, L.X., Liu, C.Y., Wu, G.J., van Loon, L.C., Bakker, P.A.H.M., 2005. Suppression ofbacterial wilt in Eucalyptus urophylla by fluorescent Pseudomonas spp. in China.Biological Control 32, 111–120.

Saravanakumar, D., Samiyappan, R., 2006. ACC deaminase from Pseudomonasfluorescens mediated saline resistance in groundnut (Arachis hypogea) plants.Journal of Applied Microbiology 102, 1283–1292.

Schaad, N.W., Alvarez, A., 1993. Xanthomonas campestris pv. campestris: cause ofblack rot of crucifers. In: Swings, J.G., Civerolo, E.L. (Eds.), Xanthomonas.Chapman & Hall, London, pp. 51–55.

Schippers, B.A., Bakker, A.W., Bakker, P.A.H.M., van Peer, R., 1991. Beneficial anddeleterious effects of HCN-producing Pseudomonas on rhizosphereinteractions. In: Kleister, D.L., Cregan, P.B. (Eds.), The rhizosphere and plantgrowth. Kluwer Academic Publishers, The Netherlands, pp. 211–219.

Schnider-Keel, U., Seematter, A., Maurhofer, M., Blumer, C., Duffy, B., Gigot-Bonnefoy, C., Reimmann, C., Notz, R., Defago, G., Haas, D., Keel, C., 2000.Autoinduction of 2,4-diacetylphloroglucinol biosynthesis in the biocontrolagent Pseudomonas fluorescens CHA0 and repression by the bacterialmetabolites salicylate and pyoluteorin. Journal of Bacteriology 182, 1215–1225.

Taylor, J.D., Conway, J., Roberts, S.J., Astley, D., Vicente, J.G., 2002. Sources and originof resistance to Xanthomonas campestris pv campestris in Brassica genomes.Phytopathology 92, 105–111.

Thomashow, L.S., Weller, D.M., Bonsall, R.F., Pierson, L.S., 1990. Production of theantibiotic phenanzine-1-carboxylic acid by fluorescent Pseudomonas species inthe rhizosphere of wheat. Applied and Environmental Microbiology 56, 908–912.

Vidhyasekaran, P., Muthamilan, M., 1995. Development of formulations ofPseudomonas fluorescens for control of chickpea wilt. Plant Disease 79, 782–786.

Voisard, C., Keel, C., Haas, D., Défago, G., 1989. Cynamid production by Pseudomonasfluorescens helps suppress black root rot of tobacco under gnotobioticconditions. EMBO Journal 8, 351–358.

Widen, C.J., Pyysalo, H., Salovaara, P., 1980. Separation of naturally occurringacylphloroglucinols by high-performance liquid chromatography. Journal ofChromatography 188, 213–220.

Wulff, E.G., Mguni, C.M., Mortensen, C.N., Keswani, C.L., Hockenhull, J., 2002.Biological control of black rot (Xanthomonas campestris pv. campestris) ofbrassicas with an antagonistic strain of Bacillus subtilis in Zimbabwe. EuropeanJournal of Plant Pathology 108, 317–325.