Abstract. – OBJECTIVE: Moringa oleiferaLam., a multipurpose tree, is used traditionallyfor its nutritional and medicinal properties. It hasbeen used for the treatment of a variety of condi-tions, including inflammation, cancer and meta-bolic disorders.

MATERIALS AND METHODS: We investigatedthe effect of Moringa oleifera Lam. on adipogenicdifferentiation of human adipose-derived mes-enchymal stem cells and its impact on lipid me-tabolism and cellular antioxidant systems.

RESULTS: We showed that Moringa oleiferaLam. treatment during adipogenic differentiationreduces inflammation, lipid accumulation and in-duces thermogenesis by activation of uncou-pling protein 1 (UCP1), sirtuin 1 (SIRT1), peroxi-some proliferator-activated receptor alpha(PPARαα), and coactivator 1 alpha (PGC1αα). In ad-dition, Moringa oleifera Lam. induces heme oxy-genase-1 (HO-1), a well established protectiveand antioxidant enzyme. Finally Moringa oleiferaLam. significantly decreases the expression ofmolecules involved in adipogenesis and upregu-lates the expression of mediators involved inthermogenesis and lipid metabolism.

CONCLUSIONS: Our results suggest thatMoringa oleifera Lam. may promote the brownremodeling of white adipose tissue inducingthermogenesis and improving metabolic home-ostasis.

Key Words:Moringa Oleifera Lam., l ipid metabolism,

adipocytes, stem cells, differentiation.

Introduction

Moringa oleifera Lam. (M. oleifera Lam.) iscultivated in many tropical and subtropical coun-

European Review for Medical and Pharmacological Sciences

Moringa oleifera Lam. improves lipid metabolism during adipogenic differentiation of human stem cells

I. BARBAGALLO1, L. VANELLA1, A. DISTEFANO1, D. NICOLOSI1, A. MARAVIGNA2, G. LAZZARINO3, M. DI ROSA3, D. TIBULLO4,R. ACQUAVIVA1, G. LI VOLTI3

Corresponding Author: Giovanni Li Volti, MD, Ph.D; e-mail: livolti@unict.it 5223

tries of Asia and Africa. It is a common herb andhas been documented to contain various phyto-chemicals, macronutrients, and micronutrientsthat contribute to its great medicinal value in-cluding the management of diseases such as asth-ma, bronchitis, diabetes, mastitis, skin condi-tions, worm infestations, and HIV/AIDS symp-toms among others1,2. Its ability to treat most ofthese conditions has been attributed to the nutri-tional and immunomodulatory properties as wellas to its antioxidant, hypoglycemic, hypotensive,antidyslipidemic, anticancer, and anti-inflamma-tory properties1. Most of the reviewed literaturereported changes in the biochemical parametersof diabetes mellitus after short-term treatmentwith an extract of M. oleifera Lam. leaves3,4

though only relatively few studies have describedthe related histological pancreatic changes5. Fur-thermore, it has been reported that M. oleiferaLam. administration to diabetic patients can in-duce better glucose tolerance by extending thetreatment period6. Recently, a study demonstrat-ed that administration of benzylamine, one of theconstituents found in M. oleifera Lam., reducesbody weight gain, circulating cholesterol, im-proves glucose tolerance and lipid metabolism inrats7,8. Among these characteristics representingsome of the hallmarks of metabolic syndrome,adipocytes also play an important role in thisprocess through their metabolism9. Adipose tis-sue growth involves the formation of newadipocytes from precursor cells, further leadingto an increase in adipocyte size. Moreover, in pa-tients affected by metabolic syndrome, adiposetissue expansion is associated with adipocyte

2016; 20: 5223-5232

1Department of Drug Sciences, University of Catania, Catania, Italy2Gamastech Srl, Catania, Italy3Department of Biomedical and Biotechnological Sciences, University of Catania, Catania, Italy4Division of Haematology, AOU “Policlinico – Vittorio Emanuele”, University of Catania, Catania, Italy

I. Barbagallo, L. Vanella, A. Distefano, D. Nicolosi, A. Maravigna, et al.

mM NH4Cl to eliminate erythrocytes and passedthrough a 40 µm mesh filter into a new tube.Cells were resuspended in an equal volume ofDMEM/10% FBS (fetal bovine serum) and thencentrifuged.

Detection of ASCs Cell Markers byFACS Analysis

ASCs phenotype was evaluated by flow-cy-tometry analysis (FC500 Beckman Coulter,Cassina De’ Pecchi, Milan, Italy). The ASCs pre-sented as a homogeneous fibroblastic cell popu-lation. Flow cytometric analysis of passage 4cells revealed that they were negative for CD34and CD45, and positive for CD105 and CD90.

Differentiation of Human ASCsInto Adipocytes

ASCs were plated in a 75-cm2 flask at a densi-ty of 1 to 2 × 104 cells and cultured in DMEMwith 10% FBS for 7 days. The medium was re-placed with an adipogenic medium, and the cellswere cultured for an additional 14 days. The adi-pogenic media were prepared as follows: com-plete culture medium supplemented withDMEM-F12 high glucose, 3% (v/v) FBS, 100nM insulin, 100 nM dexamethasone (Sigma-Aldrich, St. Louis, MO, USA), 0.5 mM isobutyl-methylxanthine (Sigma-Aldrich, St. Louis, MO,USA), 60 µM indomethacin (Sigma-Aldrich, St.Louis, MO, USA) and transferrin 10 µg/ml. Hu-man ASCs were cultured in the presence of M.oleifera Lam. (100 µg/ml) which was addedevery 3 days.

RNA Extraction and qRT-PCRTrizol (Invitrogen, Carlsbad, CA, USA)

reagent was used to extract RNA13. First strandcDNA was then synthesized with AppliedBiosystem (Foster City, CA, USA) reverse tran-scription reagent14. Quantitative real-time PCRwas performed in Roche Light Cycler Nano(Roche Diagnostics) using the SYBR Green PCRMasterMix (Life Technologies)15. The primer se-quences used for these set of experiments are re-ported in Table I. The specific PCR productswere detected by the fluorescence of SYBRGreen, the double-stranded DNA binding dye.The reaction was followed by a melting curveprotocol (Figure 1) according to the specifica-tions of the Roche Light Cycler Nano (Roche Di-agnostics, Basel, Switzerland). The relative mR-NA expression level was calculated by thethreshold cycle (Ct) value of each PCR product

dysfunction and increased inflammatory process-es9-11. The transition from undifferentiated fibrob-last-like pre-adipocytes into mature adipocytesconstitutes the adipocyte life cycle, and treat-ments that regulate both size and number ofadipocytes may provide a better therapeutic ap-proach for treating obesity.

Recently, some studies reported a novel per-spective on functional adipogenesis that appearsto play a central role in providing adipose tissueinsulin sensitivity and functionality and in pre-venting the development of insulin resistance andtype 2 diabetes.

The aim of this study was to investigate the invitro effect of administration of M. oleifera Lam.during adipogenic differentiation of human adi-pose tissue mesenchymal stem cells.

Material and Methods

Quenching of DPPHThe free radical-scavenging capacity of M.

oleifera Lam. was tested by their ability to bleachthe stable 1,1-diphenyl-2-picryl-hydrazyl radical(DPPH). The reaction mixture contained 86 µMDPPH, different concentrations of extracts (500-250-100-50-10-5 µg/ml) in 1 mL of ethanol. Af-ter 10 min at room temperature the absorbance atλ = 517 nm was recorded. Trolox (30 µM) wasused as a standard. Each result represents themean ± S.D. of five experimental determinations.

Adipose Stem Cells Isolation and Culture The subcutaneous tissue was collected from a

healthy subject of 23 years underwent surgery forumbilical hernia12 following written consent. Theadipose tissue was minced by means of the use ofscissors into pieces of a size less than 3 mm12.Briefly, after gentle shaking with an equal vol-ume of phosphate buffered saline (PBS), the mix-ture separated into two phases. The upper phase(containing stem cells, adipocytes and blood) af-ter three washes with PBS was enzymaticallydissociated with 0.075% collagenase (typeI)/PBS for 1 h at 37°C with gentle shaking. Thedissociated tissue was then mixed with an equalvolume of Dulbecco’s Modified Eagle Medium(DMEM, Gibco BRL, Invitrogen Corp., Carls-bad, CA, USA) supplemented with 10% FBS andincubated 10 min at room temperature. The solu-tion was separated into two phases. The lowerphase was centrifuged at 1500 rpm for 5 min at20°C. The cellular pellet was resuspended in 160

5224

and normalized with that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) by usingcomparative 2–∆∆Ct method14,16.

Statistical AnalysisStatistical significance (p < 0.05) of differ-

ences between experimental groups was deter-mined by the Fisher method for analysis of mul-tiple comparisons17. For comparison betweentreatment groups, the null hypothesis was testedby either single-factor analysis of variance(ANOVA) for multiple groups, or the unpaired t-test for two groups, and the data are presented asmean ± standard error mean (SEM).

Results

Free Radical Scavenging Activity of M. oleifera Lam.

The free radical scavenging activity of M.oleifera Lam. was tested by their ability to bleachthe stable DPPH radical. This assay provides in-formation on the reactivity of test sample with astable free radical. Because of its odd electron,DPPH gives a strong absorption band at 517 nmin visible spectroscopy (deep violet color). Asthis electron becomes paired off in the presenceof a free radical scavenger, the absorption vanish-es, and the resulting destaining is stoichiometricwith respect to the number of electrons taken up.In this assay, the M. oleifera Lam. showed a radi-cal scavenger of DPPH in a dose-dependent man-ner. In particular, the percentage of inhibition ofDPPH resulted were about 81%, 63%, 42%,

33%, 13% 18% respectively at concentration ofM. oleifera Lam. of 500-250-100-50-10-5 µg/ml(Figure 2).

Analysis of Adipogenic DifferentiationTo investigate signals that might regulate the

differentiation of ASCs, we analyzed the mRNAlevels of peroxisome proliferator-activated re-ceptor gamma (PPAR�), CCAAT/enhancer-bind-ing protein alpha (CEBPα), diacylglycerol O-acyltransferase 1 (DGAT1), fatty acid bindingprotein 4 (FABP4), fatty acid synthase (FAS),and sterol regulatory element-binding protein 1c(SREBP-1c).

We showed that all of these markers resultedin a significant increase after 14 days of adi-pogenic differentiation (Figure 3).

The effect of M. oleifera Lam. onAdipogenesis

As seen in Figure 4 the administration of M.oleifera Lam. during the adipogenic differentia-tion was able to reduce significantly the mRNAlevels of FABP4, FAS and SREBP-1c (Figures4A-C).

Analysis of Inflammatory Cytokines Gene Expression

To study the eventual effect of OLE on inflam-mation, we investigated Il-6 expression duringdifferentiation. We showed a significant increaseof mRNA level of IL-6 in differentiatedadipocytes (Figure 5). The M. oleifera Lam.treatment was able to significantly decrease theIl-6 mRNA levels in differentiated cells.

5225

M. oleifera Lam. improves lipid metabolism during adipogenic differentiation of human stem cells

Gene Primer forward Primer reverse Size

Adiponectin CCCTCTCTTACAAGCCCATCA GAGCCAGTCTGGTAGTACATCA 109CEBPα TAACTCCCCCATGGAGTCGG ATGTCGATGGACGTCTCGTG 207DGAT1 GGTCCCCAATCACCTCATCTG TGCACAGGGATGTTCCAGTTC 165FABP4 AAACTGGTGGTGGAATGCGT GCGAACTTCAGTCCAGGTCA 95FAS AAGGACCTGTCTAGGTTTGATGC TGGCTTCATAGGTGACTTCCA 106GAPDH AGACACCATGGGGAAGGTGA TGGAATTTGCCATGGGTGGA 56HO-1 AAGACTGCGTTCCTGCTCAAC AAAGCCCTACAGCAACTGTCG 247IL6 GAAAGCAGCAAAGAGGCACT TTTCACCAGGCAAGTCTCCT 108IRS1 CCCAGGACCCGCATTCAAA GGCGGTAGATACCAATCAGGT 89PGC1α TCTGAGTCTGTATGGAGTGACAT CCAAGTCGTTCACATCTAGTTCA 112PPARα TTCCGAATCCTCTTTACTCCAGA CCCTCTAGCTTTGATGGGTACA 102PPARγ ACCAAAGTGCAATCAAAGTGGA ATGAGGGAGTTGGAAGGCTCT 100SIRT1 TGTGTCATAGGTTAGGTGGTGA AGCCAATTCTTTTTGTGTTCGTG 101SREBP-1c GCCCCTGTAACGACCACTG CAGCGAGTCTGCCTTGATG 84UCP1 AGGTCCAAGGTGAATGCCC TTACCACAGCGGTGATTGTTC 75

Table I. PCR primers used in this study.

5226

I. Barbagallo, L. Vanella, A. Distefano, D. Nicolosi, A. Maravigna, et al.

Figure 1.Melting curve analysis.

Effect of M. oleifera on IRS-1, HO-1 andAdiponectin Expression

Interesting, M. oleifera Lam. effects show asignificant increase of insulin receptor substrate1 (IRS-1) genes expression (Figure 6A). To in-vestigate the possible role of M. oleifera Lam. onthe adiponectin expression we performed a Real-time PCR assay. The M. oleifera Lam. treatmentresulted in a significant increase of adiponectinexpression during adipose differentiation (Figure6C). Heme oxygenase-1 (HO-1) gene expression,an antioxidant protein, resulted in a significant

5227

M. oleifera Lam. improves lipid metabolism during adipogenic differentiation of human stem cells

Figure 2. Scavenger effect of M. oleifera Lam. Extract expressed as the capacity to bleach the stable DPPH. Results are ex-pressed as the percentage decrease in absorbance at = 517 nm. Each value represents the mean ± SEM of 4 experiments. Sig-nificance vs. control p < 0.005.

Figure 3. Analysis of gene expression by Real-time PCRof PPARγ, CEBPα, FAS, FABP4, DGAT1 and SREBP-1cafter 14 days of adipogenic differentiation. All values areexpressed as mean ± SEM of four experiments (n = 4) in du-plicate. (p < 0.05 vs. undifferentiated).

increase in M. oleifera Lam. treated cell culturesafter 14 days of adipogenic differentiation re-spect the differentiated untreated cells (Figure6B).

M. oleifera Lam. Induces ThermogenicPathway

To investigate the effect of M. oleifera Lam.on the lipid metabolism, we analyzed the expres-sion of the thermogenic pathway markers, whichare characterized in the brown adipocyte.

The administration of M. oleifera Lam. duringadipogenic differentiation was able to significant-ly increase mRNA levels of sirtuin 1 (SIRT-1),peroxisome proliferator-activated receptor alpha(PPARα) and peroxisome proliferator-activatedreceptor gamma, coactivator 1 alpha (Pgc-1α)(Figures 7A-C). Moreover, to study the activationof the heat-generating pathway, which is the fu-tile cycle of proton pumping through the actionsof uncoupling proteins (UCPs), we analyzed theexpression of UCP1 (Figure 7D).

Discussion

The important effects of natural antioxidantson metabolic diseases are rewiring the approach-es on the therapeutic strategy versus this kind ofcondition. It was demonstrated that natural an-tioxidants lead their effect through the expression

5228

of antioxidant enzymes and activation or inhibi-tion of specific pathways18-21. In particular, differ-ent studies on natural antioxidants effects in themetabolic suitability of adipose tissue oradipocytes showed that modulation on the ex-pression of specific protein/enzymes is responsi-ble for the improving of the metabolic process-es22-25. Maintenance of metabolic homeostasis ofadipocytes and adipose tissue is an important fac-tor for the onset of metabolic syndrome. Themain function of adipose tissue is the storage offat under conditions of calories excess and the re-lease of free fatty acids during fasting. Also,adipocytes play a role in thermoregulation, me-chanical organ protection and as an endocrine or-gan by adipokines secretion26,27. Adipokines reg-ulate important biological processes in target or-

gans including the brain, liver, skeletal muscle,vessels, heart, immune system and pancreaticislets. Altered adipokines secretion may con-tribute to impaired regulation of fat distribution,insulin secretion and sensitivity, energy expendi-ture, endothelial function, inflammation, bloodpressure and hemostasis. Therefore, alteration inadipokine secretion may link obesity to its in-flammatory, metabolic and cardiovascular co-morbidities. Because adipokines also act in anautocrine and paracrine manner they could con-tribute to the development of adipose tissue dys-function initiated from disturbances of individualadipocytes. In addition, to changes in adipokinesecretion, impaired expandability of subcuta-neous adipose tissue, ectopic fat deposition andhypoxia may contribute to adipose tissue inflam-mation or dysfunction. As a consequence,adipocyte dysfunction contributes to a proinflam-matory, atherogenic, and diabetogenic state andmay be mechanistically linked to the develop-ment of chronic inflammation, insulin resistance,metabolic syndrome and other obesity-associateddisorders. Targeting adipocyte dysfunction maybe a promising approach to prevent or treat obe-sity-related diseases in the future.

Many in vitro and in vivo studies have shownantioxidant properties of M. oleifera Lam. by itsabundant amounts of antioxidant compounds.Further, scientific evidences suggest a positiveeffect of M. oleifera Lam. on lipid homeostasis28.Previous studies29-31 have shown that supplemen-tation of M. oleifera Lam. leaves extract exhibit-ed anti-obesity effects in high fat fed mice. Fur-thermore, other study showed that M. oleiferaLam. leaves supplementation in diabetes-inducedrats leads a hypolipidemic effects, presented low-

I. Barbagallo, L. Vanella, A. Distefano, D. Nicolosi, A. Maravigna, et al.

Figure 4. Analysis of gene expression of FABP4, FAS and SREBP-1c by Real-time PCR of cells treated with M. oleiferaLam. during adipogenic differentiation (M). All values are expressed as mean ± SEM of four experiments (n = 4) in duplicate.(*p < 0.05 vs. control cells).

Figure 5. Analysis of gene expression by Real-time PCRof cytokine IL-6 of cells treated with M. oleifera Lam. dur-ing adipogenic differentiation (M). All values are expressedas mean ± SEM of four experiments (n = 4) in duplicate. (*p< 0.05 vs. control cells).

er plasma total cholesterol, triglycerides andLDL, than diabetic rats untreated3. In this study,we report that M. oleifera Lam. has higher freeradical-scavenging capacity measured by DPPHassay. In particular, our data showed that M.oleifera Lam. administration during adipogenicdifferentiation of adipose-derived human mes-enchymal stem cell resulted in a decrease ofFABP4, FAS, and SREBP-1c gene expressionduring the differentiation, confirming that its ad-ministration is able to reduce fatty acid accumu-lation. Moreover, a decrease in IL-6 expressionin adipocytes differentiated whit M. oleiferaLam. respect to the normal adipocyte confirms areduction of inflammation. We reported also thatin adipocyte treated with M. oleifera Lam. wefound an increase of IRS1 gene expression,which has been previously reported that low-IRS1 expression and protein levels are predictiveof insulin resistance and type 2 diabetes32. In or-der to understand the mechanism by which M.oleifera Lam. may act as a protective modulatorin adipocytes, we evaluated the gene expressionof HO-1 and adiponectin. Adiponectin is an

5229

M. oleifera Lam. improves lipid metabolism during adipogenic differentiation of human stem cells

Figure 6. Analysis of gene expression by Real-time PCR of IRS-1 (A), HO-1 (B) and Adiponectin (C) of cells treated withM. oleifera Lam. during adipogenic differentiation (M). All values are expressed as mean ± SEM of four experiments (n = 4) induplicate. (*p < 0.05 vs. CTRL).

adipokine secreted by adipocytes and increasedits expression was correlated to an improvementin glucose tolerance and an increase in insulinsensitivity33. Furthermore, the induction of HO-1,an antioxidant and cytoprotective enzyme, regu-lates adiponectin expression by reducing inflam-mation and insulin resistance both in in vivo andin vitro34-39. Our data show that M. oleifera Lam.treatment during differentiation leads to an over-expression of HO-1 and Adiponectin confirminga protective effect of this extract. Finally, we in-vestigated the eventually effect of this plant onthe thermogenic pathway of adipocytes analyzingthe expression of uncoupling protein UCP1,SIRT-1, PPARα and Pgc-1α. Thermogenesiscontributes to ameliorate the metabolic rate aswell as glucose and lipid metabolism in hu-mans37,40 and it represents the distinctive featureof adipocytes contained in the brown adipose tis-sue. Brown adipose tissue (BAT) is densely pop-ulated with mitochondria containing the innermitochondrial proton carrier UCP1 that uncou-ples oxidative phosphorylation and allowing themitochondrial membrane potential to be dissipat-

5230

ed as heat41. In this study, we report, for the firsttime, that M. oleifera Lam. treatment during adi-pose tissue differentiation induce thermogenesisthrough overexpression of UCP1, SIRT-1,PPARα and Pgc-1α. Our data suggest that M.oleifera Lam. during adipogenesis improvesadipocyte functionality and upregulates the ex-pression of molecules involved in thermogenesismodulating lipid metabolism.

Conclusions

Our findings show that M. oleifera Lam.should be taken in to account for future nutrition-al researches focused on using M. oleifera Lam.as minerals supplementation.

–––––––––––––––––Financial SupportThis work was supported in part by the University of Cata-nia (FIR 2014-2016) and by the no-profit organization“Mani Amiche” onlus.

–––––––––––––––––-––––Conflict of InterestThe Authors declare that there are no conflicts of interest.

References

1) LEONE A, SPADA A, BATTEZZATI A, SCHIRALDI A, ARISTIL J,BERTOLI S. Cultivation, genetic, ethnopharmacolo-gy, phytochemistry and pharmacology of moringaoleifera leaves: an overview. Int J Mol Sci 2015;16: 12791-12835.

2) ADISAKWATTANA S, CHANATHONG B. Alpha-glucosi-dase inhibitory activity and lipid-lowering mecha-nisms of Moringa oleifera leaf extract. Eur RevMed Pharmacol Sci 2011; 15: 803-808.

3) YASSA HD, TOHAMY AF. Extract of Moringa oleiferaleaves ameliorates streptozotocin-induced Dia-betes mellitus in adult rats. Acta Histochem 2014;116: 844-854.

4) JAISWAL D, RAI PK, MEHTA S, CHATTERJI S, SHUKLA S, RAIDK, SHARMA G, SHARMA B, KHAIR S, WATAL G. Role ofMoringa oleifera in regulation of diabetes-inducedoxidative stress. Asian Pac J Trop Med 2013; 6:426-432.

I. Barbagallo, L. Vanella, A. Distefano, D. Nicolosi, A. Maravigna, et al.

Figure 7. Analysis of gene expression by Real-time PCR of thermogenic pathway of cells treated with M. oleifera Lam. dur-ing adipogenic differentiation (M). SIRT1 (A), PPARα (B), PGC1α (C) and UCP1 (D). All values are expressed as mean ±SEM of four experiments (n = 4) in duplicate. (*p < 0.05 vs. control).

5) GUPTA R, MATHUR M, BAJAJ VK, KATARIYA P, YADAV S,KAMAL R, GUPTA RS. Evaluation of antidiabetic andantioxidant activity of Moringa oleifera in experi-mental diabetes. J Diabetes 2012; 4: 164-171.

6) MBIKAY M. Therapeutic potential of moringaoleifera leaves in chronic hyperglycemia anddyslipidemia: a review. Front Pharmacol 2012; 3:24.

7) IFFIU-SOLTESZ Z, WANECQ E, LOMBA A, PORTILLO MP,PELLATI F, SZOKO E, BOUR S, WOODLEY J, MILAGRO FI,ALFREDO MARTINEZ J, VALET P, CARPENE C. Chronicbenzylamine administration in the drinking waterimproves glucose tolerance, reduces body weightgain and circulating cholesterol in high-fat diet-fedmice. Pharmacol Res 2010; 61: 355-363.

8) BOUR S, VISENTIN V, PREVOT D, DAVIAUD D, SAULNIER-BLACHE JS, GUIGNE C, VALET P, CARPENE C. Effects oforal administration of benzylamine on glucose tol-erance and lipid metabolism in rats. J PhysiolBiochem 2005; 61: 371-379.

9) KLOTING N, BLUHER M. Adipocyte dysfunction, in-flammation and metabolic syndrome. Rev EndocrMetab Disord 2014; 15: 277-287.

10) ANDERSSON DP, ERIKSSON HOGLING D, THORELL A, TOFTE, QVISTH V, NASLUND E, THORNE A, WIREN M, LOF-GREN P, HOFFSTEDT J, DAHLMAN I, MEJHERT N, RYDENM, ARNER E, ARNER P. Changes in subcutaneous fatcell volume and insulin sensitivity after weightloss. Diabetes Care 2014; 37: 1831-1836.

11) ROMEO R, NAVARRA M, GIOFRE SV, CARNOVALE C, CIRMIS, LANZA G, CHIACCHIO MA. Synthesis and biologi-cal activity of new arenediyne-linked isoxazo-lidines. Bioorg Med Chem 2014; 22: 3379-3385.

12) SALOMONE F, BARBAGALLO I, PUZZO L, PIAZZA C, LIVOLTI G. Efficacy of adipose tissue-mesenchymalstem cell transplantation in rats with aceta-minophen liver injury. Stem Cell Res 2013; 11:1037-1044.

13) NOVO G, CAPPELLO F, RIZZO M, FAZIO G, ZAMBUTO S,TORTORICI E, GAMMAZZA AM, CORRAO S, ZUMMO G, DEMACARIO EC, MACARIO AJ, ASSENNATO P, NOVO S, LIVOLTI G. Hsp60 and heme oxygenase-1 (Hsp32)in acute myocardial infarction. Transl Res 2011;157: 285-292.

14) MARRAZZO G, BOSCO P, LA DELIA F, SCAPAGNINI G, DIGIACOMO C, MALAGUARNERA M, GALVANO F, NICOLOSIA, LI VOLTI G. Neuroprotective effect of silibininin diabetic mice. Neurosci Lett 2011; 504: 252-256.

15) SALAMONE F, GALVANO F, MARINO GAMMAZZA A, PATER-NOSTRO C, TIBULLO D, BUCCHIERI F, MANGIAMELI A,PAROLA M, BUGIANESI E, LI VOLTI G. Silibinin im-proves hepatic and myocardial injury in mice withnonalcoholic steatohepatitis. Dig Liver Dis 2012;44: 334-342.

16) TIBULLO D, BARBAGALLO I, GIALLONGO C, LA CAVA P,PARRINELLO N, VANELLA L, STAGNO F, PALUMBO GA, LIVOLTI G, DI RAIMONDO F. Nuclear translocation ofheme oxygenase-1 confers resistance to imatinibin chronic myeloid leukemia cells. Curr PharmDes 2013; 19: 2765-2770.

17) MALAGUARNERA M, VACANTE M, GIORDANO M, PENNISIG, BELLA R, RAMPELLO L, MALAGUARNERA M, LI VOLTIG, GALVANO F. Oral acetyl-L-carnitine therapy re-duces fatigue in overt hepatic encephalopathy: arandomized, double-blind, placebo-controlledstudy. Am J Clin Nutr 2011; 93: 799-808.

18) MARRAZZO G, BARBAGALLO I, GALVANO F, MALAGUARN-ERA M, GAZZOLO D, FRIGIOLA A, D'ORAZIO N, LI VOLTIG. Role of dietary and endogenous antioxidants indiabetes. Crit Rev Food Sci Nutr 2014; 54: 1599-1616.

19) CACCAMO D, CAMPISI A, CURRO M, LI VOLTI G, VANELLAA, IENTILE R. Excitotoxic and post-ischemic neu-rodegeneration: involvement of transglutaminas-es. Amino Acids 2004; 27: 373-379.

20) VANELLA L, DI GIACOMO C, ACQUAVIVA R, BARBAGALLOI, LI VOLTI G, CARDILE V, ABRAHAM NG, SORRENTI V. Ef-fects of ellagic Acid on angiogenic factors inprostate cancer cells. Cancers (Basel) 2013; 5:726-738.

21) VANELLA L, DI GIACOMO C, ACQUAVIVA R, BARBAGALLOI, CARDILE V, KIM DH, ABRAHAM NG, SORRENTI V.Apoptotic markers in a prostate cancer cell line:effect of ellagic acid. Oncol Rep 2013; 30: 2804-2810.

22) BARBAGALLO I, VANELLA L, CAMBRIA MT, TIBULLO D, GO-DOS J, GUARNACCIA L, ZAPPALA A, GALVANO F, LI VOLTIG. Silibinin regulates lipid metabolism and differ-entiation in functional human adipocytes. FrontPharmacol 2015; 6: 309.

23) VANELLA L, TIBULLO D, GODOS J, PLUCHINOTTA FR, DIGIACOMO C, SORRENTI V, ACQUAVIVA R, RUSSO A, LIVOLTI G, BARBAGALLO I. Caffeic acid phenethyl es-ter regulates PPAR's levels in stem cells-de-r ived adipocytes. PPAR Res 2016; 2016:7359521.

24) CAMPISI A, CACCAMO D, LI VOLTI G, CURRO M, PARISIG, AVOLA R, VANELLA A, IENTILE R. Glutamate-evokedredox state alterations are involved in tissuetransglutaminase upregulation in primary astro-cyte cultures. FEBS Lett 2004; 578: 80-84.

25) SEARS B, RICORDI C. Role of fatty acids and polyphe-nols in inflammatory gene transcription and theirimpact on obesity, metabolic syndrome and dia-betes. Eur Rev Med Pharmacol Sci 2012; 16:1137-1154.

26) CINTI S. The adipose organ. Prostaglandins LeukotEssent Fatty Acids 2005; 73: 9-15.

27) DI PIERRO F, BRESSAN A, RANALDI D, RAPACIOLI G, GI-ACOMELL I L, BERTUCCIOL I A . Potential role ofbioavailable curcumin in weight loss and omen-tal adipose tissue decrease: preliminary data ofa randomized, controlled trial in overweight peo-ple with metabolic syndrome. Preliminary study.Eur Rev Med Pharmacol Sci 2015; 19: 4195-4202.

28) SANGKITIKOMOL W, ROCEJANASAROJ A, TENCOMNAO T.Effect of Moringa oleifera on advanced glycationend-product formation and lipid metabolism geneexpression in HepG2 cells. Genet Mol Res 2014;13: 723-735.

5231

M. oleifera Lam. improves lipid metabolism during adipogenic differentiation of human stem cells

5232

29) BAIS S, SINGH GS, SHARMA R. Antiobesity and hy-polipidemic activity of moringa oleifera leavesagainst high fat diet-induced obesity in rats. AdvBiol 2014; 2014: 9.

30) RAJANANDH MG, SATISHKUMAR MN, ELANGO K, SURESHB. Moringa oleifera Lam. A herbal medicine for hy-perlipidemia: A pre–clinical report. Asian Pac JTrop Dis 2012; 2 Supplement 2: S790-S795.

31) CARACI F, CASTELLANO S, SALOMONE S, DRAGO F, BOSCOP, DI NUOVO S. Searching for disease-modifyingdrugs in AD: can we combine neuropsychologicaltools with biological markers? CNS Neurol DisordDrug Targets 2014; 13: 173-186.

32) WANG Y, NISHINA PM, NAGGERT JK. Degradation ofIRS1 leads to impaired glucose uptake in adiposetissue of the type 2 diabetes mouse model TALLY-HO/Jng. J Endocrinol 2009; 203: 65-74.

33) VANELLA L, LI VOLTI G, GUCCIONE S, RAPPAZZO G, SAL-VO E, PAPPALARDO M, FORTE S, SCHWARTZMAN ML,ABRAHAM NG. Heme oxygenase-2/adiponectin pro-tein-protein interaction in metabolic syndrome.Biochem Biophys Res Commun 2013; 432: 606-611.

34) NDISANG JF, JADHAV A. Hemin therapy improves kid-ney function in male streptozotocin-induced dia-betic rats: role of the heme oxygenase/atrial natri-uretic peptide/adiponectin axis. Endocrinology2014; 155: 215-229.

35) BARBAGALLO I, NICOLOSI A, CALABRESE G, DAVID S,CIMINO S, MADONIA M, CAPPELLO F. The role of theheme oxygenase system in the metabolic syn-drome. Curr Pharm Des 2014; 20: 4970-4974.

36) VANELLA L, SODHI K, KIM DH, PURI N, MAHESHWARI M,HINDS TD, BELLNER L, GOLDSTEIN D, PETERSON SJ,SHAPIRO JI, ABRAHAM NG. Increased heme-oxyge-

nase 1 expression in mesenchymal stem cell-de-rived adipocytes decreases differentiation andlipid accumulation via upregulation of the canoni-cal Wnt signaling cascade. Stem Cell Res Ther2013; 4: 28.

37) SACERDOTI D, COLOMBRITA C, GHATTAS MH, ISMAEIL EF,SCAPAGNINI G, BOLOGNESI M, LI VOLTI G, ABRAHAMNG. Heme oxygenase-1 transduction in endothe-lial cells causes downregulation of monocytechemoattractant protein-1 and of genes involvedin inflammation and growth. Cell Mol Biol (Noisy-le-grand) 2005; 51: 363-370.

38) RIZZO M, ABATE N, CHANDALIA M, RIZVI AA, GIGLIORV, NIKOLIC D, MARINO GAMMAZZA A, BARBAGALLO I,ISENOVIC ER, BANACH M, MONTALTO G, LI VOLTI G.Liraglutide reduces oxidative stress and re-stores heme oxygenase-1 and ghrelin levels inpatients with type 2 diabetes: a prospective pilotstudy. J Clin Endocrinol Metab 2015; 100: 603-606.

39) SALERNO L, PITTALA V, ROMEO G, MODICA MN, SIRA-CUSA MA, DI GIACOMO C, ACQUAVIVA R, BARBAGALLO I,TIBULLO D, SORRENTI V. Evaluation of novel ary-loxyalkyl derivatives of imidazole and 1,2,4-tria-zole as heme oxygenase-1 (HO-1 inhibitors andtheir antitumor properties. Bioorg Med Chem2013; 21: 5145-5153.

40) KAJIMURA S, SAITO M. A new era in brown adiposetissue biology: molecular control of brown fat de-velopment and energy homeostasis. Annu RevPhysiol 2014; 76: 225-249.

41) ROUSSET S, ALVES-GUERRA MC, MOZO J, MIROUX B,CASSARD-DOULCIER AM, BOUILLAUD F, RICQUIER D. Thebiology of mitochondrial uncoupling proteins. Dia-betes 2004; 53 Suppl 1: S130-135.

I. Barbagallo, L. Vanella, A. Distefano, D. Nicolosi, A. Maravigna, et al.