Listeria monocytogenes Uses Listeria Adhesion …Listeria monocytogenes Uses Listeria Adhesion Protein (LAP) To Promote Bacterial Transepithelial Translocation and Induces Expression

INFECTION AND IMMUNITY, Dec. 2010, p. 5062–5073 Vol. 78, No. 120019-9567/10/$12.00 doi:10.1128/IAI.00516-10Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Listeria monocytogenes Uses Listeria Adhesion Protein (LAP) ToPromote Bacterial Transepithelial Translocation and Induces

Expression of LAP Receptor Hsp60�

Kristin M. Burkholder1‡ and Arun K. Bhunia1,2*Molecular Food Microbiology Laboratory, Department of Food Science,1 and Department of

Comparative Pathobiology,2 Purdue University, West Lafayette, Indiana 47907

Received 17 May 2010/Returned for modification 22 June 2010/Accepted 14 September 2010

Listeria monocytogenes interaction with the intestinal epithelium is a key step in the infection process. Wedemonstrated that Listeria adhesion protein (LAP) promotes adhesion to intestinal epithelial cells and facil-itates extraintestinal dissemination in vivo. The LAP receptor is a stress response protein, Hsp60, but theprecise role for the LAP-Hsp60 interaction during Listeria infection is unknown. Here we investigated theinfluence of physiological stressors and Listeria infection on host Hsp60 expression and LAP-mediated bac-terial adhesion, invasion, and transepithelial translocation in an enterocyte-like Caco-2 cell model. Stressorssuch as heat (41°C), tumor necrosis factor alpha (TNF-�) (100 U), and L. monocytogenes infection (104 to 106

CFU/ml) significantly (P < 0.05) increased plasma membrane and intracellular Hsp60 levels in Caco-2 cellsand consequently enhanced LAP-mediated L. monocytogenes adhesion but not invasion of Caco-2 cells. Intransepithelial translocation experiments, the wild type (WT) exhibited 2.7-fold more translocation throughCaco-2 monolayers than a lap mutant, suggesting that LAP is involved in transepithelial translocation,potentially via a paracellular route. Short hairpin RNA (shRNA) suppression of Hsp60 in Caco-2 cells reducedWT adhesion and translocation 4.5- and 3-fold, respectively, while adhesion remained unchanged for the lapmutant. Conversely, overexpression of Hsp60 in Caco-2 cells enhanced WT adhesion and transepithelialtranslocation, but not those of the lap mutant. Furthermore, initial infection with a low dosage (106 CFU/ml)of L. monocytogenes increased plasma membrane and intracellular expression of Hsp60 significantly, whichrendered Caco-2 cells more susceptible to subsequent LAP-mediated adhesion and translocation. These dataprovide insight into the role of LAP as a virulence factor during intestinal epithelial infection and pose newquestions regarding the dynamics between the host stress response and pathogen infection.

Listeria monocytogenes is a food-borne pathogen whichcauses severe opportunistic illness in humans by crossing theintestinal epithelial barrier to gain access to deeper tissues (21,56). Physiologically stressed individuals, including pregnantwomen and those who are immunocompromised, are at great-est risk for listeriosis. In these hosts, Listeria is able to cross theblood-brain barrier to affect the central nervous system and thefeto-placental barrier to infect the fetus in pregnant women,which may cause spontaneous abortion or stillbirth.

Since it is a food-borne pathogen, the initial interaction of L.monocytogenes with the intestinal epithelium is crucial for es-tablishing infection and promoting bacterial spread to extraint-estinal sites. Adhesion is mediated by bacterial factors, includ-ing fibronectin binding protein (FbpA), ActA, Ami, CtaP, andLapB. FbpA binds fibronectin in the intestinal epithelium andon hepatocytes (17). ActA, a protein required for actin-basedmotility during intracellular infection, also promotes adhesion,via host cell proteoglycans (1). Ami, an autolysin amidase,contributes to adhesion via interaction with an unknown host

receptor (41). CtaP, a cysteine transport-associated protein, isalso involved in adhesion to host cells (61), and LapB, a newlyidentified PrfA-regulated virulence protein, is involved in bothadhesion to and invasion of host cells (49).

Members of the internalin (Inl) family of proteins mediateadhesion to and invasion of a variety of host cell types. Fol-lowing oral infection, InlB, InlC, and InlJ mediate binding tothe human intestinal mucin Muc2 (38), and InlJ also adheres tosome cell types, including intestinal epithelial cells (51). InlAdrives invasion of intestinal epithelial cells via interaction withthe host receptor E-cadherin, a major component of adherensjunctions (40), while InlB promotes deeper infection by bind-ing to the receptor c-Met on cells of the endothelium and onhepatocytes (14). InlA-facilitated invasion is associated withsystemic spread of L. monocytogenes, as InlA deletion mutantsexhibit reduced translocation to extraintestinal sites in guineapigs (36) and in transgenic mice expressing human E-cadherin(37). Despite the clear role of InlA in mediating epithelialinvasion, in vivo studies demonstrate animal mortality follow-ing oral infection with InlA mutants or in animals lacking anInlA-specific E-cadherin molecule (3, 8, 16, 30). Such reportshave identified additional virulence factors which promoteintestinal pathogenesis of L. monocytogenes, independent ofInlA. For example, the peptidoglycan hydrolase Auto aids inepithelial cell invasion (7), and virulence invasion protein(Vip) mediates invasion of intestinal epithelial cells by bindingto the host receptor Gp96 (8). In transgenic mice expressing

* Corresponding author. Mailing address: Molecular Food Microbi-ology Laboratory, Department of Food Science, 745 Agriculture MallDrive, Purdue University, West Lafayette, IN 47907-2009. Phone:(765) 494-5443. Fax: (765) 494-7953. E-mail: [email protected].

‡ Present address: Department of Microbiology & Immunology,University of Michigan Medical School, 1150 W. Medical Center Dr.,Ann Arbor, MI 48109-5620.

� Published ahead of print on 27 September 2010.

5062

on June 18, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/IAI.00516-10&domain=pdf&date_stamp=2010-12-01

http://iai.asm.org/

human E-cadherin, a �vip strain exhibited reduced transloca-tion to the mesenteric lymph nodes, liver, and spleen, to levelscomparable to those of an �inlA mutant. These studies indi-cate that transit of Listeria across the tight intestinal barrierdepends on the concerted action of multiple virulence factors,by mechanisms which are yet unclear.

Our lab has identified Listeria adhesion protein (LAP), a104-kDa alcohol acetaldehyde dehydrogenase (lmo1634), as aputative adhesion factor which promotes binding to cell linesof intestinal origin (29, 31, 32, 46) and promotes translocationto the liver and spleen following oral infection of mice (6, 31).LAP is present on the bacterial cell wall and is secreted by theSecA2 system (6). The secreted form of LAP, in conjunctionwith the cell wall-localized form, promotes full LAP-mediatedinteraction with host cells, possibly by reassociating with thebacterial cell wall (6, 29).

We previously identified human heat shock protein 60(Hsp60) as the epithelial receptor for LAP, and we demon-strated reduced LAP-mediated adhesion in Caco-2 cells fol-lowing treatment of the Caco-2 cell surface with an Hsp60-specific antibody (58). Despite our previous indication thatLAP is important for pathogenesis during the intestinal stageof Listeria infection (31), the exact contributions of LAP andHsp60 to intestinal pathogenesis are unclear.

Although Hsp60 performs chaperone functions primarilywithin the cell cytoplasm and mitochondrial matrix (28), thepresence of it and other heat shock proteins has been found onthe cytoplasmic membranes of various mammalian cells, andsurface localization of these chaperones is now generally ac-cepted (5, 8, 55). Others have also identified heat shock pro-teins as pathogen ligands: Staphylococcus aureus FbpA associ-ates with Hsp60 to mediate cell invasion (19), the hepatitis Bvirus HBx protein forms complexes with host Hsp60 andHsp70 during infection (63), and Brucella abortus exploits hostHsp70 for invasion of placental trophoblasts and induction ofabortion in pregnant mice (59). The use of a host Hsp as apathogen receptor is an intriguing phenomenon, because Hspexpression is elevated in response to physiological stressors,which include changes in temperature as well as bacterial andviral infections (4, 39, 45). Despite mounting evidence thatcertain pathogens use heat shock proteins as receptors, littleinformation exists on the potential relationship between infec-tion, the heat shock protein response, and subsequent impli-cations for host-pathogen interaction.

Our objectives in this study were to determine how LAP andHsp60 mediate interaction of Listeria with intestinal epithelialcells and to evaluate the influence of Listeria infection on hostHsp60 expression. Here we demonstrate that the interaction ofLAP and host Hsp60 promotes adherence to and translocationacross intestinal epithelial monolayers. We also provide evi-dence that low levels of L. monocytogenes infection increaseexpression of host Hsp60, which may in turn lead to greaterLAP-mediated association of Listeria with intestinal epithe-lial cells. This study reveals a novel mechanism by whichListeria may interact with the intestinal epithelial barrierand provides early evidence of how infection-induced ex-pression of host heat shock proteins may promote host-pathogen interaction.

MATERIALS AND METHODS

Bacterial strains and growth conditions. L. monocytogenes F4244 (wild type[WT]; serovar 4b), the isogenic lap-deficient insertion mutant KB208 (lap strain),and lap-complemented CKB208 (lap�) were used as described previously (6, 32)(Table 1). An inlA deletion mutant (�inlA; AKB301) and its complement (inlA�;AKB302) were generated for this study. All L. monocytogenes strains were grownin brain heart infusion (BHI) broth (Becton Dickinson) at 37°C, unless indicatedotherwise. The lap strain was grown with erythromycin (5 �g/ml) at 42°C, thelap� strain was grown with erythromycin (5 �g/ml) and chloramphenicol (5�g/ml) at 37°C, and the inlA� strain was grown with chloramphenicol (5 �g/ml)at 37°C.

Bacterial mutagenesis and complementation. A modification of splicing byoverlap extension (SOE) was used to generate a 5�-3� in-frame deletion of theinlA open reading frame (ORF) (�inlA) (10). Oligonucleotide primers InlAUSFand InlAUSR (Table 1) generated a 403-bp product from the 5� end of the inlAlocus. A 400-bp 3� product was amplified using primers InlADSF and InlADSR(Table 1). The 5� and 3� products were combined in equimolar concentrations ina ligation reaction mixture to yield an 803-bp 5�-3� SOE fragment. This productwas digested with BamHI and SacI, cloned into pGEM-T Easy (Promega, Mad-ison, WI), and subcloned into the temperature-sensitive pAUL-A shuttle vector(11). Electrocompetent L. monocytogenes F4244 WT cells were transformed withthe construct and subjected to temperature-dependent allelic exchange (10, 11).In-frame deletion of inlA was confirmed by PCR, using primers InlAUSF andInlADSR. Immunoblotting confirmed the absence of InlA but the presence ofLAP in the L. monocytogenes �inlA strain.

To complement the �inlA mutant with the inlA gene (inlA�), oligonucleotideprimers InlABamF and InlASphR (Table 1) were used to amplify the entire inlAORF from L. monocytogenes F4244 genomic DNA. Amplified inlA was clonedvia BamHI and SphI sites into pGEM-T Easy and subcloned into pMGS101(22). Electrocompetent L. monocytogenes �inlA cells were transformed withpMGS101-inlA, and positive transformants were selected by plating in the pres-ence of chloramphenicol.

Cell culture. Secondary human enterocyte-like Caco-2 cells (HTB37; Ameri-can Type Culture Collection) were grown in Dulbecco’s modified Eagle medium(DMEM; Invitrogen) containing 10% fetal bovine serum (D10F) (Atlanta Bio-logicals) at 37°C under 7% CO2 in a humidified incubator. Cells (passages 25 to35) were seeded at approximately 5 � 104 to 10 � 104 cells/well into 12- or24-well plates (Corning), and cell monolayers were used between 10 and 14 dayslater. Confluence was typically achieved at 4 to 5 days, and by 10 days, Caco-2monolayers were polarized (24).

Antibodies. An anti-Hsp60 antibody was generated via immunization of a NewZealand White rabbit with purified human Hsp60 (Assay Design, Ann Arbor,MI). Antisera were collected at the Purdue University Small Animal Care Fa-cilities, and anti-Hsp60 antibody was purified using a protein G affinity column.An anti-InlA antibody was generated via immunization of a New Zealand Whiterabbit with purified truncated InlA (amino acid residues 36 to 496) (54). Antiserawere collected, and anti-InlA antibody was purified by use of a protein A column.Other antibodies included an anti-�-actin (43 kDa) monoclonal antibody (MAb)(Abcam), an anti-ZO1 polyclonal antibody (PAb) (Invitrogen), anti-LAP MAbH7, and IgG control MAb C11E9, from our lab.

RNA interference and overexpression of Hsp60. Short hairpin RNA (shRNA)constructs targeting human hsp60 mRNA (SureSilencing shRNA-HSPD1) and anontargeting control shRNA vector (SABiosciences, Frederick, MD) were usedto generate a Caco-2 cell line with stable suppression of Hsp60 expression (Table1). To create a Caco-2 cell line exhibiting overexpression of Hsp60, full-lengthhuman hsp60 cDNA was subcloned from pOTB7-hsp60 (Open Biosystems) intothe expression vector pcDNA3.1 (Invitrogen) (Table 1). The integrity of hsp60within the expression construct (pCDNA3.1-hsp60) was verified by sequencing.A pCDNA3.1 plasmid without an insert was used as a vector control. Caco-2 celltransfections were performed using Lipofectamine LTX Plus reagent accordingto the manufacturer’s protocol (Invitrogen). Stable transformants were selectedby growth in D10F containing 800 �g/ml Geneticin sulfate (G418) (Sigma).Hsp60 expression levels were monitored by reverse transcription-PCR (RT-PCR) and Western blotting.

Analysis of Hsp60 expression in Caco-2 cell fractions by SDS-PAGE andimmunoblotting. Caco-2 cell monolayers were washed twice with cold phos-phate-buffered saline (PBS) (0.1 M; pH 7.0), and membrane and intracellularproteins were isolated using a Mem-Per eukaryotic protein extraction kit(Pierce) (64). Protein preparations were desalted (Zeba desalting spin columns;Pierce), precipitated using acetone, and resuspended in sample solvent (4.6%SDS, 0.5% �-mercaptoethanol, PBS, pH 7.0). The protein concentration wasdetermined by a reducing agent-compatible bicinchoninic acid (BCA) assay

VOL. 78, 2010 LAP PROMOTES TRANSEPITHELIAL TRANSLOCATION 5063


.org/D

ownloaded from

http://iai.asm.org/

(Pierce). A lactate dehydrogenase (LDH) assay was performed with acetone-precipitated protein fractions dissolved in DMEM to rule out contamination ofmembrane fractions with intracellular proteins (data not shown). Equal proteinconcentrations (15 �g/lane) from Caco-2 membrane and cytosolic fractions wereseparated by SDS-PAGE (10% acrylamide). Proteins were transferred to Im-mobilon-P membranes (Millipore) and immunoprobed with anti-Hsp60 PAb (1.4mg/ml; 1:1,000 dilution) and �-actin-specific MAb (1.8 mg/ml; 1:1,000 dilution).Bands were detected using horseradish peroxidase-coupled anti-mouse oranti-rabbit antibodies (Jackson Immuno Research, West Grove, PA) withenhanced chemiluminescence substrate (Pierce) and were developed on X-ray films. To compare reaction intensities, average band densities were de-termined with Quantity One software (Bio-Rad).

Bacterial adhesion and invasion assays. Fresh bacterial cultures were washedand resuspended in D10F and then added to Caco-2 monolayers at a multiplicityof infection (MOI) of �10. To measure bacterial adhesion, monolayers werewashed after 1 h of infection, and adherent bacteria were enumerated by beingplated on BHI agar as previously described (32). For bacterial invasion, mono-layers were washed after 1 h of infection and incubated with D10F containinggentamicin (50 �g/ml) for 1 h (47). Caco-2 cells were lysed with 0.1% Triton X,and internalized bacteria were enumerated by plate counting as described before(47).

Transepithelial bacterial translocation assay. Caco-2 monolayers weregrown to confluence on Transwell filter inserts (4-�m pore size; Corning) andthen placed in 12-well tissue culture plates. Transepithelial electrical resis-tance (TEER) of polarized monolayers was measured (Voltometer; Millipore),and those with a minimum TEER of about 200 �/cm2 (range, 190 to 209 �/cm2)were used for translocation experiments (15, 27). Furthermore, to ensure mono-

layer integrity on Transwell inserts, Caco-2 cells from representative experimentswere immunostained using antibodies specific to the tight junction proteinsZO-1, occludin, and claudin and Cy5- and fluorescein isothiocyanate (FITC)-conjugated secondary antibodies and were examined by confocal microscopy asdescribed in “Fluorescence microscopy.” Bacteria (MOI, �10) were added to theapical well of the Transwell system, and after 2 h at 37°C in 7% CO2, liquid wascollected from the basal well and translocated bacteria were enumerated by platecounting (15). Initial experiments were conducted to determine the appropriatelength of time for monitoring bacterial translocation through Caco-2 monolay-ers, and 2 h was chosen because at this time point bacteria in the basal well mostclosely represented the number of translocated microorganisms, with minimalposttranslocation replication (data not shown).

Effect of Hsp60 expression on Listeria interaction with Caco-2 cells. To eval-uate the role of Hsp60 expression in LAP-mediated infection, Caco-2 cells weresubjected to heat stress (41°C) or tumor necrosis factor alpha (TNF-) (Sigma)exposure at 37°C (100 U/ml D10F) (20) for 1 h, followed by a 3-h recovery periodat 37°C with 7% CO2. Flow cytometric analyses were performed to determinethat 3 h was the optimum recovery period required for surface Hsp60 expressionin Caco-2 cells following heat shock (data not shown). Hsp60 expression inCaco-2 cells was monitored by immunoblotting. Bacterial adhesion and translo-cation were measured as described above.

Influence of direct or indirect exposure of Caco-2 cells to Listeria on Hsp60expression. Caco-2 cells were exposed to various doses (104, 106, and 108 CFU/ml, corresponding to MOIs of 0.1, 10, and 100, respectively) of the L. monocy-togenes WT or lap strain or of Listeria innocua for 1 h, followed by a 3-h recoveryin D10F containing gentamicin (50 �g/ml). Initial flow cytometric analyses de-termined that 3 h was the optimal recovery period for surface Hsp60 expression

TABLE 1. Bacterial strains, cell lines, plasmids, and primers used in this study

Strain, cell line, plasmid, or primer Description or sequence (5�–3�)a Source or reference

L. monocytogenes strainsF4244 Wild type (serovar 4b); Ems Cms Our collectionKB208 (lap) lap insertion mutant; Emr (5 �g/ml) 32CKB208 (lap�) lap complementation of KB208; Emr (5 �g/ml) Cmr (5 �g/ml) 32AKB301 (�inlA) inlA deletion mutant This studyAKB302 (inlA�) inlA complementation of AKB301; Cmr (5 �g/ml) This study

Caco-2 cell lineHTB37 Wild type; Geneticin (G418) sensitive ATCCshRNA-hsp60 (Hsp60) Stable suppression of hsp60 mRNA; Geneticin (G418 resistant (800 �g/ml) This studypCDNA3.1-hsp60 (Hsp60�) Constitutive overexpression of hsp60; G418 resistant This study

PlasmidspGEM-T Easy Cloning vector PromegapAUL-A Temperature-sensitive shuttle vector 11pMGS101 Expression vector 22SureSilencing shRNA-HSPD1 Short hairpin RNA against human hsp60 SABiosciencespCDNA3.1 Mammalian expression vector InvitrogenpOTB7-hsp60 Mammalian cloning vector Open Biosystems

PrimersinlA primers

InlAUSF CGGGATCCTACTGCAAGAACAGTTAA (BamHI) This study (NCBI accessionno. NC_002973)

InlAUSR CCATCGATATATAGACTCCT (ClaI) This study (NCBI accessionno. NC_002973)

InlADSF CCATCGATAAGTAGTGTAAAGAGCTA (ClaI) This study (NCBI accessionno. NC_002973)

InlADSR CGGAGCTCATAACTTTGTCACATTGGGTA (EcoRI) This study (NCBI accessionno. NC_002973)

InlABamF CGCGGATCCGTGAGAAGAAAACGATA (BamHI) This study (NCBI accessionno. NC_002973)

InlASphR CGCGCATGCCTATTTACTAGCACGTG (SphI) This study (NCBI accessionno. NC_002973)

hsp60 primer 201-bp product SABiosciences18S rRNA primers 198-bp product

18SF TCAACTTTCGATGGTAGTCGCCGT 218SR ACTCATTCCAATTACAGGGCCTCG 2

a The underlined represents an engineered sequence restriction site with the enzyme name in parentheses. Em, erythromycin; Cm, chloramphenicol.

5064 BURKHOLDER AND BHUNIA INFECT. IMMUN.


.org/D

ownloaded from

http://iai.asm.org/

following L. monocytogenes infection (data not shown). To monitor Hsp60 ex-pression following direct bacterial exposure, bacteria were added to the apicalside of Caco-2 monolayers grown in a 12-well plate. For indirect exposure,bacteria were separated from monolayers via a Transwell filter insert (0.4-�mpore size; Corning). Hsp60 expression in Caco-2 cells was monitored by immu-noblotting as described above.

Influence of initial (primary) Listeria infection on susceptibility to subsequent(secondary) LAP-mediated adhesion and transepithelial translocation. A seriesof experiments was conducted to determine whether Listeria-induced Hsp60expression affects host cell susceptibility to subsequent (secondary) LAP-medi-ated infection.

The first experiment was conducted to determine whether initial exposure toWT L. monocytogenes or L. innocua would affect susceptibility to subsequent L.monocytogenes adhesion. L. monocytogenes and L. innocua were chosen for theinitial infection because they differed in the ability to induce Caco-2 cell Hsp60expression. Untransfected Caco-2 cells were exposed to 106 CFU/ml (MOI, �10)of the L. monocytogenes WT or lap strain or of L. innocua for 1 h (primaryinfection) or were left untreated. Noninternalized bacteria were killed by gen-tamicin (50 �g/ml) treatment, and after a 3-h recovery period in gentamicin-containing D10F, cells were thoroughly washed and exposed again to WT L.monocytogenes (106 CFU/ml) as a secondary infection. Adherent bacteria fromthe secondary infection were enumerated at 1 h postinfection as described above.To account for the number of bacteria that were internalized during the primaryinfection and had undergone intracellular replication, control wells were in-cluded which had been subjected only to the 1-h primary infection and thenmaintained in D10F with gentamicin instead of being exposed to the secondaryinfection. Intracellular bacteria were enumerated from these control wells, andthe average value was subtracted from the number of adherent bacteria after thesecondary infection.

A second set of experiments was conducted to determine the roles of Hsp60and LAP in mediating susceptibility to secondary infection. In these experiments,control shRNA (control-sh; mock-transfected)- or shRNA-Hsp60-transfectedCaco-2 cells were exposed to L. monocytogenes in a primary infection or were leftuninfected. Caco-2 cells were exposed to L. monocytogenes in a primary infectionor were left uninfected. Cells were recovered for 3 h as in the first experiment,as described above, and then were exposed to the WT, lap, lap�, �inlA, or inlA�

strain in a secondary infection. Secondary bacterial adhesion and translocationwere measured in separate experiments. As in the first experiment (above),control wells were included to account for intracellular bacteria resulting fromthe primary L. monocytogenes infection.

Fluorescence microscopy. To evaluate surface localization of Hsp60 by immu-nofluorescence microscopy, Caco-2 cells were grown to confluence in D10F onLabTek chamber slides (Nunc, ThermoFisher Scientific). Cells were washed withHanks balanced salt solution (HBSS) (Cellgro) and then incubated with anti-Hsp60 PAb (diluted 1:250 in HBSS) for 1 h at 37°C. After being washed withHBSS containing 1% bovine serum albumin (BSA), cells were incubated withFITC-conjugated monovalent secondary Fab fragment (diluted 1:250 in HBSS)for 1 h at 37°C. Propidium iodide (1 �g/ml in HBSS) was added for 10 min tostain dead cells, and then monolayers were washed with HBSS and fixed with 4%paraformaldehyde diluted 1:1 in HBSS at room temperature for 10 min. Cellswere mounted with ProLong Gold antifade reagent (Molecular Probes) andexamined under an epifluorescence microscope (Leica, Wetzlar, Germany)equipped with Spot software (Sterling Heights, MI).

To evaluate intracellular Hsp60 levels, confluent Caco-2 cells were fixed withparaformaldehyde as described above and then permeabilized with 0.01% TritonX in HBSS. Monolayers were immunoprobed at room temperature with anti-Hsp60 PAb (1:250) and FITC-conjugated monovalent secondary Fab fragment(1:250), as well as with anti-ZO1 PAb (1:250) (Molecular Probes) and Cy5-conjugated monovalent Fab fragment (1:250), as described above. In some cases,cells were treated with Hoechst dye (0.5 �g/ml in HBSS) for nuclear (blue)staining. Images were visualized at the Purdue Life Science Fluorescence Imag-ing Facility, using a Zeiss LSM 710 confocal fluorescence microscope (Carl Zeiss,Jena, Germany) with a 63�/1.4 water immersion objective. Images were acquiredand processed (colocalization) using Zeiss LSM Image Browser software (CarlZeiss, Jena, Germany).

Statistical analysis. The SAS program (Cary, NC) was employed for statis-tical analyses. Differences between pairs were assessed by Wilcoxon rank sumanalysis, and the Proc GLM test was used for comparison of data from morethan three groups (SAS, Cary, NC). P values of �0.05 were consideredsignificant.

RESULTS

LAP-Hsp60 association promotes L. monocytogenes adhesionto Caco-2 cells. We previously demonstrated that a lap-defi-cient mutant exhibited reduced adhesion to Caco-2 cells (32,58). In this study, to confirm the role of the Hsp60-LAP inter-action in promoting adhesion, we evaluated LAP-mediatedadhesion when levels of cellular Hsp60 were altered. Inductionof Caco-2 Hsp60 expression via heat stress (41°C) or exposureto TNF- (100 U/ml) (20) led to increased levels of Hsp60 inboth intracellular (44% increase for heat shock and 50%increase for TNF- exposure) and plasma membrane (69% in-crease for heat shock and 80% increase for TNF- exposure)protein fractions (Fig. 1A). Adhesion of the WT, but not thelap strain, to heat-stressed and TNF--treated Caco-2 cellsincreased 2.2-fold (P � 0.01) and 1.9-fold (P � 0.03), respec-tively, compared to that with unstressed Caco-2 cells (Fig. 1B).The contribution of Hsp60 to this interaction was further con-firmed by pretreating stressed cells with an Hsp60-specific an-tibody prior to infection, which reduced adhesion of the WT tolevels similar to those with unstressed Caco-2 cells (P � 0.01)(Fig. 1B).

To further examine the effect of Hsp60 on Listeria adhesion,we reduced the levels of endogenous Hsp60 by transfectingHsp60-specific shRNA into Caco-2 cells, which resulted inreductions of Hsp60 protein expression of approximately 70%in intracellular fractions and 90% in plasma membrane frac-tions (Fig. 2B). Hsp60 suppression in Caco-2 cells was also

FIG. 1. Influence of Caco-2 Hsp60 expression on LAP-mediatedadhesion of L. monocytogenes. (A) Immunoblot showing the level ofHsp60 expression in Caco-2 plasma membrane (Mem-Hsp60) andintracellular (Int-Hsp60) fractions after heat stress (41°C, 1 h) andTNF- exposure (100 U/ml, 1 h). �-Actin (43 kDa) was used as aninternal control. Proteins were loaded at 15 �g/well. (B) Adhesion ofWT, lap (mutant), and lap� (lap-complemented) L. monocytogenesstrains to Caco-2 monolayers following Caco-2 heat stress (41°C) andTNF- (100 U/ml) exposure and after treatment with anti-Hsp60 PAb(1 �g/ml). Adhesion data are averages for at least three independentexperiments performed in quadruplicate (n � 12). Error bars repre-sent standard errors of the means (SEM). Lowercase letters (a and b)represent significant differences (P � 0.05) in adhesion of bacterialstrains.



.org/D

ownloaded from

http://iai.asm.org/

confirmed by RT-PCR (Fig. 2A). Partial suppression of Hsp60by RNA interference was reported by others (9, 13); completeHsp60 suppression may not be possible because it has impor-tant antiapoptotic functions in cultured cell lines (25). Adhe-sion of the WT decreased 4.5-fold in Hsp60-suppressed cells,whereas adhesion of the lap strain was unchanged (Fig. 2C).Overexpression of Hsp60 via pcDNA3.1-hsp60 resulted in a60% Hsp60 increase in intracellular protein fractions and a75% increase in plasma membrane protein fractions (Fig. 2B).Adhesion of the WT increased 2.8-fold (P � 0.006) for cellsoverexpressing Hsp60, while adhesion of the lap strain wasunaffected (Fig. 2C).

LAP-Hsp60 interaction promotes Listeria monocytogenestranslocation through epithelial monolayers. Although adhe-sion is a crucial step in L. monocytogenes pathogenesis, bindingof bacteria to epithelial cells does not always directly correlatewith dissemination to target organs (30). We therefore inves-tigated whether LAP was implicated in Listeria invasion ofintestinal epithelial cells, which could contribute to the differ-ences in systemic dissemination observed between LAP-defi-cient and WT L. monocytogenes strains (6, 31). In gentamicinprotection invasion assays, internalization of the WT was

greater than that of the lap strain (P � 0.003), but both strainswere significantly more invasive than the �inlA strain (Fig. 3).However, neither Hsp60 suppression nor overexpression (Fig.3) influenced invasion of the WT, lap, or �inlA strain (Fig. 3),indicating that the LAP-Hsp60 interaction may not be directlyresponsible for invasion of L. monocytogenes into epithelialcells.

We next sought to determine the role of LAP in transloca-tion through Caco-2 monolayers. Caco-2 monolayer integritywas verified by confocal microscopy, with visible tight junctionborders and no alteration in cellular distribution of tight junc-tion proteins before and after treatment with L. monocytogenes(Fig. 4). Furthermore, TEER values for intact Caco-2 cellmonolayers ranged from 190 � 2 to 209 � 6 (Table 2) andwere consistent in all our experiments throughout this study,and these values are within the range reported by others (15,27). As a positive control, treatment of monolayers with cy-tochalasin D induced a very low TEER (Table 2) (60). Fol-lowing 2 h of bacterial exposure (MOI, �10), translocation ofthe lap strain through Caco-2 monolayers was 60% less thanthat of the WT (P � 0.02) (Fig. 5B); however, there were noapparent differences in TEER values between WT- and lapmutant-treated Caco-2 cells (Table 2). Increasing Caco-2Hsp60 expression via endogenous overexpression enhancedWT and lap� strain translocation 2-fold (P � 0.001) and 1.6-fold (P � 0.01), respectively, but did not influence transloca-tion of the lap strain (Fig. 5B). shRNA suppression of Hsp60decreased translocation of the WT 3-fold (P � 0.004), buttransit of the lap strain to the basal compartment (Fig. 5B) wasnot affected. Similarly, addition of exogenous Hsp60 to thesurfaces of Caco-2 cells resulted in greater translocation of theWT (P � 0.001) but not of the lap strain (data not shown).These data indicate a clear role for the LAP-Hsp60 interactionin mediating transepithelial translocation of L. monocytogenes.

Surprisingly, translocation of the �inlA strain throughCaco-2 monolayers was nearly 2-fold greater than that of theWT (P � 0.025) and was reversed to WT levels when the strainwas complemented with inlA (Fig. 5B and C). Furthermore,

FIG. 2. Analysis of L. monocytogenes adhesion to Caco-2 cells fol-lowing Hsp60 knockdown by shRNA (shRNA Hsp60) or Hsp60overexpression (Hsp60�) or adhesion to control-sh-transfected cells(Caco-2 cells transfected with noncoding shRNA). (A) RT-PCR anal-ysis of hsp60 expression (23 cycles) in Caco-2 cells following shRNA-Hsp60 knockdown. 18S RNA was used as an internal control.(B) Immunoblot showing Hsp60 suppression (shRNA Hsp60) andoverexpression (Hsp60�) in Caco-2 plasma membrane (Mem-Hsp60)and intracellular (Int-Hsp60) fractions. �-Actin (43 kDa) was used asan internal control. Proteins were loaded at 15 �g/well. (C) Adhesionof L. monocytogenes WT, lap (mutant), and lap� (lap-complemented)strains to control-sh, shRNA-Hsp60, and Hsp60� Caco-2 monolayers.Adhesion data are averages for at least three independent experimentsperformed in quadruplicate (n � 12) and are presented with SEM.Lowercase letters (a, b, and c) indicate significant differences (P �0.05) in adhesion of individual bacterial strains to Caco-2 monolayersexpressing varied levels of Hsp60.

FIG. 3. Analysis of L. monocytogenes WT, lap, lap�, �inlA, andinlA� strain invasion of Caco-2 cells following Hsp60 knockdown byshRNA (shRNA Hsp60) or Hsp60 overexpression (Hsp60�) or ofcontrol-sh-transfected cells (Caco-2 cells with scrambled shRNA). In-vasion results are averages for at least three independent experimentsperformed in quadruplicate (n � 12) and are presented with SEM.Lowercase letters (a to c) indicate significant differences (P � 0.05) ininvasion among bacterial strains.



.org/D

ownloaded from

http://iai.asm.org/

�inlA strain translocation was influenced by Hsp60 expres-sion, similar to that of the WT, as translocation decreased inshRNA-Hsp60-transfected Caco-2 monolayers (Fig. 5B). Totest for LAP-mediated translocation in the �inlA strain, whichexpresses normal levels of LAP (Fig. 5A), the �inlA strain wascoated with a LAP-specific antibody prior to Caco-2 cell infec-tion. Antibody treatment resulted in a 60% reduction in trans-location (P � 0.02) (Fig. 5C), indicating that LAP-mediatedtranslocation occurs in the �inlA strain. The observance ofincreased translocation in the absence of epithelial cell inva-sion suggests that LAP-mediated translocation of the �inlAstrain may occur via a noninvasive, or paracellular, mechanism.Such paracellular translocation might necessitate localizationof Hsp60 near Caco-2 paracellular borders. Confocal micro-scopic analysis revealed low levels of Hsp60 colocalization withCaco-2 cell tight junctions (Fig. 6C).

L. monocytogenes infection at a low dosage influences Hsp60expression. Recent reports indicate that bacterial and viralinfections can induce a host heat shock response (4, 39, 62).We sought to determine whether L. monocytogenes infectionmight influence Hsp60 expression in intestinal epithelial cellsby infecting Caco-2 cells with various doses (104, 106, and 108

cells) of L. monocytogenes and monitoring protein expression.

Infection with each dose of L. monocytogenes increased hsp60transcript levels, as analyzed by RT-PCR (data not shown), aswell as levels of Hsp60 protein in plasma membrane and in-tracellular protein fractions (Fig. 6A). However, the greatestincrease in Hsp60 was in the plasma membrane following in-fection with 104 or 106 cells of L. monocytogenes (Fig. 6A).Fluorescence microscopy confirmed increased levels of surface(Fig. 6B) and intracellular (Fig. 6C) Hsp60 and demonstratedthat colocalization of Hsp60 with Caco-2 cell tight junctionsincreased following L. monocytogenes infection (Fig. 6C).

To determine whether Hsp60 expression occurred specifi-cally in response to L. monocytogenes or in response to generalbacterial factors, we exposed Caco-2 cells to 106 CFU/ml of theL. monocytogenes WT or lap strain or nonpathogenic L. in-nocua and monitored Hsp60 expression by Western blotting(Fig. 7A) and flow cytometry (Fig. 7B). The Hsp60 level in-creased in both intracellular (62% increase) and membrane(80% increase) fractions following infection with L. monocy-togenes but was not dependent upon LAP expression, since thelap mutant had similar levels to those of the WT (Fig. 7A), anddid not increase after L. innocua exposure. These data indicatethat the Hsp60 response may be specific to L. monocytogenes.Furthermore, no change in Hsp60 expression was observedwhen bacterial cells were separated from Caco-2 cells by use ofa 0.4-�m filter (indirect exposure) (Fig. 7), suggesting thatdirect bacterial contact with epithelial cells, irrespective ofLAP expression, is required and that diffusible microbial fac-tors may not induce Hsp60 expression.

Caco-2 cells expressing high levels of Hsp60 are more sus-ceptible to subsequent L. monocytogenes infection. Pathogen-induced Hsp60 expression is not unprecedented (4, 39); how-ever, it is intriguing in the case of L. monocytogenes infection ofintestinal epithelial cells, since Hsp60 is the receptor for LAP-mediated infection. We therefore designed a series of cell-based studies to test whether L. monocytogenes-induced Hsp60expression would render host cells more susceptible to further

FIG. 4. Confocal microscopic analysis of tight junction integrity in uninfected (A) and L. monocytogenes-infected (2 h) (B) Caco-2 monolayersgrown on Transwell filters. Monolayers were labeled with antibodies specific for the tight junction proteins ZO-1, occludin, and claudin (red) andfor Hsp60 (green) and with a nuclear stain (blue). The images reveal visible tight junction borders in both uninfected and infected Caco-2monolayers, with no alteration in cellular distribution of tight junction proteins or in cellular damage.

TABLE 2. TEER values for Caco-2 cells before andafter treatments

Treatment

TEER (mean ��/cm2� � SD)a

Beforetreatment

After treatmentfor 2 h

L. monocytogenes F4244 (WT) 203 � 7.4 164 � 10.5A

L. monocytogenes lap strain (KB208) 209 � 6.1 158 � 13.1A

L. monocytogenes �inlA strain (AKB301) 208 � 2.5 166 � 12.2A

L. innocua F4248 201 � 11.0 177 � 7.5A

Cytochalasin D (1 mg/ml) 190 � 2.0 59 � 7.6B

a Values are averages for two experiments run in triplicate (n � 6). Valuesmarked with letters (A and B) are significantly different (P � 0.05).



.org/D

ownloaded from

http://iai.asm.org/

LAP-mediated (secondary) infection. First, control (untrans-fected) Caco-2 monolayers were exposed to WT L. monocyto-genes or to L. innocua in a primary infection; after a 3-hrecovery period with gentamicin, cells were then subjected tosecondary infection by L. monocytogenes. The number of L.monocytogenes organisms bound to Caco-2 cells resulting from

the secondary infection was significantly greater (P � 0.032)following a primary L. monocytogenes exposure than in previ-ously uninfected cells or in monolayers which were first ex-posed to L. innocua (Fig. 8A). These data suggest that initialinfection with L. monocytogenes may render host cells moresusceptible to further (secondary) infection by this pathogen,but this alone does not imply involvement of Hsp60 or LAPin susceptibility to secondary infection. Therefore, a secondexperiment was conducted with control-sh (transfected withshRNA noncoding vector)- and shRNA-Hsp60-transfectedCaco-2 cells, where the primary infection microorganism wasthe WT and the secondary microorganism was the WT, lap, or�inlA strain (Fig. 8B). In control-sh-transfected Caco-2 cells,we observed significantly greater adhesion of the WT (3.3-foldincrease) (P � 0.01) and the �inlA strain (4.4-fold increase)(P � 0.025), but not the lap mutant, following primary L.monocytogenes WT infection than that to cells which werepreviously uninfected (Fig. 8B). This indicates that primaryinfection rendered the Caco-2 cells more susceptible to LAP-mediated infection, in a manner which was independent ofInlA. There was no apparent effect of primary infection onadhesion of any microorganism during secondary infection inshRNA-Hsp60-transfected Caco-2 cells (Fig. 8C).

Similarly, in transepithelial translocation studies, we ob-served an increase in LAP-mediated translocation in control-sh-transfected (Fig. 9A) but not shRNA-Hsp60-transfected(Fig. 9B) Caco-2 cell monolayers following primary L. mono-cytogenes WT infection. Despite differences observed in LAP-mediated translocation in control-sh-transfected Caco-2 cells,the level of translocation during secondary infection in bothCaco-2 cell lines was higher for all microorganisms than thatobserved in earlier primary infection studies. This may be dueto reductions in TEER which resulted from primary WT in-fection (data not shown). The secondary adhesion and trans-epithelial translocation findings emphasize the contribution ofL. monocytogenes-induced host Hsp60 expression to subse-quent LAP-mediated infectivity of L. monocytogenes.

DISCUSSION

Mechanisms mediating interaction of Listeria with the hostintestinal epithelium are critical for establishing a successfulinfection and involve the concerted action of multiple viru-lence factors (23). Our lab previously identified LAP as avirulence factor which promotes adhesion to intestinal epithe-lial cell lines (31) and whose expression is required for fullvirulence in orally infected mice (6, 31). We identified humanHsp60 as the epithelial receptor for LAP (58), but the preciserole of the LAP-Hsp60 interaction in mediating bacterium-epithelial cell interaction was unknown, as was its potential forpromoting extraintestinal translocation of bacteria. Othershave shown that pathogens can target host heat shock proteinsto promote adhesion and invasion (19, 59, 63), and it is alsoknown that stressors, including infection, can induce synthesisof host heat shock proteins (4, 39, 45). However, little infor-mation exists about the influence of the host stress response oninfection by pathogens which recognize heat shock proteins asreceptors. Our objectives were to examine how the LAP-Hsp60interaction influences bacterial adhesion, invasion, and trans-epithelial translocation and to determine whether Listeria in-

FIG. 5. Analysis of transepithelial translocation of L. monocyto-genes through polarized Caco-2 cell monolayers grown on a Transwellfilter insert (see the text for further details). (A) Immunoblot showingLAP and InlA expression in L. monocytogenes WT and �inlA strains.Each lane was loaded with 15 �g of total cell protein. (B) Transepi-thelial translocation of L. monocytogenes WT, lap, lap�, �inlA, andinlA� cells through Caco-2 monolayers following Hsp60 knockdown byshRNA [shRNA Hsp60()] or Hsp60 overexpression (Hsp60�) orthrough control-sh-transfected cells (Caco-2 cells transfected with non-coding shRNA). (C) Translocation of WT, lap, lap�, and �inlA cellsand of �inlA cells pretreated with anti-LAP MAb (1 �g/ml) or an IgGcontrol (MAb C11E9) (1 �g/ml) through control-sh-transfectedCaco-2 monolayers. Data are averages for at least three independenttranslocation experiments performed in quadruplicate (n � 12) andare presented with SEM. Lowercase letters (a to c) indicate significantdifferences (P � 0.05) in translocation of individual bacterial strainsthrough Caco-2 monolayers expressing various levels of Hsp60.



.org/D

ownloaded from

http://iai.asm.org/

fection influences Hsp60 expression or LAP-mediated infec-tion of cultured intestinal epithelial cells.

We confirmed that the interaction of LAP with Hsp60 iscritical for establishing full adhesion, as Caco-2 cells weresignificantly less susceptible to LAP-mediated adhesion follow-ing shRNA-Hsp60 knockdown than parental Caco-2 cell lines.

Similarly, adhesion of WT but not lap bacteria was greaterwhen the cellular level of Hsp60 was increased via constitutiveoverexpression, heat stress, or TNF- exposure. Invasion ofthe WT into Caco-2 cells was inherently greater than that ofthe lap-deficient mutant, which initially suggested that LAPmight also serve as an epithelial invasion factor. However,

FIG. 6. Influence of L. monocytogenes infection on Hsp60 expression in Caco-2 cells. (A) Immunoblot analysis of the level of Hsp60 expressionin Caco-2 plasma membrane (Mem-Hsp60) and intracellular (Int-Hsp60) fractions after exposure to L. monocytogenes (Lm) at 1 � 104, 1 � 106,or 1 � 108 CFU/ml. �-Actin was used as an internal control. Proteins were loaded at 15 �g/well. Blots are representative of at least three individualexperiments. (B) Microscopic analysis of Hsp60 (green) on the surfaces of uninfected or L. monocytogenes-infected (106 CFU/ml [MOI of 10:1]and 108 CFU/ml [MOI of 1,000:1]) Caco-2 cells. Caco-2 cells were labeled with anti-Hsp60 antibody and an FITC-conjugated secondary antibody.Propidium iodide was used to stain dead cells (red). Samples were viewed on a Leica fluorescence microscope with a 40� objective. Bars, 10 �m.(C) Confocal microscopic analysis of intracellular Hsp60 (FITC; green) expression in Caco-2 cells left uninfected (top panels) or infected with 106

CFU/ml L. monocytogenes (bottom panels). The tight junction protein ZO1 was labeled (Cy5; red) for the purpose of visualizing cell borders.Yellow highlighting indicates areas where Hsp60 and ZO-1 are colocalized (right panels). Hsp60 expression was more abundant in L. monocy-togenes-infected cells than in uninfected cells.



.org/D

ownloaded from

http://iai.asm.org/

manipulation of Hsp60 expression had no influence on theinvasive capacity of L. monocytogenes, which indicates that thesole interaction of LAP with Hsp60 is not likely to drive inva-sion of L. monocytogenes. Instead, LAP may promote invasionby interacting with an unknown host receptor, or LAP-medi-ated adhesion may indirectly facilitate invasion by increasingbacterial association with epithelial cells and promoting inter-action of invasion factors such as internalins and Vip with theirreceptors (8, 38, 40, 51).

Using a Transwell cell culture device that enabled measure-ment of bacterial translocation across polarized cell monolay-ers (27), we demonstrated that LAP is involved in promotingtransepithelial translocation through Caco-2 cells, as translo-cation of the WT was greater than that of the lap mutant. Thiswas further confirmed in an Hsp60-suppressed Caco-2 cell linein which WT translocation was significantly impaired but thelap strain showed no effect. Similarly, overexpression of Hsp60led to greater WT but not lap strain translocation.

Our adhesion and translocation findings support our earlierstudies, in which we demonstrated LAP-mediated extraintes-

tinal dissemination of Listeria to the liver and spleen followingoral infection of mice (6, 31). However, the question remainsas to how LAP-Hsp60-mediated transepithelial translocationoccurs, since invasion studies provided no clear role for theLAP-Hsp60 interaction in mediating bacterial entry into intes-tinal epithelial cells. Interestingly, the L. monocytogenes �inlAstrain exhibited greater translocation through Caco-2 mono-layers than the WT. In the absence of inlA, invasion of L.monocytogenes into intestinal epithelial cells is severely re-stricted (40). If the LAP-Hsp60 interaction mediates bacterialtranslocation via a noninvasive route, such as through a para-cellular rather than a transcellular pathway (15, 27), then incomparison to fully invasive WT bacteria, more �inlA bacteriamay be available for LAP-mediated paracellular translocation.This proposed mechanism of a noninvasive route of transloca-tion (Fig. 10) could be tested through creation of a double inlA

FIG. 7. Hsp60 expression in Caco-2 cells following direct versusindirect exposure to Listeria. (A) Immunoblot analysis of Hsp60 levelsin Caco-2 plasma membrane (Mem-Hsp60) and intracellular (Int-Hsp60) fractions following direct or indirect (via separation by a 0.4-�m-pore-size filter) exposure to the L. monocytogenes (Lm) WT, the L.monocytogenes lap strain, or L. innocua at 106 CFU/ml (MOI, 10:1).�-Actin was used as an internal control. Blots are representative ofthree individual experiments. Proteins were loaded at 15 �g/well.Lanes marked with an open box indicate increased Hsp60 expressioncompared to that of controls. (B) Flow cytometric analysis of Hsp60expression on the surfaces of Caco-2 cells following direct or indirectexposure to L. monocytogenes WT or lap strain. Data are averages for3 experiments, with treatments run in quadruplicate (n � 12), and arepresented as fold changes in the number of Caco-2 cells expressingsurface Hsp60 compared to uninfected cells. Data are presented withSEM. Lowercase letters (a and b) represent significant differences(P � 0.05) in surface Hsp60 expression in Caco-2 cells due to directversus indirect bacterial exposure.

FIG. 8. Influence of primary Listeria infection on Caco-2 cellsusceptibility to subsequent (secondary) L. monocytogenes adhe-sion. (A) Secondary adhesion of L. monocytogenes WT to normalCaco-2 cells after primary infection with L. monocytogenes WT or L.innocua compared to that with previously uninfected cells. Data areaverages for at least three independent experiments performed inquadruplicate (n � 12) and are presented with SEM. Lowercase letters(a and b) represent significant differences (P � 0.05) in adhesion ofbacterial strains. (B and C) Adhesion of L. monocytogenes WT, lap,lap�, �inlA, and inlA� strains to control-sh-transfected Caco-2 cells(Caco-2 cells transfected with noncoding shRNA) (B) and to Hsp60knockdown Caco-2 cells (shRNA Hsp60) (C) following primary in-fection with L. monocytogenes WT for 1 h. After primary infection,cells were incubated for 3 h in gentamicin (50 �g/ml)-containing cellculture medium (recovery period) prior to secondary infection for 1 hwith L. monocytogenes. Adhesion data are averages for at least threeindependent experiments performed in quadruplicate (n � 12) and arepresented with SEM. Bars marked with asterisks indicate significantdifferences in secondary bacterial adhesion between previously unin-fected and infected Caco-2 monolayers (P � 0.05). Bars marked withlowercase letters (a to e) represent significant (P � 0.05) differences inLAP-mediated adhesion between bacterial strains.



.org/D

ownloaded from

http://iai.asm.org/

lap mutation in L. monocytogenes and by comparing transloca-tion of the double mutant to that of the WT, �inlA, and lapstrains; however, several attempts to generate this double mu-tant were unsuccessful in our laboratory. Therefore, in lieu ofhaving a lap inlA mutant, we treated the �inlA strain withanti-LAP antibody prior to infection of Caco-2 cells to blockLAP associated with the bacterial surface. Treatment of the�inlA strain with anti-LAP, but not with an IgG control anti-body, significantly reduced its translocation in comparison tothat of the �inlA strain alone. While antibody treatment re-duced �inlA strain translocation, the levels were not as low asthose for the L. monocytogenes lap strain, most likely due toLAP secretion by the �inlA strain after antibody treatment.Our data provide strong evidence that LAP may mediate trans-location via a noninvasive mechanism, such as through a para-cellular pathway, whose molecular mechanism is currently un-der investigation in our lab.

L. monocytogenes infection is known to reduce the TEER ofepithelial monolayers (33), as also observed in this study (Ta-ble 2), which can contribute to paracellular bacterial translo-cation (15, 27). Although the exact mechanism for a Listeria-induced reduction in TEER is unknown, it has been linked tovirulence traits such as actin cytoskeleton disruption followinginvasion (26, 52, 60), as well as extracellular secretion of LLO(50). Although the presence or absence of LAP expression didnot induce changes in TEER (Table 2), it is possible that aweakened epithelial barrier facilitates LAP-Hsp60-mediatedbacterial translocation.

The finding that LAP-mediated translocation was greater inthe �inlA strain was unexpected, given previous findings thatL. monocytogenes �inlA strains are attenuated for systemicinfection following oral administration in animals expressingan InlA-specific E-cadherin (35, 37). It is possible that LAP-

Hsp60-mediated translocation contributes to differences in sys-temic infection observed in vivo between WT and lap strains (6,31). However, the fact that �inlA bacteria translocate more butinvade less in vitro yet cause less systemic infection followingoral administration in vivo (37) draws into question the relativeimportance of epithelial cell invasion versus transepithelialtranslocation during in vivo infection by L. monocytogenes.Certainly, the ability of L. monocytogenes to cross the intestinalepithelial barrier is a complex process involving multiple viru-lence factors. The importance of InlA-mediated intestinal ep-ithelial invasion during in vivo Listeria infection has been dem-onstrated clearly (35, 37). Although L. monocytogenes haspreviously been shown to translocate across epithelial mono-layers in vitro (12), our findings of LAP-Hsp60-mediated trans-location are the first evidence that listerial translocation isdriven by a specific bacterium-host interaction. If transepithe-lial translocation of L. monocytogenes leads to submucosalphagocytosis, as it does for pathogens such as Campylobacterand Shigella (34, 53), then it could potentiate systemic spreadof L. monocytogenes due to the pathogen’s ability to survivecomplete destruction within phagocytes (18). However, in lightof our findings that the �inlA strain translocates more in vitro,although it is deficient for systemic infection in vivo (37), morestudies are needed to determine the specific role of LAP-mediated transepithelial translocation during systemic infec-tion by L. monocytogenes.

The use of human Hsp60 as a receptor for LAP is intriguinggiven recent findings that infection by bacterial and viral patho-gens can induce Hsp expression in host cells. Belles et al. (4)demonstrated that L. monocytogenes intravenous infection ofmice increased plasma membrane expression of Hsp60 inspleen and liver lymphocytes. Infections by Salmonella entericaserovar Enteritidis (39) and dengue virus (45) also increasedexpression of host Hsps in cultured cells. Here we showed thatinfection with moderate doses (104 to 106 CFU/ml) of L.monocytogenes increased intracellular and surface expressionof Hsp60 in Caco-2 monolayers. The Hsp60 response requireddirect exposure to L. monocytogenes and was not induced by

FIG. 10. Proposed model of LAP-mediated paracellular transloca-tion in Caco-2 intestinal epithelial monolayers, which occurs indepen-dently of InlA-mediated invasion of L. monocytogenes. (A) In WT L.monocytogenes, the interaction of InlA with the epithelial receptorE-cadherin promotes invasion of Caco-2 cells, while interaction ofLAP with the epithelial receptor Hsp60 mediates paracellular trans-epithelial translocation. (B) In an L. monocytogenes �inlA strain, theabsence of InlA-specific E-cadherin interaction facilitates greater in-teraction of LAP-Hsp60 and promotes increased paracellular bacterialtranslocation through Caco-2 monolayers.

FIG. 9. Influence of Listeria-induced Hsp60 expression on sub-sequent LAP-mediated translocation through Caco-2 monolayers.Translocation of L. monocytogenes WT, lap, lap�, �inlA, and inlA�

strains is shown for control-sh-transfected cells (Caco-2 cells trans-fected with noncoding shRNA) (A) and shRNA-Hsp60-transfectedCaco-2 cells (B) following primary infection with L. monocytogenesWT. Caco-2 cell preparation and treatment were the same as thosedescribed in the legend to Fig. 7, except that the translocation assayduring secondary infection was performed for 2 h. Translocation assayswere repeated at least three times in quadruplicate wells (n � 12), anddata are presented with SEM. Bars marked with asterisks indicatesignificant differences in secondary bacterial adhesion between previ-ously uninfected and infected Caco-2 monolayers (P � 0.05), whilebars marked with lowercase letters (a to c) represent significant (P �0.05) differences in LAP-mediated adhesion between bacterial strains.



.org/D

ownloaded from

http://iai.asm.org/

nonpathogenic L. innocua (Fig. 8A). The infection-inducedHsp60 response may be dependent upon pathogen contact orinvasion, although it is independent of LAP expression. SinceHsp60 serves as a LAP receptor, we conducted studies to testwhether infection-induced Hsp60 expression would affect cel-lular susceptibility to subsequent LAP-mediated infection. Weobserved an important role for infection-induced Hsp60 ex-pression in promoting Listeria infection, as both LAP-medi-ated adhesion and translocation were greater in Caco-2 cellsalready subjected to primary infection than in previouslyuninfected cells. This phenomenon was observed only inparental (control-sh) Caco-2 cells, not in Hsp60-suppressedCaco-2 cells, which confirmed the role of Listeria-inducedHsp60 expression in mediating greater susceptibility to LAP-mediated infection.

The finding that Listeria-induced Hsp60 expression leads togreater LAP-mediated infectivity provides evidence of a host-pathogen interplay during infection. Expression of heat shockproteins during infection may protect cellular constituentsagainst damage resulting from pathogen virulence mechanismsand host defenses (42, 43). Surface-expressed Hsp60 may alsopromote the host immune response by serving as a warningsignal (48, 57) and by binding pathogen-associated molecularpatterns (PAMPs) to modulate PAMP-induced Toll-like re-ceptor (TLR) signaling (44). However, certain pathogens canuse host chaperones to promote infection: S. aureus binds toHsp60 to promote invasion of epithelial cells (19), Brucellaabortus uses Hsp70 to mediate invasion of trophoblasts (59),and expression of Hsp60 by macrophages is critical for denguevirus infection and intracellular replication (45). We demon-strated that Listeria infection induces Hsp60 expression in hostcells, which facilitates greater LAP-mediated adhesion andtranslocation. The role of Hsp60 expression in the broadercontext of in vivo L. monocytogenes infection is still unknown.However, these studies provide evidence that initial infectionof intestinal epithelial cells initiates a host stress response,which promotes LAP-mediated L. monocytogenes infection.These findings pose relevant questions as to how the host heatshock response may affect the outcome of infection by otherpathogens which target chaperones as receptors.

ACKNOWLEDGMENTS

We sincerely thank Krishna Mishra for assistance with molecularcloning. We are also grateful to Jennie Sturgis and Gregory Richter foraid with confocal microscopy, to Cathy Ragheb and Cheryl Holdmanfor assistance with flow cytometry, and to R. Vemulapalli, D. Zhou, B.Applegate, and J. P. Robinson for critical evaluations of the study andfor helpful discussions.

Part of this research was supported by Purdue Faculty Scholar Fund-ing, a Bilsland Fellowship, and the U.S. Department of Agriculture(project number 1935-42000-035).

REFERENCES

1. Alvarez-Dominguez, C., J. A. Vazquez-Boland, E. Carrasco-Marin, P. Lopez-Mato, and F. Leyva-Cobian. 1997. Host cell heparan sulfate proteoglycansmediate attachment and entry of Listeria monocytogenes, and the listerialsurface protein ActA is involved in heparan sulfate receptor recognition.Infect. Immun. 65:78–88.

2. Bansal, T., R. C. Alaniz, T. K. Wood, and A. Jayaraman. 2010. The bacterialsignal indole increases epithelial-cell tight-junction resistance and attenuatesindicators of inflammation. Proc. Natl. Acad. Sci. U. S. A. 107:228–233.

3. Barbour, A. H., A. Rampling, and C. E. Hormaeche. 2001. Variation in theinfectivity of Listeria monocytogenes isolates following intragastric inocula-tion of mice. Infect. Immun. 69:4657–4660.

4. Belles, C., A. Kuhl, R. Nosheny, and S. R. Carding. 1999. Plasma membraneexpression of heat shock protein 60 in vivo in response to infection. Infect.Immun. 67:4191–4200.

5. Bocharov, A. V., T. G. Vishnyakova, I. N. Baranova, A. T. Remaley, A. P.Patterson, and T. L. Eggerman. 2000. Heat shock protein 60 is a high-affinityhigh-density lipoprotein binding protein. Biochem. Biophys. Res. Commun.277:228–235.

6. Burkholder, K. M., K. P. Kim, K. K. Mishra, S. Medina, B. K. Hahm, H.Kim, and A. K. Bhunia. 2009. Expression of LAP, a SecA2-dependentsecretory protein, is induced under anaerobic environment. Microbes Infect.11:859–867.

7. Cabanes, D., O. Dussurget, P. Dehoux, and P. Cossart. 2004. Auto, a surfaceassociated autolysin of Listeria monocytogenes required for entry into eu-karyotic cells and virulence. Mol. Microbiol. 51:1601–1614.

8. Cabanes, D., S. Sousa, A. Cebria, M. Lecuit, F. Garcia-del Portillo, and P.Cossart. 2005. Gp96 is a receptor for a novel Listeria monocytogenes viru-lence factor, Vip, a surface protein. EMBO J. 24:2827–2838.

9. Cabiscol, E., G. Belli, J. Tamarit, P. Echave, E. Herrero, and J. Ros. 2002.Mitochondrial Hsp60, resistance to oxidative stress, and the labile iron poolare closely connected in Saccharomyces cerevisiae. J. Biol. Chem. 277:44531–44538.

10. Camilli, A., L. G. Tilney, and D. A. Portnoy. 1993. Dual roles of plcA inListeria monocytogenes pathogenesis. Mol. Microbiol. 8:143–157.

11. Chakraborty, T., M. Leimeister-Wachter, E. Domann, M. Hartl, W. Goebel,T. Nichterlein, and S. Notermans. 1992. Coordinate regulation of virulencegenes in Listeria monocytogenes requires the product of the prfA gene. J.Bacteriol. 174:568–574.

12. Corr, S., C. Hill, and C. G. Gahan. 2006. An in vitro cell-culture modeldemonstrates internalin- and hemolysin-independent translocation of Liste-ria monocytogenes across M cells. Microb. Pathog. 41:241–250.

13. Corydon, T. J., J. Hansen, P. Bross, and T. G. Jensen. 2005. Down-regula-tion of Hsp60 expression by RNAi impairs folding of medium-chain acyl-CoA dehydrogenase wild-type and disease-associated proteins. Mol. Genet.Metab. 85:260–270.

14. Cossart, P., J. Pizarro-Cerda, and M. Lecuit. 2003. Invasion of mammaliancells by Listeria monocytogenes: functional mimicry to subvert cellular func-tions. Trends Cell Biol. 13:23–31.

15. Cruz, N., L. Qi, X. Alvarez, R. D. Berg, and E. A. Deitch. 1994. The Caco-2cell monolayer system as an in vitro model for studying bacterial-enterocyteinteractions and bacterial translocation. J. Burn Care Rehabil. 15:207–212.

16. Czuprynski, C. J., N. G. Faith, and H. Steinberg. 2003. A/J mice are sus-ceptible and C57BL/6 mice are resistant to Listeria monocytogenes infectionby intragastric inoculation. Infect. Immun. 71:682–689.

17. Dramsi, S., F. Bourdichon, D. Cabanes, M. Lecuit, H. Fsihi, and P. Cossart.2004. FbpA, a novel multifunctional Listeria monocytogenes virulence factor.Mol. Microbiol. 53:639–649.

18. Drevets, D. A. 1999. Dissemination of Listeria monocytogenes by infectedphagocytes. Infect. Immun. 67:3512–3517.

19. Dziewanowska, K., A. R. Carson, J. M. Patti, C. F. Deobald, K. W. Bayles,and G. A. Bohach. 2000. Staphylococcal fibronectin binding protein interactswith heat shock protein 60 and integrins: role in internalization by epithelialcells. Infect. Immun. 68:6321–6328.

20. Ferm, M. T., K. Soderstrom, S. Jindal, A. Gronberg, J. Ivanyi, R. Young, andR. Kiessling. 1992. Induction of human Hsp60 expression in monocyticcell-lines. Int. Immunol. 4:305–311.

21. Freitag, N. E., G. C. Port, and M. D. Miner. 2009. Listeria monocytogenes—from saprophyte to intracellular pathogen. Nat. Rev. Microbiol. 7:623–628.

22. Fujimoto, S., and Y. Ike. 2001. pAM401-based shuttle vectors that enableoverexpression of promoterless genes and one-step purification of tag fusionproteins directly from Enterococcus faecalis. Appl. Environ. Microbiol. 67:1262–1267.

23. Gahan, C. G., and C. Hill. 2005. Gastrointestinal phase of Listeria monocy-togenes infection. J. Appl. Microbiol. 98:1345–1353.

24. Gaillard, J. L., and B. B. Finlay. 1996. Effect of cell polarization and differ-entiation on entry of Listeria monocytogenes into the enterocyte-like Caco-2cell line. Infect. Immun. 64:1299–1308.

25. Ghosh, J. C., T. Dohi, B. H. Kang, and D. C. Altieri. 2008. Hsp60 regulationof tumor cell apoptosis. J. Biol. Chem. 283:5188–5194.

26. Hanajima-Ozawa, M., T. Matsuzawa, A. Fukui, S. Kamitani, H. Ohnishi, A.Abe, Y. Horiguchi, and M. Miyake. 2007. Enteropathogenic Escherichia coli,Shigella flexneri, and Listeria monocytogenes recruit a junctional protein,zonula occludens-1, to actin tails and pedestals. Infect. Immun. 75:565–573.

27. Hidalgo, I. J., T. J. Raub, and R. T. Borchardt. 1989. Characterization of thehuman colon carcinoma cell line (Caco-2) as a model system for intestinalepithelial permeability. Gastroenterology 96:736–749.

28. Itoh, H., A. Komatsuda, H. Ohtani, I. H. Waku, H. Imai, K. Sawada, M.Otaka, M. Ogura, A. Suzuki, and F. Hamada. 2002. Mammalian Hsp60 isquickly sorted into the mitochondria under conditions of dehydration. Eur.J. Biochem. 269:5931–5938.

29. Jagadeesan, B., O.-K. Koo, K.-P. Kim, K. M. Burkholder, K. K. Mishra, A.Aroonnual, and A. K. Bhunia. 2010. LAP, an alcohol acetaldehyde dehydro-



.org/D

ownloaded from

http://iai.asm.org/

genase enzyme in Listeria promotes bacterial adhesion to enterocyte-likeCaco-2 cells only in pathogenic species. Microbiology 156:2782–2795.

30. Jaradat, Z. W., and A. K. Bhunia. 2003. Adhesion, invasion, and transloca-tion characteristics of Listeria monocytogenes serotypes in Caco-2 cell andmouse models. Appl. Environ. Microbiol. 69:3640–3645.

31. Jaradat, Z. W., J. W. Wampler, and A. W. Bhunia. 2003. A Listeria adhesionprotein-deficient Listeria monocytogenes strain shows reduced adhesion pri-marily to intestinal cell lines. Med. Microbiol. Immunol. 192:85–91.

32. Kim, K. P., B. Jagadeesan, K. M. Burkholder, Z. W. Jaradat, J. L. Wampler,A. A. Lathrop, M. T. Morgan, and A. K. Bhunia. 2006. Adhesion character-istics of Listeria adhesion protein (LAP)-expressing Escherichia coli toCaco-2 cells and of recombinant LAP to eukaryotic receptor Hsp60 asexamined in a surface plasmon resonance sensor. FEMS Microbiol. Lett.256:324–332.

33. Klingberg, T. D., M. H. Pedersen, A. Cencic, and B. B. Budde. 2005. Appli-cation of measurements of transepithelial electrical resistance of intestinalepithelial cell monolayers to evaluate probiotic activity. Appl. Environ. Mi-crobiol. 71:7528–7530.

34. Konkel, M., M. Monteville, V. Rivera-Amill, and L. Joens. 2001. The patho-genesis of Campylobacter jejuni-mediated enteritis. Curr. Issues Intest. Mi-crobiol. 2:55–71.

35. Lecuit, M. 2007. Human listeriosis and animal models. Microbes Infect.9:1216–1225.

36. Lecuit, M., S. Dramsi, C. Gottardi, M. Fedor-Chaiken, B. Gumbiner, and P.Cossart. 1999. A single amino acid in E-cadherin responsible for host spec-ificity towards the human pathogen Listeria monocytogenes. EMBO J. 18:3956–3963.

37. Lecuit, M., S. Vandormael-Pournin, J. Lefort, M. Huerre, P. Gounon, C.Dupuy, C. Babinet, and P. Cossart. 2001. A transgenic model for listeriosis:role of internalin in crossing the intestinal barrier. Science 292:1722–1725.

38. Linden, S. K., H. Bierne, C. Sabet, C. W. Png, T. H. Florin, M. A. McGuckin,and P. Cossart. 2008. Listeria monocytogenes internalins bind to the humanintestinal mucin MUC2. Arch. Microbiol. 190:101–104.

39. Malago, J. J., J. F. Koninkx, H. H. Ovelgonne, F. J. van Asten, J. F. Swen-nenhuis, and J. E. van Dijk. 2003. Expression levels of heat shock proteinsin enterocyte-like Caco-2 cells after exposure to Salmonella enteritidis. CellStress Chaperones 8:194–203.

40. Mengaud, J., H. Ohayon, P. Gounon, R. M. Mege, and P. Cossart. 1996.E-cadherin is the receptor for internalin, a surface protein required for entryof L. monocytogenes into epithelial cells. Cell 84:923–932.

41. Milohanic, E., R. Jonquieres, P. Cossart, P. Berche, and J. L. Gaillard. 2001.The autolysin Ami contributes to the adhesion of Listeria monocytogenes toeukaryotic cells via its cell wall anchor. Mol. Microbiol. 39:1212–1224.

42. Mohri-Shiomi, A., and D. A. Garsin. 2008. Insulin signaling and the heatshock response modulate protein homeostasis in the Caenorhabditis elegansintestine during infection. J. Biol. Chem. 283:194–201.

43. Multhoff, G., and L. E. Hightower. 1996. Cell surface expression of heatshock proteins and the immune response. Cell Stress Chaperones 1:167–176.

44. Osterloh, A., and M. Breloer. 2008. Heat shock proteins: linking danger andpathogen recognition. Med. Microbiol. Immunol. 197:1–8.

45. Padwad, Y. S., K. P. Mishra, M. Jain, S. Chanda, D. Karan, and L. Ganju.2009. RNA interference mediated silencing of Hsp60 gene in human mono-cytic myeloma cell line U937 revealed decreased dengue virus multiplication.Immunobiology 214:422–429.

46. Pandiripally, V. K., D. G. Westbrook, G. R. Sunki, and A. K. Bhunia. 1999.Surface protein p104 is involved in adhesion of Listeria monocytogenes tohuman intestinal cell line, Caco-2. J. Med. Microbiol. 48:117–124.

47. Pizarro-Cerda, J., M. Lecuit, and P. Cossart. 2002. Measuring and analysing

invasion of mammalian cells by bacterial pathogens: the Listeria monocyto-genes system. Methods Microbiol. 31:161–177.

48. Ranford, J. C., and B. Henderson. 2002. Chaperonins in disease: mecha-nisms, models, and treatments. Mol. Pathol. 55:209–213.

49. Reis, O., S. Sousa, A. Camejo, V. R. Villiers, E. Gouin, P. Cossart, and D.Cabanes. 2010. LapB, a novel Listeria monocytogenes LPXTG surface adhe-sin, required for entry into eukaryotic cells and virulence. J. Infect. Dis.202:551–562.

50. Richter, J. F., A. H. Gitter, D. Gunzel, S. Weiss, W. Mohamed, T.Chakraborty, M. Fromm, and J. D. Schulzke. 2009. Listeriolysin O affectsbarrier function and induces chloride secretion in HT-29/B6 colon epithelialcells. Am. J. Physiol. Gastrointest. Liver Physiol. 296:G1350–G1359.

51. Sabet, C., A. Toledo-Arana, N. Personnic, M. Lecuit, S. Dubrac, O. Poupel,E. Gouin, M. A. Nahori, P. Cossart, and H. Bierne. 2008. The Listeriamonocytogenes virulence factor InlJ is specifically expressed in vivo andbehaves as an adhesin. Infect. Immun. 76:1368–1378.

52. Sambruy, Y., S. Ferruzza, G. Ranaldi, and I. De Angelis. 2001. Intestinal cellculture models: applications in toxicology and pharmacology. Cell Biol. Toxi-col. 17:301–317.

53. Schroeder, G. N., and H. Hilbi. 2008. Molecular pathogenesis of Shigellaspp.: controlling host cell signaling, invasion, and death by type III secretion.Clin. Microbiol. Rev. 21:134–156.

54. Schubert, W. D., C. Urbanke, T. Ziehm, V. Beier, M. P. Machner, E.Domann, J. Wehland, T. Chakraborty, and D. W. Heinz. 2002. Structure ofinternalin, a major invasion protein of Listeria monocytogenes, in complexwith its human receptor E-cadherin. Cell 111:825–836.

55. Soltys, B. J., and R. S. Gupta. 1997. Cell surface localization of the 60 kDaheat shock chaperonin protein (hsp60) in mammalian cells. Cell Biol. Int.21:315–320.

56. Vazquez-Boland, J. A., M. Kuhn, P. Berche, T. Chakraborty, G. Dominguez-Bernal, W. Goebel, B. Gonzalez-Zorn, J. Wehland, and J. Kreft. 2001. Lis-teria pathogenesis and molecular virulence determinants. Clin. Microbiol.Rev. 14:584–640.

57. Wallin, R. P., A. Lundqvist, S. H. More, A. von Bonin, R. Kiessling, andH. G. Ljunggren. 2002. Heat-shock proteins as activators of the innateimmune system. Trends Immunol. 23:130–135.

58. Wampler, J. L., K. P. Kim, Z. Jaradat, and A. K. Bhunia. 2004. Heat shockprotein 60 acts as a receptor for the Listeria adhesion protein in Caco-2 cells.Infect. Immun. 72:931–936.

59. Watanabe, K., M. Tachibana, S. Tanaka, H. Furuoka, M. Horiuchi, H.Suzuki, and M. Watarai. 2008. Heat shock cognate protein 70 contributes toBrucella invasion into trophoblast giant cells that cause infectious abortion.BMC Microbiol. 8:212.

60. Wells, C. L., E. M. A. van de Westerlo, R. P. Jechorek, H. M. Haines, andS. L. Erlandsen. 1998. Cytochalasin-induced actin disruption of polarizedenterocytes can augment internalization of bacteria. Infect. Immun. 66:2410–2419.

61. Xayarath, B., H. Marquis, G. C. Port, and N. E. Freitag. 2009. Listeriamonocytogenes CtaP is a multifunctional cysteine transport-associated pro-tein required for bacterial pathogenesis. Mol. Microbiol. 74:956–973.

62. Young, R. A. 1990. Stress proteins and immunology. Annu. Rev. Immunol.8:401–420.

63. Zhang, S. M., D. C. Sun, S. Lou, X. C. Bo, Z. Lu, X. H. Qian, and S. Q. Wang.2005. HBx protein of hepatitis B virus (HBV) can form complex with mito-chondrial Hsp60 and Hsp70. Arch. Virol. 150:1579–1590.

64. Zhou, J., H. An, H. Xu, S. Liu, and X. Cao. 2005. Heat shock up-regulatesexpression of Toll-like receptor-2 and Toll-like receptor-4 in human mono-cytes via p38 kinase signal pathway. Immunology 114:522–530.

Editor: J. B. Bliska



.org/D

ownloaded from

http://iai.asm.org/

Documents

Listeria monocytogenes Uses Listeria Adhesion …Listeria monocytogenes Uses Listeria Adhesion Protein (LAP) To Promote Bacterial Transepithelial Translocation and Induces Expression