Life Science

Available online at www.sciencedirect.com

7) 1575–1584www.elsevier.com/locate/lifescie

Life Sciences 81 (200

The involvement of secondary signaling molecules in cytochromeP-450 1A1-mediated inducible nitric oxide synthase expressionin benzo(a)pyrene-treated rat polymorphonuclear leukocytes

Abhai Kumar a, Ghanshyam Upadhyay a, Dinesh Raj Modi b, Mahendra Pratap Singh a,⁎

a Environmental Biotechnology Division, Industrial Toxicology Research Centre (ITRC), Lucknow-226 001, Indiab Department of Biotechnology, Deen Dayal Upadhyay Gorakhpur University, Gorakhpur-273 001, India

Received 7 May 2007; accepted 18 September 2007

Abstract

Benzo(a)pyrene induces cytochrome P-450 1A1 (CYP1A1) expression in rat polymorphonuclear leukocytes (PMNs) that upregulatesexpression of inducible nitric oxide synthase (iNOS). In the present study, the involvement of secondary signaling molecules in CYP1A1-mediated augmentation of iNOS expression in benzo(a)pyrene-treated rat PMNs was investigated. PMNs were isolated from the peripheral bloodof controls and benzo(a)pyrene-treated rats. The expression and/or activity of CYP1A1, iNOS, tumor necrosis factor-alpha (TNF-α), interleukin-1beta (IL-1β), and intracellular calcium ([Ca2+]i) concentrations were measured in control and benzo(a)pyrene-treated rat PMNs with and withoutalpha-naphthoflavone, aminoguanidine, genistein, pyrrolidine dithiocarbamate (PDTC), felodipine, or SB202190 pre-treatment. A significantelevation in CYP1A1 and [Ca2+]i was observed in benzo(a)pyrene-treated rat PMNs, which was significantly restored by alpha-naphthoflavone orgenistein. Neither PDTC, SB202190, nor aminoguanidine altered the benzo(a)pyrene-mediated increase in [Ca2+]i. Although felodipine reducedthe benzo(a)pyrene-mediated increase in [Ca2+]i, no significant change was observed in CYP1A1 expression and activity. Benzo(a)pyrene-augmented iNOS expression and activity in PMNs were significantly reverse by felodipine, genistein, or PDTC. Benzo(a)pyrene also inducedTNF-α and IL-1β production in PMNs, which was significantly reversed by genistein. The results demonstrated the involvement of [Ca2+]i,tyrosine kinase, inflammatory cytokines, and NF-κB in CYP1A1-mediated iNOS expression in benzo(a)pyrene-treated rat PMNs.© 2007 Elsevier Inc. All rights reserved.

Keywords: Benzo(a)pyrene; Polymorphonuclear leukocytes; Nitric oxide synthase; Cytochrome P-450 1A1; Intracellular calcium; Signaling molecules

Introduction

Cytochrome P-4501A1 (CYP1A1) is involved in benzo(a)pyrene metabolism and regulates the intracellular calcium ([Ca2+]i)concentration (Tannheimer et al., 1999). DNA reactive metabolitesof benzo(a)pyrene potentially alter cell signaling and calciumhomeostasis in lymphoid and non-lymphoid cells (Tannheimer et al.,1997; Burchiel and Luster, 2001; Davila et al., 1995; Mounho et al.,1997;Zhao et al., 1996).Dependingon the physiological conditions,

⁎ Corresponding author. Industrial Toxicology Research Centre (ITRC),Mahatma Gandhi Marg, Post Box-80, Lucknow-226 001, UP, India. Tel.: +91522 2627586/2620107x337; fax: +91 522 2628227.

E-mail address: [email protected] (M.P. Singh).

0024-3205/$ - see front matter © 2007 Elsevier Inc. All rights reserved.doi:10.1016/j.lfs.2007.09.032

secondary signaling molecules can activate Src-like proteintyrosines and/or inositol triphosphate-dependent activation ofphospholipase C-gamma, as well as regulate [Ca2+]i (Tannheimeret al., 1997; Mounho and Burchiel, 1998). Polycyclic aromatichydrocarbons (PAHs)mediate elevation in [Ca2+]i and induce tumorformation and progression (Tannheimer et al., 1997; Berridge,2001).

Polymorphonuclear leukocytes (PMNs) generate superoxideanions in various pathological conditions and during inflamma-tion (Babior et al., 1973; Segal and Abo, 1993). The [Ca2+]itriggers degranulation and myeloperoxidase (MPO) secretion inPMNs, leading to the generation of hypochlorous acid (Arnhold,2004). Hypochlorous acid reacts with superoxide and converts itinto more reactive oxygen and nitrogen species, which have highpotential for cellular toxicity (Winterbourn, 1985; Arnhold et al.,1993). The elevation of [Ca2+]i regulates the expression of

mailto:[email protected]

http://dx.doi.org/10.1016/j.lfs.2007.09.032

1576 A. Kumar et al. / Life Sciences 81 (2007) 1575–1584

inducible nitric oxide synthase (iNOS) and thus, of nitric oxide(NO) production (Tfelt-Hansen et al., 2005). There are severalsecondary signalingmolecules, including tyrosine kinase, nuclearfactor-kappa B (NF-κB), and p38 mitogen-activated proteinkinase (MAPK) that activate iNOS by regulating [Ca2+]i(Poljakovic et al., 2003; Nakashima et al., 1999; Ganster et al.,2001; Marlowe and Puga, 2005). A CYP1A1 inhibitor (alpha-naphthoflavone), iNOS inhibitor (aminoguanidine), tyrosinekinase inhibitor (genistein), NF-κB inhibitor (pyrrolidine dithio-carbamate, PDTC), p38 MAPK inhibitor (SB202190) andcalcium channel blocker (felodipine), have all been used toelucidate the involvement of these signaling molecules in theregulation of [Ca2+]i and activation of iNOS (Kumar et al., 2006;Ziolo et al., 2001; Mene et al., 1999; Delescluse et al., 2000;Nakayama et al., 2006; Feinstein et al., 1994; Comalada et al.,2006; Stefano et al., 2006; Choi and Lee, 2004; Li et al., 2003;Katz et al., 2006). Although the involvement of secondarysignaling molecules in benzo(a)pyrene-mediated carcinogenesisis reported in esophageal cells (Chen et al., 2005), due to theirvariable origins, functions, responses to endogenous and exoge-nous toxicants, structural stabilities, and life spans of PMNs, it isstill worthwhile to examine the involvement of secondary medi-ators in CYP1A1-mediated iNOS expression in PMNs. Themechanism of benzo(a)pyrene-induced toxicity in PMNs mayhelp to better understand the mechanism of toxicity and carci-nogenesis in those organs that are not directly exposed to benzo(a)pyrene or PAHs. Secondly, the data obtained from blood/bloodcells in animals may be extrapolated and validated directly inhuman beings, which is not possible with esophageal cells or anyother cells obtained by using more invasive tools.

Although CYP1A1 augments iNOS expression in benzo(a)pyrene-treated rat PMNs, which leads to the production of nitricoxide and thereby cellular toxicity (Kumar et al., 2006), it is stillnot clear which signaling molecule(s) participate in CYP1A1-mediated iNOS expression in benzo(a)pyrene-treated rat PMNs.The present investigation was undertaken to examine the in-volvement of secondary signaling molecules and also to eluci-date the mechanism of CYP1A1-mediated iNOS expression inbenzo(a)pyrene-treated rat PMNs.

Materials and methods

Materials

The following chemicals were procured from Sigma Aldrich,USA: alpha-naphthoflavone, aminoguanidine, benzo(a)pyrene,bovine serum albumin (BSA), calcium chloride, dextran-500,dimethyl sulfoxide (DMSO), disodium hydrogen orthophosphate,ethylene glycol tetraacetic acid (EGTA), Fura-2 AM, genistein,glucose, glucose-6-phosphate, histopaque 1119-1/1077-1, magne-sium chloride, methanol, nicotinamide adenine dinucleotidephosphate reduced form (NADP) tetrasodium salt, N-napthylethylenediamine, phosphoric acid, pyrrolidine dithiocarbamate(PDTC), potassium chloride, resorufin ethyl ether (ERF),SB202190, sodium dihydrogen orthophosphate, sodium nitrite,sulphanilamide, and Triton X-100. cDNA synthesis kits wereobtained from MBI Fermentas and TNF-α and IL-1β ELISA kits

were procured from Pierce Biotechnology Incorporation, USA.Deoxy nucleotide triphosphates (dNTP), magnesium chloride, Taqbuffer, Taq DNA polymerase, forward and reverse primers, andother chemicals were purchased locally fromBanglore Genei, India.

Animal treatment

Male Wistar rats (130–150 g) were obtained from an animalcolony at Industrial ToxicologyResearchCentre (ITRC), Lucknow.The animals were kept in the animal house under standardconditions (temperature 22 °C±2 °C; humidity 45%–55%; lightintensity 300–400 lx). The experimental animals were treatedintraperitoneally with benzo(a)pyrene (50 mg/kg body weight in50 μl of 0.1%DMSO) twice a week for 2 weeks. Controls/vehicleswere treated similarly with 0.1% DMSO (50 μl). The institutionalethics committee for the use of laboratory animals approved thestudy.

Isolation of PMNs

Blood was collected from controls and benzo(a)pyrene-treatedrats 48 h after the last injection through cardiac puncture under etheranesthesia using trisodium citrate as an anti-coagulant (0.129 M,pH 6.5, 9:1 v/v). The PMNs were isolated from the whole bloodusing a standard procedure (Kumar et al., 2006; Sethi et al., 1999;Boyum, 1968). In brief, PMNs were isolated from the buffy coatafter mild centrifugation and dextran sedimentation and furtherpurified with histopaque density gradient centrifugation (Kumaret al., 2006; Sethi et al., 1999; Boyum, 1968). The pure PMNswererecovered at the interface of histopaque 1077-1/1119-1 and washedthrice with Hank's balanced salt solution (HBSS: 138 mM sodiumchloride, 2.7 mM potassium chloride, 8.1 mM disodium hydrogenphosphate, and 1.5 mM potassium dihydrogen phosphate) contain-ing 0.6 mM magnesium chloride, 1.0 mM calcium chloride, and10 mM glucose at pH 7.4. The viability of the PMNs was tested bythe trypan blue exclusion test and was never less than 95%.

Treatment of PMNs with various inhibitors

The PMNs (1×107 cells/ml) were treated with variouspharmacological agents (i.e. alpha-naphthoflavone (4 μM),aminoguanidine (5 mM), genistein (50 μM), PDTC (50 μM),SB202190 (20 μM), PD98059 (30 μM), or felodipine (0.5 mM)),incubated for 1 h at 37 °C, washed twice with HBSS, and used forfurther experiments (Poljakovic et al., 2003; Katz et al., 2006;Sethi et al., 1999). The viability of the PMNs was tested aftertreatment with these pharmacological agents and no significantalterationwas observed. PMNswere also activated with lipopoly-saccharide (LPS) in some experiments as a positive control.

Reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was isolated from the PMNs of rats using TRIreagent BD, and reverse transcription was carried out for 1 h at42 °C in the presence of oligo-dTand Revert Aid™Hminus MulV-reverse transcriptase, according to the manufacturer's instruc-tions. Forward and reverse primers for CYP1A1, iNOS, TNF-α,

1577A. Kumar et al. / Life Sciences 81 (2007) 1575–1584

IL-1β, and β-actin were synthesized as described elsewhere(Garcon et al., 2004; Saini et al., 2006; Nastevska et al., 1999;Yang et al., 1999). In brief, the primers used to amplify 341, 314,295, 675, and 155 bp fragments specific for CYP1A1, iNOS,TNF-α, IL-1β, and β-actin, respectively, were 5′CCATGAC-CAGGACTATGGG3′ (forward), 5′TCTGGTGAGCATCCAG-GACA3′ (reverse) (GeneBank Accession No. K02246); 5′GGACCACCTCTATCAGGAA3′ (forward), 5′CCTCATGA-TAACGTTTCTGGC3′ (reverse) (GeneBank Accession No.X76881); 5′TACTGAACTTCGGGGTGATTGGTCC3′ (for-ward), 5′CAGCCTTGTCCCTTGAAGAGAACC3′ (reverse)(GeneBank Accession No. L00981); 5′GTGTCTGAAGCAG-CTATGGC3′ (forward), 5′ATCTTGTTGAAGACAAAC-CGCTT3′ (reverse) (GeneBank Accession No. M98820) and 5′CCTCTATGCCAACACAGT3′ (forward), 5′AGCCACCAAT-CCACACAG3′ (reverse) (GeneBank Accession No. V01217).The amplification procedure was as follows: 30 cycles ofdenaturation, annealing and elongation at 94 °C for 1 min,57 °C for 1 min, and 72 °C for 2 min for CYP1A1 (Garcon et al.,2004); 30 cycles of denaturation, annealing and elongation at95 °C for 1 min, 60 °C for 1 min, and 72 °C for 3 min, respectively,for iNOS (Saini et al., 2006); 35 cycles of denaturation, annealingand elongation at 94 °C for 45 s, 60 °C for 45 s, and 72 °C for 2min,respectively, for TNF-α (Nastevska et al., 1999); and 45 cycles ofdenaturation, annealing and elongation at 94 °C for 30 s, 52 °C for30 s, and 72 °C for 30 s, respectively, for IL-1β (Yang et al., 1999).β-actin amplification was performed concurrently with CYP1A1,iNOS, TNF-α, or IL-1β. PCR products were visualized on 2%agarose gel containing 1 μg/ml ethidium bromide under UVtransilluminator. The band density of CYP1A1, iNOS, TNF-α, orIL-1β was calculated using a computerized densitometry systemand values were normalized to the β-actin band density.

Measurement of nitrite content

The nitric oxide production was measured in terms of nitriteusing standard procedures (Granger et al., 1996). In brief, 5×107

PMNs were incubated with and without alpha-naphthoflavone,aminoguanidine, genistein, PDTC, SB202190, or felodipine for1 h. Cell suspensions were centrifuged and re-suspended separatelyin ammonium chloride (0.7 mM) and mixed with Griess reagent(0.1% N-nephthyl ethylenediamine and 1% sulfanilamide in 2.5%phosphoric acid). The reaction mixture was incubated at 37 °C for30 min, centrifuged, and the absorbance of the supernatant wasrecorded at 550 nm. The nitrite content was calculated using astandard curve for sodium nitrite (10–100 μM) and is expressed inμM.

Protein estimation

The protein content of PMN lysates was measured usingBSA as a standard (Bradford, 1976).

CYP1A1 catalytic activity

CYP1A1 (7-ethoxyresorufin O-deethylase; EROD) activityin PMNs with and without alpha-naphthoflavone, aminoguani-

dine, genistein, PDTC, SB202190, or felodipine was measuredusing standard procedures (Pohl and Fouts, 1980) with slightmodifications. In brief, PMN protein (50 μg) was mixed with0.1 M phosphate buffer (pH 7.4) containing 5 mM glucose-6-phosphate, 2 U of glucose-6-phosphate dehydrogenase, 5 mMmagnesium sulphate, 1.6 mg/ml BSA, and 1.5 μM 7-ethoxyresorufin. NADPH (0.6 nM) was added to initiate the reactionand the mixed content was incubated at 37 °C for 20 min. Thereaction was stopped by the addition of 2.5 ml methanol and thereaction mixture was kept on ice. The ice-cold reaction mixturewas centrifuged and the supernatant was used to measure thefluorescence (excitation wavelength — 550 nm and emissionwavelength — 585 nm). The enzymatic activity was calculatedin pmol resorufin/min/mg protein.

Measurement of [Ca2+]i

The PMNs (1.5×107) were treated with and without alpha-naphthoflavone, aminoguanidine, genistein, PDTC, SB202190,or felodipine for 1 h. The cell suspension was centrifuged, theresultant pellet was re-suspended in 1 ml HBSS, and incubatedin the dark with 3 μM Fura-2 AM for 1 h at 37 °C. Cells wererecovered by centrifugation at 900 ×g for 5 min and washedtwice with HBSS. The [Ca2+]i was measured by monitoringFura-2 AM fluorescence at 37 °C using alternate excitationwavelengths at 340 and 380 nm and an emission wavelength at510 nm (Grynkiewicz et al., 1985). The fluorescence wasmeasured separately in control and benzo(a)pyrene-treatedPMNs in the absence (F) and presence of 0.2% Triton X-100(Fmax), and also with 1 mM EGTA (Fmin). The fluorescenceratio at 340 and 380 nm was used to measure [Ca2+]i based onthe formula [Ca++]=Kd(F−Fmin/Fmax−F), where [Ca++] is theintracellular calcium concentration and Kd is the dissociationconstant (Grynkiewicz et al., 1985). The value of Kd was225 nM Ca++ for Fura-2 AM (Grynkiewicz et al., 1985).

Quantitative estimations of TNF-α and IL-1β

Enzyme linked immunosorbent assay (ELISA) was performedto measure TNF-α and IL-1β in PMNs using commerciallyavailable kits. In brief, equal quantities of pre-treatment buffer wasmixed with the sample (50 μl) and incubated at room temperaturefor 1 h. After incubation, the ELISA plate was washed thrice withwash buffer and 50μl of biotinylated antibodywas added into eachwell. The plate was re-washed thrice with wash buffer; 100 μl ofstreptavidin–HRP conjugate was added into each well, andincubated for 30 min at room temperature. The plate was washedagainwith wash buffer and 100μl of tetramethyl benzidine (TMB)was added into eachwell. The colour was developed in the dark for10 min, a stop solution was added to stop the reaction, and theabsorbance was recorded at 450 nm using an ELISA reader.

Statistical analysis

One-way analysis of variance (ANOVA) was used forcomparisons between different groups with the Newman Keul'spost-hoc test. The data are expressed as means±standard error of


the means (S.E.M.). The differences were considered statisticallysignificant when the p value was less than 0.05.

Results

Expression of iNOS mRNA

A significant increase in iNOS expression in PMNs of benzo(a)pyrene-treated rats was observed as compared to DMSO-treated vehicles/controls (pb0.001). The tyrosine kinaseinhibitor, genistein, attenuated the benzo(a)pyrene-mediatedincrease in iNOS expression (pb0.001). Similarly, the intra-cellular calcium channel blocker (felodipine), NF-κB inhibitor(PDTC), CYP1A1 inhibitor (alpha-naphthoflavone), and iNOSinhibitor (aminoguanidine) attenuated the benzo(a)pyrene-mediated increase in iNOS expression (pb0.001), but the p38MAPK inhibitor (SB202190), did not alter the increased iNOS

Fig. 1. Effect of felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, anexpression of iNOS in control and benzo(a)pyrene-treated rat PMNs in the presence oaminoguanidine (a). Bar diagram showing band density ratio of iNOS and β-actin (b). Bwith or without felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, and achanges are expressed as benzo(a)pyrene-treated versus (vs.) vehicle control [⁎⁎⁎(pbtreated vs. genistein [$$$(pb0.001)], benzo(a)pyrene-treated vs. PDTC [###(pb0.00pyrene-treated vs. aminoguanidine [δδδ(pb0.001)], LPS-treated vs. control [γγγ(pb0

expression (Fig. 1a and b). The positive control (LPS-inducedPMN) was also used to check whether the increase in iNOSexpression is mediated by a p38 MAPK-independent pathwayor not. The effect of aminoguanidine, SB202190, and PD98059(a positive control for SB202190) on iNOS expression in LPS-activated PMNs was assessed. iNOS expression was attenuatedin the presence of aminoguanidine (pb0.001), but no significantchange was observed in the presence of SB202190 andPD98059 (Fig. 1a and b). The results obtained by using thepositive controls clearly suggested that the induction of iNOSexpression is independent of the p38 MAPK pathway. Westernblotting was done to assess the MAPK protein level in normaland hypoxic PMNs. PMNs was made hypoxic by incubating thecells for 30 min in oxygen depleted HBSS buffer (by bubblingwith nitrogen). An augmentation in MAPK level was observedin hypoxic cells as compared with normal cells. The augmentedMAPK level was attenuated significantly in SB202190 pre-

d aminoguanidine on iNOS expression and activity in rat PMNs. The mRNAr absence of felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, andar diagram showing nitrite content in control and benzo(a)pyrene-treated rat PMNsminoguanidine (c). Data are expressed as means±S.E.M. (n=4) and significant0.001)], benzo(a)pyrene-treated vs. felodipine [£££(pb0.001)], benzo(a)pyrene-1)], benzo(a)pyrene-treated vs. alpha-naphthoflavone [τττ(pb0.001)], benzo(a).001)], and LPS-treated vs. aminoguanidine [ιιι(pb0.001)].

Fig. 3. Effect of alpha-naphthoflavone, aminoguanidine, genistein, PDTC,SB202190, and felodipine on [Ca2+]i in rat PMNs. Data are expressed as means±S.E.M. (n=4) and significant changes are expressed as benzo(a)pyrene-treatedversus (vs.) vehicle control [⁎⁎⁎(pb0.001)], benzo(a)pyrene-treated vs.alpha-naphthoflavone [τττ(pb0.001)], benzo(a)pyrene-treated vs. genistein[$$$(pb0.001)], and benzo(a)pyrene-treated vs. felodipine [£££(pb0.001)].

Fig. 2. Effect of felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, and aminoguanidine on CYP1A1 mRNA expression and activity in rat PMNs. ThemRNA expression of CYP1A1 and β-actin in control and benzo(a)pyrene-treated rat PMNs in the presence or absence of felodipine, genistein, PDTC, SB202190,alpha-naphthoflavone, and aminoguanidine (a). Bar diagram showing the band density ratio of CYP1A1 and β-actin (b). CYP1A1 activity in control and benzo(a)pyrene-treated rat PMNswith andwithout felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, and aminoguanidine (c). Data are expressed asmeans±S.E.M. (n=4) andsignificant changes are expressed as benzo(a)pyrene-treated versus (vs.) vehicle control [⁎⁎⁎(pb0.001)], benzo(a)pyrene-treated vs. genistein [$$(pb0.01), $$$(pb0.001)],and benzo(a)pyrene-treated vs. alpha-naphthoflavone [ττ(pb0.01), τττ(pb0.001)].


treated hypoxic cells (data not shown). This observation clearlysuggested that SB202190 works well under the conditions ofthe present study.

Measurement of nitrite content

The increase in nitrite content was noted in benzo(a)pyrene-treated rat PMNs as compared to 0.1% DMSO-treated controls.Genistein, felodipine, PDTC, alpha-naphthoflavone, and ami-noguanidine treatment attenuated the benzo(a)pyrene-mediatedaugmentation in nitrite content, however; the p38 MAPKinhibitor, SB202190, did not alter the nitrite content (pb0.001)(Fig. 1c). Positive controls (LPS-induced PMNs) were used tocheck whether the increase in nitrite content (iNOS activity)was mediated by a p38 MAPK-independent pathway. The effectof aminoguanidine, SB202190, and PD98059 (a positivecontrol for SB202190) on nitrite content (iNOS activity) inLPS-activated PMNs was assessed and nitrite content wasattenuated in the presence of aminoguanidine (pb0.001), but nosignificant change was observed in the presence of SB202190and PD98059 (Fig. 1c). These results clearly suggest that the


induction of nitrite content (iNOS activity) was independent ofp38 MAPK.

CYP1A1 mRNA expression

CYP1A1 mRNA expression was augmented in benzo(a)pyrene-treated rat PMNs when compared to respective controls( pb0.001). Genistein significantly attenuated benzo(a)pyrene-induced CYP1A1 expression in PMNs (pb0.001) and alpha-naphthoflavone attenuated CYP1A1 expression (pb0.001),however no significant change was observed when cells weretreated with the intracellular calcium blocker felodipine,SB202190, or the iNOS inhibitor aminoguanidine (Fig. 2a and b).

CYP1A1 catalytic activity

CYP1A1 catalytic activity was also augmented in benzo(a)pyrene-treated rat PMNs as compared to controls (pb0.001).Although benzo(a)pyrene-induced CYP1A1 activity was de-creased by genistein (pb0.01) and alpha-naphthoflavone(pb0.01), no significant alteration was observed in the presenceof felodipine, SB202190, or aminoguanidine (Fig. 2c).

Fig. 4. Effect of felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, andexpression in control and benzo(a)pyrene-treated rat PMNs with and without felodi(a). Bar diagram showing the band density ratio of TNF-α and β-actin in PMNs undeand benzo(a)pyrene-treated rat PMNs with and without felodipine, genistein, PDTC, Smeans±S.E.M. (n=4) and significant changes are expressed as benzo(a)pyrene-treatreated vs. genistein [$(pb0.05), $$(pb0.01)], and benzo(a)pyrene-treated vs. alpha

Measurement of [Ca2+]i

An increase in [Ca2+]i in benzo(a)pyrene-treated rat PMNswas seen as compared with DMSO-treated controls (pb0.001).The increase in [Ca2+]i was attenuated by the CYP1A1inhibitor, alpha-naphthoflavone, and the intracellular calciumantagonist felodipine (pb0.001), however; aminoguanidine didnot produce any change (Fig. 3). Although the NF-κB inhibitor,PDTC, and the p38 MAPK inhibitor, SB202190, did not alterbenzo(a)pyrene-induced augmentation in [Ca2+]i, the tyrosinekinase inhibitor, genistein, significantly attenuated the benzo(a)pyrene-mediated increase in [Ca2+]i (pb0.001) (Fig. 3).

TNF-α and IL-1β mRNA expression

Benzo(a)pyrene treatment significantly increased the ex-pression of TNF-α and IL-1β mRNA (Figs. 4a,b and 5a,b;pb0.01 and 0.05, respectively). Genistein and alpha-naphtho-flavone treatment attenuated the benzo(a)pyrene-induced TNF-α and IL-1β mRNA expression in benzo(a)pyrene-treated ratPMNs (pb0.05). Although SB202190, PDTC, and felodipinereduced benzo(a)pyrene-induced TNF-α and IL-1β mRNA

aminoguanidine on TNF-α expression in rat PMNs. TNF-α and β-actin mRNApine, genistein, PDTC, SB202190, alpha-naphthoflavone, and aminoguanidiner these conditions (b). ELISA-based quantitative estimation of TNF-α in controlB202190, alpha-naphthoflavone, and aminoguanidine (c). Data are expressed asted versus (vs.) vehicle control [⁎⁎(pb0.01), ⁎⁎⁎(pb0.001)], benzo(a)pyrene--naphthoflavone [τ(pb0.05), ττ (pb0.01)].

Fig. 5. Effect of felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, and aminoguanidine on IL-1β expression in rat PMNs. IL-1β and β-actin mRNAexpression in control and benzo(a)pyrene-treated rat PMNs with and without felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, and aminoguanidine(a). Bar diagram showing the band density ratio of IL-1β and β-actin in control and benzo(a)pyrene-treated rat PMNs with and without felodipine, genistein, PDTC,SB202190, alpha-naphthoflavone, and aminoguanidine (b). ELISA-based quantitative estimation of IL-1β in control and benzo(a)pyrene-treated rat PMNs in thepresence or absence of felodipine, genistein, PDTC, SB202190, alpha-naphthoflavone, and aminoguanidine. Data are expressed as means±S.E.M. (n=4) and significantchanges are expressed as benzo(a)pyrene-treated versus (vs.) vehicle control [⁎(pb0.05), ⁎⁎⁎(pb0.001)], benzo(a)pyrene-treated vs. genistein [$(pb0.05), $$(pb0.01)],and benzo(a)pyrene-treated vs. alpha-naphthoflavone [τ(pb0.05)].


expression, it was not statistically significant, however; nochange was observed in the presence of aminoguanidine (Figs.4a,b and 5a,b).

Quantitative estimation of TNF-α and IL-1β

An increase in TNF-α and IL-1β was observed in PMNs ofbenzo(a)pyrene-treated rats as assessed by ELISA (Figs. 4c and 5c;pb0.001). Genistein and alpha-naphthoflavone treatment attenu-ated the benzo(a)pyrene-induced increase in TNF-α (pb0.01) andIL-1β levels (pb0.01 and pb0.05, respectively). On the otherhand, SB202190, PDTC, felodipine, and aminoguanidine did notsignificantly alter the benzo(a)pyrene-mediated increase in TNF-αand IL-1β (Figs. 4c and 5c).

Discussion

Although CYP1A1-mediated iNOS induction utilizes variouspathways depending on the physiological conditions of theisolated cells or tissues, the involvement of secondary messen-gers, including [Ca2+]i, tyrosine kinase, p38 MAPK, NF-κB, andcytokines in CYP1A1-mediated iNOS induction in benzo(a)

pyrene-treated rat PMNs has not yet been established (Chen et al.,2005; Park et al., 1996; Biswas et al., 2001; Anel et al., 1994).Since the underlying mechanism of CYP1A1-mediated iNOSexpression in benzo(a)pyrene-treated rat PMNs is still not known(Kumar et al., 2006), the present study was undertaken toinvestigate the signal transduction pathway from CYP1A1 toiNOS induction.

The increase in iNOS expression and activity in benzo(a)pyrene-treated rat PMNs was reversed by the CYP1A1 inhibitoralpha-naphthoflavone, however; the iNOS inhibitor, aminoguani-dine, abolished any increased iNOS expression and catalyticactivity without altering CYP1A1 expression and activity,suggesting that CYP1A1 actively participates in iNOS inductionand NO production in benzo(a)pyrene-treated rat PMNs (Kumaret al., 2006). Inhibition of iNOS by felodipine, genistein, or PDTCand of CYP1A1 by genistein clearly indicated involvement oftyrosine kinases in CYP1A1 activation and in [Ca2+]i, NF-κB and/or tyrosine kinase in iNOS activation. Since the aryl hydrocarbonreceptor (Ahr) and protein tyrosine kinases are co-localized in thecytosol, they could activate CYP1A1 and subsequently iNOS(Burchiel and Luster, 2001; Delescluse et al., 2000). The p38MAPK inhibitor, SB202190, did not produce any changes in iNOS

Fig. 6. Possible mechanism of the involvement of secondary signalingmolecules in CYP1A1-mediated augmentation of iNOS expression in benzo(a)pyrene-exposed rat PMNs.


expression and activity in benzo(a)pyrene-treated rat PMNs,indicating that despite the involvement of multiple intermediarymediators in increased iNOS expression and activity (Chen et al.,2005; Park et al., 1996; Biswas et al., 2001; Anel et al., 1994;Kikuchi et al., 1998), p38 MAPK is not significantly involved inthe process.

Felodipine did not alter CYP1A1 expression and activity, butsignificantly inhibited increased iNOS expression and activity inbenzo(a)pyrene-treated rats,which clearly suggested that it was theelevation in [Ca2+]i that activated iNOS expression, and notCYP1A1. The CYP1A1 inhibitor, alpha-naphthoflavone, and thetyrosine kinase inhibitor, genistein, significantly reverted theaugmented [Ca2+]i in benzo(a)pyrene-treated rat PMNs, suggest-ing that CYP1A1 and tyrosine kinases were responsible for thisprocess. CYP1A1-mediated elevation in [Ca2+]i in peripherallymphocytes after benzo(a)pyrene exposure is also reported inrodents and humans (Davila et al., 1995; Romero et al., 1997).CYP-derivedmetabolites, i.e., benzo(a)pyrene-7, 8-diol and benzo(a)pyrene-7, 8-diol-9,10-epoxide (BPDE), were more effective inincreasing [Ca2+]i in MCF-10A cells, and the CYP1A1 inhibitor,

alpha-naphthoflavone, reverted CYP1A1 mediated augmentationin [Ca2+]i (Tannheimer et al., 1999; Burdick et al., 2006). Benzo(a)pyrene-induced CYP1A1 expression could augment iNOSexpression and NO production by the MPO pathway in PMNs(Kumar et al., 2006). MPO is localized in azurophilic granules andthe increased cytosolic calcium resulted in PMNdegranulation andthe subsequent release of MPO (Kumar et al., 2006). The increasein CYP1A1-mediated iNOS expression in benzo(a)pyrene-treatedrat PMNs could be due to effect of increased [Ca2+]i, and tyrosinekinases. Alpha-naphthoflavone abolished the benzo(a)pyrene-inducedCYP1A1 expression and activity and felodipine abolishedinduction of [Ca2+]i. This clearly showed that incomplete inhi-bition caused by alpha-naphthoflavone on [Ca2+]i and felodipineon iNOS production is due to the existence of alternative signalingpathways and not due to inefficiency of the inhibitor under thepresent conditions.

The level of [Ca2+]i, is regulated by various downstream andupstream signaling systems, but the correlation between cytosoliccalcium and iNOS expression is not yet clearly understood (Parket al., 1996). The increase in intracellular calcium and iNOSexpression is regulated by several pathways,which include tyrosinekinases, NF-κB, and p38 MAPK signaling pathways. Therefore,the role of these signaling molecules was evaluated in the process.The intracellular calcium blocker felodipine, the tyrosine kinaseinhibitor genistein, and the NF-κB inhibitor PDTC all significantlyreduced the benzo(a)pyrene-mediated increase in iNOS expressionand nitrite content. However, the p38 MAPK inhibitor SB202190did not alter benzo(a)pyrene-mediated iNOS expression in PMNs.This study clearly showed the involvement of [Ca2+]i via tyrosinekinases and NF-κB pathways in a benzo(a)pyrene-mediated in-crease in iNOS expression. The elevation of [Ca+2]i and proteintyrosine kinase activation by cytochrome P-450-derived benzo(a)pyrene metabolites might be possible, as reported in Daudi cells(Mounho and Burchiel, 1998; Davila et al., 1999; Salas andBurchiel, 1998).

Benzo(a)pyrene-induced expression of TNF-α and IL-1β,which were significantly decreased after genistein treatment,suggested that tyrosine kinases are probably involved in thisphenomenon. The interaction between NF-κB and Ahr is animportant aspect in the pathophysiological responses to poly-halogenated hydrocarbons and PAHs (Tian et al., 1999; Kim et al.,2000), however; we did not find any change in [Ca2+]i with theaddition of NF-κB or p38 MAPK inhibitors. This suggested thatthese mediators are probably not involved in the benzo(a)pyrene-induced increase in [Ca2+]i in PMNs. PDTC did not produce anyeffect on benzo(a)pyrene-induced [Ca2+]i, but inhibited TNF-αand IL-1β levels, suggesting that NF-κB acts as a downstreammediator of calcium. The roles of NF-κB, p38 MAPK, andcytokine production in peripheral blood cells were also observedby various investigators under different conditions (Geng et al.,1993; Shapira et al., 1994; Kim and Rikihisa, 2002; White et al.,2000). Since felodipine also inhibited benzo(a)pyrene-inducedaugmentation in TNF-α and IL-1β levels, cytokine productioninduced by benzo(a) treatment could be due to either [Ca2+]i,tyrosine kinases, or both (Geng et al., 1993; Shapira et al., 1994;Kim and Rikihisa, 2002; White et al., 2000; Amadou et al., 2002;Watson et al., 1988). This is in accordance with an earlier report


that found that TNF-α and IL-1β act as intermediary mediators iniNOS induction (Wong et al., 1996). Regulation of cytokineproduction at the transcriptional level is well documented in PMNsand the transcription factor, NF-κB, has been identified as themainintermediate involved in this process. NF-κB is usually heldinactive in the cytoplasm by the endogenous inhibitor proteincalled IκB (inhibitor of NF-κB) and its activation in response topro-inflammatory stimuli, such as TNF-α and IL-1β, is a widelyaccepted phenomenon (Stefano et al., 2006; Kim and Rikihisa,2002). Although we did not determine NF-κB expression/activityor use cytokine antagonists,we positioned TNF-α and IL-1β in thesignaling cascade between [Ca2+]i andNF-κBbased on the reportsavailable in the literature (Hellerbrand et al., 1998; Seabra et al.,1998). PDTC inhibited iNOS expression clearly suggested theinvolvement of NF-κB in iNOS induction, albeit downstream ofcalcium and cytokines. Calcium, cytokines, and CYP1A1/tyrosinekinases may cause the activation of an IκB kinase and thesubsequent phosphorylation of IκB leads to the activation of NF-κB and thereby iNOS and NO (Fig. 6).

Conclusions

Benzo(a)pyrene-induced CYP1A1-mediated iNOS expres-sion in rat PMNs is a complicated phenomenon that involvesseveral signaling molecules. The present study demonstrated thatbenzo(a)pyrene induces CYP1A1, which in turn augments iNOSexpression in PMNs through elevation of [Ca2+]i and activationof tyrosine kinases, inflammatory cytokines, and NF-κB.

Acknowledgement

The authors sincerely acknowledge the Council of Scientificand Industrial Research (CSIR), New Delhi, India for providing aresearch fellowship to Abhai Kumar and Ghanshyam Upadhyay.The ITRC communication number for this manuscript is 2559.

References

Amadou, A., Nawrocki, A., Best-Belpomme, M., Pavoine, C., Pecker, F., 2002.Arachidonic acid mediates dual effect of TNF-alpha on Ca2+ transients andcontraction of adult rat cardiomyocytes. American Journal of Physiology.Cell Physiology 282, 1339–1347.

Anel, A., Richieri, G.V., Kleinfeld, A.M., 1994. A tyrosine phosphorylationrequirement for cytotoxic T lymphocyte degranulation. Journal of BiologicalChemistry 269, 9506–9513.

Arnhold, J., 2004. Properties, functions and secretion of human myeloperox-idase. Biochemistry 69, 4–9 (Moscow).

Arnhold, J., Mueller, S., Arnold, K., Sonntag, K., 1993. Mechanisms of inhibitionof chemiluminescence are in the oxidation of luminol by sodium hypochlorite.Journal of Bioluminescence and Chemiluminescence 8, 307–313.

Babior, B.M., Kipnes, R.S., Curnutte, J.T., 1973. Biological defense mechan-isms. The production by leukocytes of superoxide, a potential bactericidalagent. Journal of Clinical Investigation 52, 741–744.

Berridge, M.J., 2001. The versatility and complexity of calcium signaling.Novartis Foundation Symposium 239, 52–64.

Biswas, S.K., Sodhi, A., Paul, S., 2001. Regulation of nitric oxide production bymurine peritoneal macrophages treated in vitro with chemokine monocytechemoattractant protein. Nitric Oxide 5, 566–579.

Boyum, A., 1968. Separation of leukocytes from blood and bone marrow.Scandinavian Journal of Clinical and Laboratory Investigation 21, 77.

Bradford, M.M., 1976. Rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Analytical Biochemistry 72, 248–254.

Burchiel, S.W., Luster,M.I., 2001. Signaling by environmental polycyclic aromatichydrocarbons in human lymphocytes. Clinical Immunology 98, 2–10.

Burdick, A.D., Ivnitski-Steele, I.D., Lauer, F.T., Burchiel, S.W., 2006. PYK2mediates anti-apoptotic AKT signaling in response to benzo[a]pyrene diolepoxide in mammary epithelial cells. Carcinogenesis 27, 2331–2340.

Chen, J., Yan, Y., Li, J., Ma, Q., Stoner, G.D., Ye, J., Huang, C., 2005. Differentialrequirement of signal pathways for benzo[a]pyrene (B[a]P)-induced nitricoxide synthase (iNOS) in rat esophageal epithelial cells. Carcinogenesis 26,1035–1043.

Choi, H.C., Lee, K.Y., 2004. CD14 glycoprotein expressed in vascular smoothmuscle cells. Journal of Pharmacological Sciences 95, 65–70.

Comalada,M., Ballester, I., Bailon, E., Sierra, S., Xaus, J., Galvez, J.,Medina de, F.S.,Zarzuclo, A., 2006. Inhibition of pro-inflammatory markers in primary bonemarrow-derived mouse macrophages by naturally occurring flavonoids: analysisof the structure-activity relationship. Biochemical Pharmacology 72, 1010–1021.

Davila, D.R., Davis, D.P., Campbell, K., Cambier, J.C., Zigmond, L.A.,Burchiel, S.W., 1995. Role of alterations in Ca(2+)-associated signalingpathways in the immunotoxicity of polycyclic aromatic hydrocarbons.Journal of Toxicology and Environmental Health 45, 101–126.

Davila, D.R., Lane, J.L., Lauer, F.T., Burchiel, S.W., 1999. Protein tyrosinekinase activation by polycyclic aromatic hydrocarbons in human HPB-ALLT cells. Journal of Toxicology and Environmental Health A 56, 249–261.

Delescluse, C., Lemaire, G., de Sousa, G., Rahmani, R., 2000. Is CYP1A1induction always related to AHR signaling pathway. Toxicology 153, 73–82.

Feinstein, D.L., Galea, E., Cermak, J., Chugh, P., Lyandvert, L., Reis, D.J.,1994. Nitric oxide synthase expression in glial cells: suppression by tyrosinekinase inhibitors. Journal of Neurochemistry 62, 811–814.

Ganster, R.W., Taylor, B.S., Shao, L., Geller, D.A., 2001. Complex regulation ofhuman inducible nitric oxide synthase gene transcription by Stat 1 and NF-kappaB. Proceedings of the National Academy of Sciences of the United States ofAmerica 98, 8638–8643.

Garcon, G., Gosset, P., Zesimech, F., Grave-Descampiaux, B., Shirali, P., 2004.Effects of Fe2O3 on the capacity of Benzo(a)pyrene to induce polycyclicaromatic hydrocarbon-metabolizing enzymes in the respiratory tract ofSprague–Dawley rats. Toxicology Letters 150, 179–189.

Geng, Y., Zhang, B., Lotz, M., 1993. Protein tyrosine kinase activation isrequired for lipopolysaccharide induction of cytokines in human bloodmonocytes. Journal of Immunology 151, 6692–6700.

Granger, D.L., Taintor, R.R., Boockvar, K.S., Hibbs, J.B., 1996. Measurementof nitrite in biological sample using nitrate reductase and Griess reaction.Methods in Enzymology 268, 142–151.

Grynkiewicz, G., Poenie,M., Tsien, R.Y., 1985. A new generation of Ca2+ indicatorswith greatly improved fluorescence properties. Journal of Biological Chemistry260, 3440–3450.

Hellerbrand, C., Jobin, C., Licato, L.L., Sartor, R.B., Brenner, D.A., 1998.Cytokines induce NF-kB in activated but not in quiescent rat hepatic stellatecells. American Journal of Physiology 275, G269–G278.

Katz, S., Boland, R., Santillan, G., 2006. Modulation of ERK1/2 and p38MAPKsignaling pathways by ATP in osteoblasts: involvememnt of mechanicalstress activated calcium influx, PKC and Src activation. InternationalJournal of Biochemistry and Cell Biology 38, 2082–2091.

Kikuchi, H., Hossain, A., Yoshida, H., Kobayashi, S., 1998. Induction ofcytochrome P-450 1A1 by omeprazole in human HepG2 cells is proteintyrosine kinase-dependent and is not inhibited by alpha-naphthoflavone.Archives of Biochemistry and Biophysics 358, 351–358.

Kim, H.Y., Rikihisa, Y., 2002. Roles of p38 mitogen-activated protein kinase,NF-kappaB, and protein kinase C in proinflammatory cytokinemRNA expressionby human peripheral blood leukocytes, monocytes and neutrophils in response toAnaplasma phagocytophila. Infection and Immunity 70, 4132–4141.

Kim, D.W., Gazourian, L., Quadri, S.A., Romieu-Mourez, R., Sherr, D.H.,Sonenshein, G.E., 2000. The RelA NF-kappaB subunit and the arylhydrocarbon receptor (AhR) cooperate to transactivate the c-myc promoterin mammary cells. Oncogene 19, 5498–5506.

Kumar, A., Patel, S., Gupta, Y.K., Singh, M.P., 2006. Involvement of endogenousnitric oxide in myeloperoxidase mediated benzo(a)pyrene induced


polymorphonuclear leukocytes injury. Molecular and Cellular Biochemistry286, 43–51.

Li, W., Liu, W., Altura, B.T., Altura, B.M., 2003. Catalase prevents elevation of[Ca(2+)](i) induced by alcohol in cultured canine cerebral vascular smoothmuscle cells: possible relationship to alcohol-induced stroke and brainpathology. Brain Research Bulletin 59, 315–318.

Marlowe, J.L., Puga, A., 2005. Aryl hydrocarbon receptor, cell cycle regulation,toxicity, and tumorigenesis. Journal of Cellular Biochemistry 96, 1174–1184.

Mene, P., Pascale, C., Teti, A., Barnardini, S., Cinotti, G.A., Pugliese, F., 1999.Effects of advanced glycation end products on cytosolic Ca2+ signaling ofcultured human mesangial cells. Journal of the American Society ofNephrology 10, 1478–1486.

Mounho, B.J., Burchiel, S.W., 1998. Alterations in human B cell calciumhomeostasis by polycyclic aromatic hydrocarbons: possible associationswith cytochrome P450 metabolism and increased protein tyrosinephosphorylation. Toxicology and Applied Pharmacology 149, 80–89.

Mounho, B.J., Davila, D.R., Burchiel, S.W., 1997. Characterization ofintracellular calcium responses produced by polycyclic aromatic hydro-carbons in surface marker-defined human peripheral blood mononuclearcells. Journal of Toxicology and Environmental Health 45, 101–126.

Nakashima, O., Tereda, Y., Inoshita, S., Kuwahara, M., Sasaki, S., Marumo, F.,1999. Inducible nitric oxide synthase can be induced in the absence of activenuclear factor-kappaB in rat mesangial cells: involvement of Janus kinase 2signaling pathway. Journal of the American Society of Nephrology 10,721–729.

Nakayama, S., Ito, Y., Sato, S., Kamijo, A., Liu, H.N., Kajioka, S., 2006.Tyrosine kinase inhibitors and ATP modulate the conversion of smoothmuscle L-type Ca2+ channels toward a second open state. Federation ofAmerican Societies for Experimental Biology Journal 20, 1492–1494.

Nastevska, C., Gerber, E., Horbach, M., Rohrdanz, E., Kahl, R., 1999.Impairment of TNF-α expression and secretion in primary rat liver cellcultures by acetaminophen treatment. Toxicology 133, 85–92.

Park, Y.C., Jun, C.D., Kang, H.S., Kim, H.D., Kim, H.M., Chung, H.T., 1996.Role of intracellular calcium as a priming signal for the induction of nitricoxide synthesis in murine peritoneal macrophages. Immunology 87,296–302.

Pohl, R.J., Fouts, J.R., 1980. A rapid method assaying the metabolism of 7-ethoxyresorufin by microsomal subcellular fractions. Analytical Biochemistry107, 150–155.

Poljakovic, M., Nygren, J.M., Persson, K., 2003. Signaling pathways regulatinginducible nitric oxide synthase expression in human kidney epithelial cells.European Journal of Pharmacology 469, 21–28.

Romero, D.L., Mounho, B.J., Lauer, F.T., Born, J.L., Burchiel, S.W., 1997.Depletion of glutathione by benzo(a)pyrene metabolites, ionomycin,thapsigargin, and phorbol myristate in human peripheral blood mononuclearcells. Toxicology and Applied Pharmacology 144, 62–69.

Saini, R., Patel, S., Saluja, R., Sahasrabuddhe, A.A., Singh, M.P., Habib, S.,Bajpai, V.K., Dikshit, M., 2006. Nitric oxide synthase localization in the ratneutrophils: immunocytochemical, molecular, and biochemical studies.Journal of Leukocyte Biology 79, 519–528.

Salas, V.M., Burchiel, S.W., 1998. Apoptosis in Daudi human B-cells inresponse to benzo(a)pyrene and benzo[a]pyrene-7,8-dihydrodiol. Toxicol-ogy and Applied Pharmacology 151, 367–376.

Seabra, V., Stachlewitz, R.F., Thurman, R.G., 1998. Taurime blunt LPS-inducedincrease in intracellular calcium and TNF-alpha production by Kupffer cells.Journal of Leukocyte Biology 64, 615–621.

Segal, A.W., Abo, A., 1993. The biochemical basis of the NADPH oxidase ofphagocytes. Trends in Biochemical Sciences 18, 43–47.

Sethi, S., Singh, M.P., Dikshit, M., 1999. Nitric oxide-mediated augmentation ofolymorphonuclear free radical generation after hypoxia-reoxygenation.Blood 93, 333–340.

Shapira, L., Takashiba, S., Champagne, C., Amar, S., Van Dyke, T.E., 1994.Involvement of protein kinase C and protein tyrosine kinase in lipopoly-saccharide-induced TNF-alpha and IL-1 beta production by humanmonocytes. Journal of Immunology 153, 1818–1824.

Stefano De, D., Maiuri, M.C., Iovine, B., Ialenti, A., Bevilacqua, M.A.,Carnuccio, R., 2006. The role of NF-kappaB, IRF-1, and STAT-1alphatranscription factors in the iNOS gene induction by gliadin and IFN-gammain RAW 264.7 macrophages. Journal of Molecular Medecine 84, 65–74.

Tannheimer, S.L., Barton, S.L., Ethier, S.P., Burchiel, S.W., 1997. Carcinogenicpolycyclic aromatic hydrocarbons increase intracellular Ca2+ and cellproliferation in primary human mammary epithelial cells. Carcinogenesis 18,1177–1182.

Tannheimer, S.L., Lauer, F.T., Lane, J., Burchiel, S.W., 1999. Factorsinfluencing elevation of intracellular Ca2+ in the MCF-10A humanmammary epithelial cell line by carcinogenic polycyclic aromatic hydro-carbons. Molecular Carcinogenesis 25, 48–54.

Tfelt-Hansen, J., Ferreira, A., Yano, S., Kanuparthi, D., Romero, J.R., Brown,M., Chattopadhyay, N., 2005. Calcium-sensing receptor activation inducesnitric oxide production in H-500 Leydig cancer cells. American Journal ofPhysiology. Endocrinology, Metabolism and Gastrointestinal Physiology288, 1206–1213.

Tian, Y., Ke, S., Denison, M.S., Rabson, A.B., Gallo, M.A., 1999. Ah receptorand NF-kappaB interactions, a potential mechanism for dioxin toxicity.Journal of Biological Chemistry 274, 510–515.

Watson, M.L., Lewis, G.P., Westwick, J., 1988. Neutrophil stimulation byrecombinant cytokines and a factor produced by IL-1-treated human synovialcell cultures. Immunology 65, 567–572.

White, J.E., Lin, H.Y., Davis, F.B., Davis, P.J., Tsan, M.F., 2000. Differentialinduction of tumor necrosis factor alpha and manganese superoxide dismutaseby endotoxin in human monocytes: role of protein tyrosine kinase, mitogen-activated protein kinase, and nuclear factor kappa. Journal of CellularPhysiology 182, 381–389.

Winterbourn, C.C., 1985. Comparative reactivities of various biologicalcompounds with myeloperoxidase-hydrogen peroxide-chloride, and simi-larity of the oxidant to hypochlorite. Biochimica et Biophysica Acta 840,204–210.

Wong, H.R., Finder, J.D., Wasserloos, K., Lowenstein, C.J., Geller, D.A.,Billiar, T.R., Pitt, B.R., Davies, P., 1996. Transcriptional regulation of iNOSby IL-1 beta in cultured rat pulmonary artery smooth muscle cells. AmericanJournal of Physiology 271, L166–L171.

Yang, G.H., Osanai, K., Takahashi, K., 1999. Effect of interleukin-1beta onDNA synthesis in rat alveolar type II cells in primary culture. Respirology 4,139–145.

Zhao, M., Lytton, J., Burchiel, S.W., 1996. Inhibition of sarco-endoplasmicreticulum calcium ATPases (SERCA) by polycyclic aromatic hydrocarbons:lack of evidence for direct effects on cloned rat enzymes. InternationalJournal of Immunopharmacology 18, 589–598.

Ziolo, M.T., Katoh, H., Bers, D.M., 2001. Expression of inducible nitric oxidesynthase depresses beta-adrenergic-stimulated calcium release from thesarcoplasmic reticulum in intact ventricular myocytes. Circulation 104,2961–2966.

Documents

Life Science