Libyan Journal of Veterinary and Medical Sciences

(Libyan J. Vet. Med. Sci.)

ISSN 2410-9215

Editorial board

Editor-in-Chief:

Dr. Abdulhakim A. El Maghrbi

Editors: Dr. Abdelrazzag A. Elmajdoub

Dr. Mohamed H. Abushhiwa

Dr. Emad M. Bennour

(Faculty of Veterinary Medicine, University of Tripoli, Tripoli, Libya)

Scope and aims

Libyan Journal of Veterinary and Medical Sciences (Libyan J. Vet. Med. Sci.) is a

biannually journal that publishes peer-reviewed papers on the fields of veterinary and

basic medical sciences. Contributions may be in the form of original research or review

articles and case reports. The goal of this journal is to provide a platform for scientists to

promote, share and discuss various new issues and developments in all aspects of

veterinary and basic medical sciences.

i

INSTRUCTIONS TO AUTHORS

The journal publishes original scientific

research or review papers and case reports.

Manuscripts should be submitted in

English. Only unpublished manuscripts may

be accepted for the review process. All

manuscripts initially reviewed by members of

editorial board, then forwarded to qualified

reviewers. Three hard copies of manuscript

with figures and tables should be submitted in

addition to an electronic copy on a CD.

Electronic submission by the e-mail

mentioned below is strongly recommended. In

case of rejection, the submitted copies of the

manuscript will not be returned to authors.

There are no page charges.

Preparation of the manuscript

1. General guidelines

All manuscripts including references,

tables and figure legends should be typed

double-spaced on one side of the paper with

12 font size and Times New Roman format,

with at least 25mm margin. The manuscript

should be numbered consecutively beginning

from the title page followed by the abstract,

text, acknowledgments, references, tables and

legends. Lines should be numbered in all

sections of the manuscript.

All manuscripts should be accompanied by

a cover letter from the corresponding author

which specifies the following:

i. The type of submission.

ii. The name of corresponding author and

his/her complete mailing address,

telephone and fax numbers.

iii. A statement by the corresponding

author certifying that all coauthors

have seen and agreed to the contents of

manuscript and that the submitted

work has not been considered for

publication or published previously.

2. Title page

The title page of the manuscript should be

in a separate page and include the following:

i. A concise and informative title of

fewer than 200 characters.

ii. Full names of authors with first name,

middle initial and last name of each

author.

iii. Complete affiliation for each author,

with the name of department(s) and

institution(s) to which the work should

be attributed.

iv. Name, address, telephone number, fax

number, and e-mail address of the

corresponding author.

v. Superscript numbers should be used to

link the author with institution and an

asterisk (*) should be used to refer to

the corresponding author.

3. Abstract

An abstract with up to 250 words in one

paragraph for original and review articles

should be submitted. The abstract should

contain the background, purpose(s) of the

study, procedure(s), results and conclusions.

For review articles, the abstracts should

summarize the contents of the review. Up to

six key words should also be provided with the

abstract.

4. Introduction

This section should provide a clear and

concise justification of the study including its

relevance. The number of citations should be

kept to the minimum. The final paragraph

should state the hypothesis and the aims of the

study.

5. Materials and methods

This section should include the design and

the methodology of the study and should be

presented in sufficient details. However,

previously published methods should not be

discussed in details but cited with appropriate

references instead.

6. Results

The content of this section should be

informative and accompanied by self-

explanatory tables, figures or other illustrations

if necessary.

ii

ii

Libyan J. Vet. Med. Sci.

7. Discussion

Its contents should be interpretative and

based on the study results only. The

discussion can be in a single section or it can

be presented together with the results and

conclusion.

8. Tables

Tables should be typed double spaced each

on a separate page. Pages should be numbered

consecutively with text. The table number and

title should be provided above the table.

Footnote for each table should be provided for

identifying all used abbreviations.

9. Figure legends

Must be self explanatory, placed under the

figure and all abbreviations should be

identified.

10. Figures

The maximum allowed number is up to 10

for all types of publications and should be in a

good level of resolution.

11. Acknowledgement

12. References

References in the text must be written in

parentheses and provided as name and year of

the publication. They should be written in

chronological order, then in alphabetical

order, in parentheses; for example: (Albrecht

1983; Meyer 1983; Muller and Frank 1985;

Schmitz et al. 1988). If the author's name is

mentioned in the text directly, then the year of

publication is to be written in parentheses; e.g.

according to Smith (2007). If there are more

than two authors, then the first is named and

the others are summarized under "et al.". All

the sources cited in the text should be in the

reference list. It is the entire responsibility of

the author(s) to cross-check the references and

citations carefully.

The list of references should be organized

alphabetically based on the first letter of the

first author surname.

The following citation method is to be

used in the list of references:

Journal article

The title of the journal should be

abbreviated according to the official

abbreviations given in Medline

(www.ncbi.nlm.nih.gov). The journal name

should be abbreviated without any full stops

and in italic format (e.g. Vet Med); the issue

numbers should NOT be mentioned.

e.g. Gibson TW, Brisson BA and Sears W

(2005). Perioperative survival rates after

surgery for diaphragmatic hernia in dogs and

cats: 92 cases (1990-2002). J Am Vet Med

Assoc. 227:105-109.

Book

e.g. Ganong WF (1985). Review of medical

physiology (12th

edn). Lange Medical

Publications, Los Altos: pp 55.

Chapter in book

e.g. Thomson GR (1994). Foot-and-mouth

disease. In Coetzer JAW, Thomson GR,

Tustin RC (eds) Infectious diseases of livestock

with special reference to southern Africa Vol.

1. Oxford University Press, Cape Town: pp

825-852.

Conference proceedings

e.g. Nielsen JP and Rosendal S (1994).

Ciliostasis in the pathogenesis of atrophic

rhinitis. Proceedings of the 13th International

Pig Veterinary Society Congress, Bangkok,

Thailand, 26-30 June pp119.

Thesis

e.g. Pini A (1977). Strains of African swine

fever virus isolated from domestic pigs and

from the tick Ornithodoros moubata in South

Africa. DVSc thesis, University of Pretoria.

Online materials

Only authentic online materials should be

used.

e.g. Batey R (2003). Mycotic dermatitis

(dermatophilosis) of sheep. Online at:

http://www. austbreed.com.au (accessed 2

May 2007).

13. Case report

Case report will be considered for

publication only if it concerns unrecognized

condition or offers new insight into

pathophysiology, diagnosis or treatment of a

disease. The abstract of case reports should

not exceed 100 words and overall text not

exceeds 2000 words including tables, figures

and references.

Libyan J. Vet. Med. Sci.

iii

All correspondence should be addressed to:

Dr. Abdulhakim A. El Maghrbi

Editor-in-Chief

Libyan Journal of Veterinary and Medical Sciences (Libyan J Vet Med Sci)

Faculty of Veterinary Medicine

University of Tripoli

P.O. Box 13662

Tripoli, Libya

Fax: +218 21 462 8422

E-mail: dochakim1990@gmail.com

E-mail: dochakim2000@yahoo.com

Libyan J. Vet. Med. Sci.

iv

Contents

Laboratory Investigation on the Effect of Some Plant Extracts on the Development

of Culex quinquefasciatus. Abdulhakim A. EL Maghrbi and Mohamed M. Hosni

1-6

Molecular Analysis of Factor VIII (F8) Gene Mutations and Its Detection in Libyan

Patients with Hemophilia A. Nadia N. Essarbout, Mohamed B. Marwan, Rasem K. Alajnaf, Amel A. Essarbout, Alttaf N.

Essarbout and Refaat M. Tabagh

7-12

Study of Serotonin Transporters Gene in Sporadic Amyotrophic Lateral Sclerosis

in French Population. Julien Praline, Refaat M. Tabagh, Maïté Amy, Patrick Vourc’h, Christian Andres and Philippe

Corcia

13-17

The Impact of Wheat Rhizosphere on the Distribution of Burkholderia spp and Soil

Bacteria. Merfat T. Ben Mahmud

18-21

Clinical Outbreaks of Flavobacterium columnare among Tilapia Populations from

Lake Qarun, Egypt. Dina A. Mosselhy, Mohamed A. El-Aziz, Mona M. Husien, Abdelsalam A. Abumhara

and Alaa E.

Eissa

22-28

Effects of Mercury Chloride on Sperm Parameters and Pathological Changes in

Kidney of Mouse.

Habiba A. El Jaafari, Amr M. Fathalla and Suhera Aburawi

29-32

Libyan J. Vet. Med. Sci.

v

Bushwereb et al.

L .J. V. M. Sci. (2015) Vol. 1 (1): 1-4.

Laboratory Investigation on the Effect of Some Plant Extracts on the

Development of Culex quinquefasciatus

Abdulhakim A. EL Maghrbi¹* and Mohamed M. Hosni²

¹Department of Microbiology and Parasitology, Faculty of Veterinary Medicine, University of Tripoli, P.O. Box 13662, Libya

²Department of Preventive Medicine, Faculty of Veterinary Medicine, University of Tripoli, P.O. Box 13662, Libya

Received 4October 2015/ Accepted 18 November 2015

Keywords: Culex quinquifasciatus, development, larvae, plant extracts

Introduction

Chemical control methods of vectors like

mosquitoes based on the application of synthetic

insecticides but due to environmental pollution and the

development of resistance by most of species of

mosquitoes including vectors of important diseases as

malaria, Bancroftian filariasis and yellow fever

(Georghiou, 1980 and Pessoa and Martins, 1988). It’s

necessary to find an alternative, cheaper, vector control

methods which require easy technology, but give

excellent results. Phytochemicals obtained from plants

with proven mosquito control potential can be used as

an alternative to synthetic insecticides or along with

other insecticides under the integrated vector control.

Plant products can be used, either as insecticides for

killing larvae or adult mosquitoes or as repellents for

protection against mosquito bites, depending on the

type of activity they possess.

A large number of plant extracts have been reported

to have mosquitocidal or repellent activity against

mosquito vectors (Sukumar et al. 1991). Biologically

active plant extracts are therefore being studied for their

potential efficacy to minimize the extent of pollution

and for its activities as larvicidal, ovicidal, influence on

oviposition behavior and on the growth of pre-imaginal

stages. Certain bioactive compounds derived from

Apium graveolens seeds have been proven to possess

nematocidal activity against Caenorhabditis elegans

and Panagrellus redivivus, antifungal activity against

Candida albican, C. kruseii and C. parapsilasis, and

mosquitocidal effects against Aedes aegypti fourth-

instar larvae (Rafikali et al. 2000; Rafikali and

Muraleednaran 2001). Choochote et al. (2004)

investigated the crude seed extract of celery, A.

graveolens, for anti-mosquito potential, including

larvicidal, adulticidal, and repellent activities against

Aedes aegypti. They found that ethanol-extracted A.

graveolens possessed larvicidal activity against fourth

instar larvae of Ae. aegypti with LD50 (81.0 mg/L) and

LD95 ( 176.8 mg/L).

For adulticidal activity, the plant extract exhibited a

slightly adulticidal potency with LD50 (6.6 mg/cm²)

and LD95 (66.4 mg/cm²). Also, this extract showed

repellency against adult females with ED50 and ED95

values of 2.03 and 28.12 mg/cm2, respectively.

Warikoo et al. (2011) revealed that the addition of

100% oil of Ocimum basilicum and Cymbopogon

nordus caused complete ovi-position deterrence of

Ae.agypti but A. graveolens caused of 75% effective

repellency. Papaya seeds, Carica papaya have

antifungal, antibacterial, anti-helminthic and anti-

amoebic properties, (Chavez 2011; Aravind et al.

2013). Masamba et al. (2003) reported that the oil of

Lemongrass, C. citratus has both contact and fumigant

toxicity effects on larger Grain Borer (Prostephanus

truncates). Also, reported that the oil Lemongrass when

applied to maize grain in storage, there were significant

reductions in maize damage and weight loss.

Sherwani et al. (2013) concluded that the crude

aqueous extract of C. citratus (lemongrass) showed

anthelmintic activity and could be apply as an effective

agent in future after further exploration. Dhanasekaran

et al. (2013) they investigated the larvicidal, ovicidal,

and repellent potential of the ethanolic crude extracts

Original article

Abstract Ethanol and acetone extracts of four species of plants (Allium tuberosum, Apium leptophylum, Carica papaya and

Cymbopogon citratus) were tested in respect of their influence on the development of pre-imaginal stages of mosquito

(Culex quinquifasciatus) in concentration 100, 10 and 1mg/L. Eight experiments, four replications were conducted in

each case. For each replication, 25 first stage larvae were placed in each dish of experiment and control. The

developments of larvae were followed daily till the completion of cycle. All concentrations of ethanol and some of

acetone extracts of A.tuberosum were significantly prolonged the time of the growth beside increase mortality of

larvae in acetone extract of concentration 100mg/L during development. A. leptophyllum in ethanol and acetone

extracts of concentrations 100mg/L, the developmental period of the pupal stage and in acetone extract of 10mg/L

from L4 to pupa were significantly lengthened. Also, the same vegetable in both extracts produce mortality during this

experiment. The two extract of C. papaya in 100mg/L and the extracts of C. citratus in 100 and 10 mg/l were

prolonged time of the development and causing high mortality, out of 100/100 and 77(100) in ethanol and acetone

extracts of C. papaya respectively but only acetone extract of C. citratus lead to high mortality of larvae 25/100 in

100mg/L. The differences in obtained responses necessitate the adoption of deeper research to isolate the active

principle of such plants for potential use in mosquito control program.

Libyan Journal of Veterinary and Medical Sciences December 2015 Vol. 1 (2): 1-6

*Corresponding Author: Abdulhakim A. El Maghrbi. Department of Microbiology and Parasitology, Faculty of Veterinary

Medicine, University of Tripoli. P. O. Box 13662 Tripoli, Libya.Tele.+218 925360665, Email: dochakim2000@yahoo.com.

1

EL Maghrbi et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:1-6

. from the medicinal plants. Celosia argentea,

Anthocephalus cadamba, Gnetum ula, Solena

amplexicaulis and Spermacoce hispida against the

medically important mosquito vectors, Anopheles

stephensi, Ae. aegypti and Culex tritaeniorhynchus.

They concluded that among the five plant extract, G.

ula and S. hispida have significantly higher larvicidal,

ovicidal and repellent activity against selected human

vector mosquitoes An. stephensi, Ae. aegypti and Cx.

tritaeniorhynchus.

Coello et al. (2013) demonstrated that the

chloroform extracts of C. papaya seed has significant

antiprotozoal activity, but does not totally eliminate

Trypanosoma cruzi trypomastigotes during the active

phase of infection. Alcoholic/acetone extracts of C.

papaya and C. citratus at 100 mg/L; were proved to be

repulsive for ovi-position of Ae. fluviatilis. On the other

hand, acetone extracts of Allium tuberosum at 100 and

10 mg/L and A. leptophyllum at 100 mg/L produced

same effect on ovi-position behavior of Ae. fluviatilis.

Four acetone extracts (A. tuberosum, A. leptophylum, C.

papaya and C. Citrates) were repulsive for ovi-position

at 100 mg/L. Acetone extract of A. tuberosum at 10 and

1 mg/L and C. citratus at 10 mg/L maintained the same

properties (EL Maghrbi and Hosni 2014).

Cx. quinquifasciatus is one of the species essentially

domestic, per domestic and the principle vector on

Wuchereria bancrofti in the world (Pessoa and Martins,

1988). This study was designed to investigate the

influence of ethanol and acetone extracts of four plants

on development of pre-imaginal of Cx. quinquifasciatus

in the laboratory.

Materials and methods

Adult male (1000) and female (1000) mosquitoes

(Cx. quinquifasciatus) were maintained in laboratory in

transparent screen cages (40x40x40cm) containing 5%

honey solution and recipient contain dechlorinated

water for females oviposition at 27± 2 °C and 75 ± 5%

R.H. and 12 h photoperiod. Adult females were also fed

on pigeon. The larvae were reared in plastic containers

with approximately seven liters of clean dechlorinated

water and changed completely every two days. Larvae

were feeding on grinding, sieved and autoclaved ration

of cats.

Four species of plants, Allium tuberosum

(Liliaceae); Apium leptophylum (Umbelliferae); Carica

papaya (Caricaceae); Cymbopogon citrates (Graminae)

were selected on the basis of its biological activity on

mosquito or other organism, facility of obtaining and

plenty in nature. The plants were identified according to

Marbberly (1987). Plant extracts were prepared by

agitating the dried and ground plant parts in ethanol

and/or acetone separately for 24 h followed by filtration

and later recuperation of solvent using rotary

evaporator.

Eight experiments, four replications were conducted

in each case. For each experiment, concentration of 100,

10 and 1mg/L in distilled water of each plant extract

was used (150ml/9.5cm in diameter). To facilitating

dilution in water, every 100mg of extract were initially

dissolved in 2 ml of ethanol or acetone and then diluted

in one liter of distil water. The same solvents were

added in similar proportion in controls. For each

replication, 25 first stage larvae were placed in each

dish of experiment and control (containing distal water)

after removing the water through the filter paper to

avoid alteration the concentration of extracts.

All the test and control cups were covered with

netting to prevent successfully emerged adults from

escaping into the environment. The developments of

larvae were followed daily until the complete

emergence of adults. All changes in the different

concentrations and control were recorded. All dead

larvae and pupa were removed. The Medias which

contain the larvae were changed completely every three

days. The developed larvae were feeding on grinding,

sieved and autoclaved ration of cats with equal quantity

according to AMCA (1970).

Results and discussion

The following results of the experiments on the

development of pre-imaginal stages of Cx.

quinquifasciatus in different concentrations of ethanol

and acetone extracts of the plants were illustrated in the

figures 1 to 8 (The different letters indicating the

differences significantly occurred inside each stage

evolution) and the mortalities occurred during the same

experiments (Tables 1 to 8).

All concentrations of ethanol and some of acetone

extracts of A.tuberosum were significantly prolonged

the time of the growth beside increase mortality of

larvae in acetone extract of concentration 100mg/L

during development, figure (1-2) and Table (1), (2).

Figure 1. Effects of ethanol extract concentrations of

Allium tuberosum on the development of pre-imaginal

stages of Culex quinquefasciatus.

Figure 2. Effects of acetone extract concentrations of

Allium tuberosum on the development of pre-imaginal

stages of Culex quinquefasciatus.

2

EL Maghrbi et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:1-6

Table 1: Number of mortality, males and females of Cx. quinquefasciatus developed in

various concentrations (mg/L) of ethanol extract of Allium tuberosum and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 4 3 7 93 41 52

10 3 4 7 93 45 48

1 1 2 3 97 52 45

0 1 6 7 93 46 47

In each concentration 4 replications of 24 larvae

Table 2: Number of mortality, males and females of Cx. quinquefasciatus developed in

various concentrations (mg/L) of acetone extract of Allium tuberosum and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 44 - 44 56 29 27

10 2 1 3 97 43 54

1 - 1 1 99 45 54

0 1 1 2 98 51 47

In each concentration 4 replications of 24 larvae

A.leptophyllum in ethanol and acetone extracts in

concentration 100mg/L, the pupation period were

delayed and in acetone extract of 10mg/L, the time of

the growth from L4 to pupa were significantly

lengthened. Also, the same vegetable in both extracts

produce mortality during this experiment, figure (3), (4)

and Table (3), (4).

Figure 3. Effects of ethanol extract concentrations of

Apium leptophyllum on the development of pre-

imaginal stages of Culex quinquefasciatus.

Figure 4. Effects of acetone extract concentrations of

Apium leptophyllum on the development of pre-

imaginal stages of Culex quinquefasciatus.

Both extracts of C. papaya in 100mg/L, the time of

the growth were increased and causing high mortality,

out of 100/100 and 77/100 in ethanol and acetone

extracts respectively, figure (5)-(6) and Table (5)-(6).

Figure 5. Effects of ethanol extract concentrations of

Carica papaya on the development of pre-imaginal

stages of Culex quinquefasciatus.

Figure 6. Effects of acetone extract concentrations of

Carica papaya on the development of pre-imaginal

stages of Culex quinquefasciatus.

Table 3: Number of mortality, males and females of Cx. quinquefasciatus developed in

various concentrations (mg/L) of ethanol extract of Apium leptophyllum and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 13 7 20 80 45 35

10 - - - 100 48 52

1 - 2 2 98 57 41

0 1 - 1 99 50 49

In each concentration 4 replications of 24 larvae

3

EL Maghrbi et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:1-6

. Table 4: Number of mortality, males and females of Cx. quinquefasciatus developed in

various concentrations (mg/L) of acetone extract of Apium leptophyllum and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 69 2 71 29 16 13

10 3 2 5 95 46 49

1 6 - 6 94 52 42

0 6 - 6 94 53 41

In each concentration 4 replications of 24 larvae

Table 5: Number of mortality, males and females of Cx. quinquefasciatus developed in

various concentrations (mg/L) of ethanol extract of Carica papaya and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 100 - 100 - - -

10 7 6 13 87 42 45

1 2 8 10 90 48 42

0 5 4 9 91 47 44

In each concentration 4 replications of 24 larvae

Table 6: Number of mortality, males and females of Cx. qyuinquefasciatus developed in

various concentrations (mg/L) of acetone extract of Carica papaya and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 77 - 77 23 10 13

10 9 - 9 91 52 39

1 4 3 7 93 50 43

0 6 3 9 91 43 48

In each concentration 4 replications of 24 larvae

The concentrations 100 and 10mg/l of both extracts

of C.citratus were delayed the time of the development

and lead to high mortality of larvae in high

concentration of acetone extract only (Figure (7), (8)

and Table (7), (8).

Figure 8. Effects of acetone extract concentrations of

Cymbopogon citratus on the development of pre-

imaginal stages of Culex quinquefasciatus.

Figure 7. Effects of ethanol extract concentrations of

Cymbopogon citratus on the development of pre-imaginal

stages of Culex quinquefasciatus.

Table 7: Number of mortality, males and females of Cx. quinquefasciatus developed in

various concentrations (mg/L) of ethanol extract of Cymbopogon citrarus and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 11 1 12 88 39 49

10 8 3 11 89 41 48

1 7 3 10 90 48 42

0 6 1 7 93 50 43

In each concentration 4 replications of 24 larvae

4

EL Maghrbi et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:1-6

Table 8: Number of mortality, males and females of Cx. quinquefasciatus developed in

various concentrations (mg/L) of acetone extract of Cymbopogon citrarus and in control (0).

Mg/L Larval

mortality

Pupal

mortality

Total

mortality

Adults

emerged Male Female

100 25 1 26 74 30 44

10 6 4 10 90 49 41

1 1 3 4 96 55 41

0 3 2 5 95 46 49

In each concentration 4 replications of 24 larvae

The influence of vegetable or its extracts on the

population of mosquitoes were aboard by number of

authors with different forms; Supavaran et al. (1974)

found that between 36 methanol extracts, 12 reduced

the emerging of the adults, 11 inhibited significantly the

development of larvae and 10 prolonged the time of

growth of the larvae of Aedes aegypti.

Also, the authors reported that the methanol extract

of Ricinus communis was capable to kill all larvae (L4)

of Ae. aegypti in three days in concentration of 1000

ppm. Osmani and Sighamony (1980) reported that the

oil of Cymbopogon when tested against Ae. Aegypti in

Bangalore in India induced high mortality for larvae

(L3 and L4) but considered poor ovicidal and no

produce any significant effect in relation to inhibition of

the growth. In our results, the ethanol and acetone

extracts of this plant were produced significant effect on

the growth of Cx.quinquefasciatus and have the same

effect on the larvae in acetone extract only. Mwangi and

Rembold (1988) reported that water extract of Melia

volkensii inhibited the growth of second stage larvae of

Ae.aegypti.

EL Maghrbi (2013) reported that the ethanol extract

of C.citratus, acetone extract of A. leptophyllum and C.

citratus at 100mg/L were capable of reducing the

number of eggs hatched significantly, in addition

ethanol extract of A. tuberosum, C. papaya and acetone

extract of A. tuberosum at 100mg/L were significantly

kills the larvae of Ae. fluviatilis. Kloss et al. (1987)

found that water extract of seeds of C.papaya have low

to moderate moluscide (Biomphalaria pfeifferi) in

Kenya. Water extract of C.papaya has toxic activity on

the larvae of Cx. quinquefasciatus (Evans and Raj,

1988). Oil of C.citratus when tested against Ae.aegypti

in India, was able to induce high mortality to larvae

(Grandi et al. 1989).

Rahuman et al. (2009) investigated the larvicidal

potential of indigenous plant extracts from commonly

used medicinal herbs as an environmentally safe

measure to control the filarial vector Cx.

quinquefasciatus, they found that the all plant extracts

showed moderate larvicidal effects after 24 h of

exposure at 1.000 ppm; however, the highest larval

mortality was found in stem-park hot water, acetone

and methanol extracts of Cedrus deodara

(LC50=133.85, 141.60 and 95.19 ppm, LC90= 583.14,

624.19 and 639.99 ppm.) and leaf hot water, acetone,

methanol and chloroform extracts of Nicotiana tabacum

(LC50= 76.27, 163.81 and 83.38 and 105.85ppm,

LC90= 334.72, 627.38, 709.51 and 524.39 ppm) against

the larvae of Cx. quinquefasciatus respectively.

Consuli et al. (1991) recorded that some ethanol

extracts of 17 species of plants at 100 mg/L produced

low percent of egg hatching laid in these extracts. Also,

11.1% and 33.3% of ethanol extracts influenced

surviving of larva of Cx.quinquefasciatus and

Ae.fluviatilis respectively and 11.1% of acetone extracts

for both species. Zebitz (1984) denoted that aqueous

extract obtained with organic solvent of Azadirachta

indica caused extreme prolongation of larval period,

when L1 exposed to these extracts, this author

suggested that the component of Azadirachtin and

others presented in this vegetable being capable the

interfere in hormonal equilibrium or affect on neuro-

endocrine control of ecdisteroides.

In Algeria, A. indica extract, was tested against

larvae and pupae of Cx. pipiens under laboratory

conditions. After treatment of larval stage, LC50 and

LC90 values for Azadirachtin were 0.35 and 1.28 mg/L

in direct effect and 0.3–0.99 mg/L in indirect effect,

respectively. Also, after treatment of the pupal stage,

the LC50 and LC90 in direct effect were measured as

0.42–1.24 mg/L and in indirect effect was 0.39–1.14

mg/L respectively. In addition, mosquito adult

fecundity was decreased and sterility was increased by

the Azadirachtin after treatment of the fourth instar and

pupal stage. The treatment also prolonged the duration

of the larval stage (Alouani et al. 2009).

It is worthy to perceive that extract concentration

and type of solvents for extraction are important when

used to influence the development. In conclusion, our

results indicated that the plants used in the current study

were rich source of valuable compounds. Therefore,

screening of these plants will be of great interest and

further investigation should be undertaken to identify

the biological active compound and their chemical

structure.

References

Alouani A, Rehimi N and Soltani N (2009). Larvicidal

Activity of a Neem Tree Extract (Azadirachtin)

Against Mosquito Larvae in the Republic of Algeria.

Jordan J Biol Sci. 2:15-22.

AMCA (1970). Manual for mosquito rearing and

eaperimental techniques. Am Mosq Control Assoc.

INC, 109 pp.

Aravind G, Bhowmik D., Duraivel. S and Harish.G.

(2013) Traditional and Medicinal Uses of Carica

papaya. J Med Plants Studies 1(1): 7-15.

Chavez (2011.) Antifungal activity in ehanolic extracts

of carica papaya L cv Maradol leaves and seeds.

NCBI. 1 (51), 54-60.

5

EL Maghrbi et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:1-6

. Choochote W, Tuetun B, Kanjanapothi D,

Rattanachanpichai E, Chaithong U, Chaiwong P,

Jitpakdi A, Tippawangkosol P, Riyong D and

Pitasawat B (2004). Potential of crude seed extract

of celery, Apium graveolens L., against the

mosquito Aedes aegypti (L.) (Diptera: Culicidae). J

Vector Ecol. 29 (2): 340-346.

Coello MJ, Marín EG, Pacheco AO, Gutiérrez SP and

Viana YA (2013). Assessment of the Anti-Protozoal

Activity of Crude Carica papaya Seed Extract

against Trypanosoma cruzi Molecules 18, 12621-

12632.

Consoli RAGB, Olivera, AB. Grandi TS, M; Macedo,

ME and Anjos, AMG (1991). Larvas eclodidas de

ovos de Aedes fluviatilis (Diptera: Culicidae) postos

em extratos de vegetais da Familia Compositae

provenientes de Minas Gerais. IV Jornada Cientifica

de Fundacao Oswaldo Cruz. 1 a 3 de dezebro de

1991 – Escola de Saude Publica/FIOCRUZ/Rio de

Janeiro – Anais (D.37).

Dhanasekaran S, Krishnappa K, Anandan A and

Elumalai K. (2013) Larvicidal, ovicidal and

repellent activity of selected indigenous medicinal

plants against malarial vector Anopheles stephensi

(Liston.), dengue vector Aedes aegypti (Linn.) and

Japanese encephalitis vector, Culex tritaeniorynchus

(Giles.) (Diptera:Culicidae). J Agric Technol. 9(1):

29-47.

EL Maghrbi A. A. (2013) Activity of Some Plant

Extracts on the Eggs and Larvae of Aedes Fluviatilis

in the Laboratory. WASET. 75:498-500.

EL Maghrbi AA and Hosni MM (2014). Influence of

some plant extracts on the ovi-position behavior of

Aedes fluviatilis and Culex quinquifasciatus.

International J Vet Sci Med. 2: 95–98.

Evans DA, and Raj RK, (1988). Extracts of Indian

plants as mosquito larvicides. Indian J Med Res.

88:38-41.

Grandi TS. M, Trinidade JA, Pinto MJF, Ferreira LL

and Catella AAC (1989). Plantas medicinais de

Minas Gerais, Brasil. Acta Bot Bras. 3: 135.

Georghiou GP (1980). Mosquito resistance to

insecticides. Californ. Agriculture,

Kloss H, Thiongo FW, Ouma JH and Butterworth AE

(1987). Preliminary evaluation of some wild and

cultivated plants for control in Machakos Distict,

Kenya. J Trop Med Hyg. 90:197-204.

Masamba WRL, Kamanula JFM, Henry EMT and

Nyirenda GKC (2003). Extraction and analysis of

Lemongrass (Cymbopogon citratus) oil: An essential

oil with potential to control the larger Grain Borer

(Prostephanus truncates) in stored products in

Malawi. Malawi J Agric Sci. 2 (1):56-64.

Marbberly DJ (1987). The plant book, Cambridge

University, press, Cambridge. 706 pp.

Mwangi RW and Rembold H (1988). Growth inhibiting

and larvicidal effect of Melia volkensii extracts on

Aedes aegypti larvae. Entomol Exp Appl. 46: 103-

108.

Osmani Z and Sighamony S (1980). Effects of certain

essential oils on mortality and metamorphosis of

Aedes aegypti. Pesticides 14:15-16.

Pessoa and Martins, (1988). Parasitologia Medica. 11a

adicao. Guanabara Koogan, Rio de Janeiro, 872 pp.

Rafikali AM, Russel SR and Muraleednaran GN

(2000). Bioactive compounds and 1,3-Di [(cis)-9-

octadecenoyl]-2-[(cis,cis)-9-12-octadecadienoyl]

glycerol from Apium graveolens L. seeds J Agric

Food Chem. 48: 3785-3788.

Rafikali AM and Muraleednaran GN (2001).

Mosquitocidal, nematicidal and antifungal

compounds from Apium graveolens L. seeds J Agric

Food Chem. 49: 142-145.

Rahuman AA, Bagavan A, Kamaraj C, Vadivelu M,

Abduz Zahir A, Elango G and Pandiyan G.(2009).

Evaluation of indigenous plant extracts against the

larvae of Culex quinquefasciatus Say (Diptera :

Culicidae). Parasitol Res. 104:637-643.

Sherwani SK, Khan MM, Khan MU, Shah MA and

Kazmi SU (2013). Evaluation of in Vitro

anthelmintic activity of Cymbopogon citratus

(lemongrass) extract. IJPLS.4 ( 6):2722-2726.

Sukumar K, Perich MJ and Boobar LR (1991).

Botanical derivatives in mosquito control: A

Review. J Am Mosq Cont Assoc. 7: 210.

Supavarn P Knapp FW and Sigafus R (1974).

Biologically active plant extracts for control of

mosquito larvae. Mosq News. 43:398-402.

Warikoo R, Wahab N and Kumar S (2011).

Oviposition-altering and ovicidal potentials of five

essential oils against female adult of the dengue

fever Aedes agypti L. Parasitol Res.109:1125–1131.

Zebitz CP (1984). Effect of some crude and

azadirachtin enriched neem (Azadirachta indica)

seed kernel extracts on larvae of Aedes aegypti.

Entomol Exp Appl. 35:11-16.

6

Bushwereb et al.

L .J. V. M. Sci. (2015) Vol. 1 (1): 1-4.

Molecular Analysis of Factor VIII (F8) Gene Mutations and Its Detection in

Libyan Patients with Hemophilia A

Nadia N. Essarbout1 Mohamed B. Marwan

2,3,4, Rasem K. Alajnaf

5, Amel A. Essarbout

1, Alttaf N.

Essarbout4 and Refaat M. Tabagh

2*

¹Department Of Public Health / Faculty of Medical Technology, University of Tripoli, Tripoli-Libya

²Department of Zoology, Faculty of Science, University of Tripoli, Tripoli-Libya

³Department of Paediatric Oncology Hematology, Tripoli Medical Center, Tripoli-Libya

4Group of Blood Researchs, Biotechnology Research Center, Twesha, Libya 5Polyclinic of Airport Road, Tripoli, Libya

Received 8 October 2015/ Accepted 18 November2015

Key words: Factor VIII, Hemophilia A, PCR, Restriction enzyme, Exons 23, 24, and 26 A+B, Molecular analysis

Introduction

The X-linked coagulation disorder hemophilia A

(HA) is caused by mutations in the factor 8 (F8) gene,

this gene encodes coagulation factor VIII (FVIII) and is

located at Xq28, in the end of the long arm of the X

chromosome, telomeric region (Alan et al.1987).The

patients with severe hemophilia A have a factor VIII

(FVIII) activity level of less than 0.01 IU/ mL. Severe

hemophilia has changed from a debilitating disease to a

condition with a good quality of life (Dorain et al.2003;

Santacroce et al.2008). Studies show great advances in

efficacy and safety of FVIII products and treatment

strategies have made this possible, Factor VIII (FVIII)

is an essential blood-clotting protein, also known as

anti-hemophilic factor (AHF) (Plug et al.2008).The F8

gene mutation type is the most important predictors of

the risk of inhibitor development in hemophilia A

(Scwaab et al. 1995; Ter et al.2008).

Gouw et al. (2012) reported that the meta-analysis

confirm earlier reports that the F8 genotype is an

important determinant of inhibitor development in

patients with severe hemophilia A. The inhibitor risk in

large deletions and nonsense mutations was higher than

in intron 22 inversions, the risk in intron 1 inversions

and splice site mutations was equal and the risk in small

deletions/insertions and missense mutations was lower.

Coagulation factor VIII is made chiefly by liver

sinusoidal cells and endothelial cells throughout the

body (Kumaran et al. 2005). This protein circulates in

an inactive form in the bloodstream and bound to the

other molecule called von Willebrand factor, until

occurs damages in blood vessels. When injuries take

place, coagulation factor VIII is activated and separates

from von Willebrand factor (Sadler et al, 1998). The

severity of hemophilia A is determined by the level of

clotting activityof factor VIII in the blood (Millar et al.

1990).

In haemophilia A patients with the same mutation in

the F8 gene show heterogenous bleeding phenotypes.

Specific mutations in the A2 domain of factor VIII are

associated with mild haemophilia and a higher risk of

inhibitor development, so a double mutation in mild

haemophilia A are rarely reported (Bakija et al.2005).

In general Hemophilia A is a single gene disorders,

this group is determined primarily by a single mutant

gene and follows the Mendelian pattern of inheritance.

Hemophilia is caused by mutation in the F8 gene.

Hundreds of mutations in this gene have been

identified. These span a diverse range of mutation

types, namely, missense, splice-site, deletions of single

and multiple exons, inversions, etc. The gene for factor

VIII was cloned in 1984. The factor VIII gene size is

186 kb and contains 26 exons and 25 introns. The exon

length varies from 69 to 262 nucleotides except for

exon 14 which is 3106 nucleotides long and exon 26

which has 1958 nucleotides. Also there are six long

introns of more than 14 kb, such as intron 22 which is

32 kb long. (Antonarakis and Kazazian 1988;

Antonarakis 1995).

Original article

Abstract Hemophilia A is an X linked recessive hemorrhagic disorder caused by mutations in the F8 gene that lead to qualitative

and/or quantitative deficiencies of coagulation factor VIII (FVIII). Molecular diagnosis of hemophilia A is challenging

because of the high number of different causative mutations that are distributed throughout the large F8 gene. Molecular

studies of these mutations are essential in order to reinforce our understanding of their pathogenic effect responsible for

this disorder. The present study aimed to obtain data on sequence variation in F8, a set of functionally validated control

chromosomes of Libyan descent; we have performed for the first time molecular analysis of F8 in 43 Libyan hemophilia

patients. This study included 63 cases 43 patient, 10 Carrier, and 10 Control, Amplifying of F8 by using PCR technique,

and identification of mutations by using restriction enzyme Taq I for exon 23. Our results showed the presence of partial

deletions in two brother patients in exon 23 this result had been concluded refer to areas that failed to be amplified by

PCR. Our study may contribute to the knowledge on the risk factors of inhibitor development that allows libyan clinicians

to assess whether an individual patient is at high risk.

Libyan Journal of Veterinary and Medical Sciences December 2015 Vol. 1 (2): 7-12

*Corresponding Author: Refaat Mohamed Tabagh, Department of Zoology, Faculty of science, University of Tripoli.

Tripoli, Libya. Tele.+ 218092 404 65 67. E.mail: Refaat_tb@yahoo.com.

7

Essarbout et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:7-12

. Hemophilia A is also known as classic Hemophilia

(Alan and David 1987; Gad et al.1999; Lloyd and

Samuel 1985). It is the most common type of this

disease, affecting 1 from 10,000 males worldwide (Gad

et al.1999; Mannucci and Tuddenham 2001). The

severity of hemophilia A is determined by the level of

clotting activity of factor VIII in the blood. There are

levels of severity of hemophilia, mild from 5 to 30 % of

normal, moderate from1 to 5% of normal, and severe

less than 1% of normal (Taq 2007). Hemophilia usually

affects only males, because the hemophilia gene is

carried on the same chromosome that determines

whether the person is male or female, The

chromosomes that determine the person's sex are called

X and Y. Males have an X and a Y chromosome and

Females have two X chromosomes (Plug et al.2008).

Materials and methods

Blood samples collection

This study included 43 Patient (40 Male, 3 Female),

10 Carrier, and 10 Control (8 Male, 2 Female) the total

is 63 cases. Blood samples were collected from Libyan

patients (Department of Pediatric Oncology, Tripoli

Medical Center). Five ml of blood were drawn from

each patient and collected in tube containing EDTA and

kept in freezer (-20ºC).

The blood samples were transported to DNA

Laboratory, Human's Tissues Department and the

Genetic Engineering Department , Biotechnology

Research Center, Twesha – Libya, for DNA Studies

Amplifying of F8 by using Polymerase Chain

Reaction( PCR ) technique, and identification of

mutations by using restriction enzyme Taq I for exon 23

, exon 24 , and exon 26 A+B for researching for

mutation in Exon 23, 2147 , CGA to TGA (Arg to

Stop), Exon 24 , 2209, CGA to TGA (Arg to Stop), and

Exon 26 A+B, 2307, CGA to TGA (Arg to stop).

Genomic DNA Extraction and Primers

DNA was extracted from frozen blood samples by

QIAamp DNA Blood Mini Kit from Qiagen.

Oligonucleotide primers used to amplify exons of factor

VIII are listed in table (1).

Amplification of F8 gene by Polymerase Chain

Reaction (PCR) condition: The PCR was performed in

a final volume of 50L containing 100ng genomic

DNA, 125μM each dNTP, 200 nM of primers 1.5MM

MgCl2 and 1 U of Taq DNA polymerase (Invitrogen).

The 30 -40 cycle amplification program was carried out

in a thermocycler T100 Thermal cycler BIO-RAD

(Table1).The steps of PCR were as follows:

denaturation, 30 sec at 95 ºC , annealing 30 sec at 50-60

ºC, extension 30 sec at 72 ºC and final extension step 6

min at 72 ºC (Saiki et al.1988; Saiki et al.1985).

Restriction enzyme analysis

The PCR products from the amplification were

digested with Taq 1. PCR reaction mixture 10 µL (~0.1-

0.5 µg of DNA),nuclease-free water 18 µL,10X Buffer

TaqI 2 µL, TaqI 1-2 µL, Incubate under paraffin oil in a

capped vial at 65°C for 1-16 hours. Stop the digestion

reaction by adding 0.5 M EDTA, pH 8.0 (#R1021), to

achieve a 20mM final concentration. Mix thoroughly,

add an electrophoresis loading dye and load onto gel.

The digests were electrophoresed on 2%

gelelectrophoresis and the restriction enzyme pattern

was visualized after staining the gel with ethidium

bromide (Table2) (Taq1 BIORON GmbH).

Table 1: Oligonucleotide primers for PCR Analysis of Factor VIII.

Exon 5' Primer 3' Primer Size of PCR

fragment (bp)

23 5'- GAAGGAAGATATGATTGACAGA -3' 5'- AACTAGAACAGTTAGTCACC -3' 258

24 5'- ATAACTGAGGCTGAAGCATG -3' 5'- GTAGATCTGTTGCCTCTTACC -3' 242

26(A+B) 5'- GCTTTGCAGTGACCATTGTC -3' 5'- AGCTGAGGAGGGAGAGGTGA -3' 192

Table 2: Restriction Enzyme used in this study.

Name Restriction

Enzyme

Source of Restriction

Enzyme Recognition Sequence

Number of Cuts in F8

Gene

Taq I Thermus aquaticus bacterium

BIORON GmbH 5'…T ^ CGA…3'

3'…AGC ^ T…5'

87 position

Results

Analysis of three Taq I sites in exons 23, 24 and 26

(A+B) in studied patients at Two patients with a

moderate form of the disease demonstrated an abnormal

electrophoretic pattern in exon 8 and sequencing by

DNA Sequencing Capillary Electrophoresis from

Applied Biosystem and analyzed by SeqScape

Software, this software demonstrated missense

mutations at codon 2147 for arginine within a thrombin

activation site. These mutations were C to T transitions

changing a CGA codon for arginine to a TGA

termination codon, Results had been reached in this

study showed the presence of tow partial deletions in

two brother patients in exon 23 had been conclude refer

to areas that failed to be amplified by PCR (Figure 1, 2

and 3). Previous studies showed that Partial deletion in

8

Essarbout et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:7-12

exons of FVIII gene refer to do not amplify by PCR

(Table3).conclude refer to areas that failed to be

amplified by PCR.

Table 3: Previous studies show that Partial deletion in

exons of FVIII gene refer to do not amplify by PCR .

Exon Severity References

23 Moderate J-M Lavergene et al. (1992)

24 Moderate J-M Lavergene et al. (1992)

23-24 Moderate J-M Lavergene et al. (1992)

23-26 Sever J-M Lavergene et al. (1992)

26 Sever J-M Lavergene et al. (1992)

24-25 - Vidal et al. (2002)

25 - Vidal et al. (2002)

25-26 - Vidal et al. (2002)

23 mild In this study

Figure 1: Detection of the Partial deletion [ Exon 23, codon 2147, (Arg Stop)] by Taq I digestion of the 291bp of amplified

fragment to 145bp and 146bp this case is normal, but when does not cut is abnormal case. Lane M: DNA Marker. 7, 8,9,10 No PCR

Product caused by Partial Deletion. Lanes: 1, 2,3,4,5,6,11,12,13,14 are normal for the nonsense mutation of codon 2147, (Arg

Stop). (PP=PCR Product; RE= Restriction Enzyme; N=Normal; CM=Carrier Mother; (+) With Mutation; (-) Without Mutation;

♀=Female; ♂=Male, Taq Icut innormal allele.

Figure 2: Gel electrophoresis of the amplicons of exon 24 For FVIII gene, size of PCR Productis 224 bp

and Taq I restriction digestion gives two fragments. The size of the first fragment is 62 bp and the second

is 162 bp. Lane M DNA Ladder (50-1000 bp); Lane 1P/N ♂; 1R/N-♂; 2P/H♂; 2R/H- ♂. P=PCR Product;

R= Restriction Enzyme; N=Normal Case; H=Hemophiliacs; (-) Case Without Mutation;♂=Male;

Taq Idigested innormal allele.

9

Essarbout et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:7-12

.

Figure 3: Gel electrophoresis of amplicon of exon 26 (A+B) of FVIII gene. Size of PCR Productis 264 bp

and Taq I restriction digestion gives two fragments. The size of the first fragment is 104 bp and the second is

160 bp.(The DNA sequencing by Sequencing Capillary Electrophoresis from Applied Biosystem and analyzed

by SeqScape Software, this software) Lane M DNA Ladder (50-1000 bp); Lane1P/N ♂; 1R/N-♂;2P/H♂; 2R/H- ♂;

3P/H ♂; 3R/H- ♂. P=PCR Product;R= Restriction Enzyme; N=Normal Case; H=Hemophiliacs; (-) Case Without Mutation;

♂=Male; Taq Idigested innormal allele.

The patients divided into three groups according to

severity 19 Severe, 8 Moderate and 16 Mild (Table 4).

People with hemophilia A often bleed longer than other

people, bleeds can occur internally, into joints and

muscles, or externally, from minor cuts, dental

procedures or trauma. How frequently a person bleeds

and the severity of those bleeds depends on how much

FVIII is in the plasma, the straw-colored fluid portion

of blood.

Normal plasma levels of FVIII range from 50% to

150%. Levels below 50%, or half of what is needed to

form a clot, determine a person’s symptoms. Mild

hemophilia A 5% up to 30% of FVIII in the

blood. People with mild hemophilia Agenerally

experience bleeding only after serious injury, trauma or

surgery. In many cases, mild hemophilia is not

diagnosed until an injury, surgery or tooth extraction

results in prolonged bleeding.

Moderate hemophilia A 1% up to 5% of FVIII in the

blood. People with moderate hemophilia A tend to have

bleeding episodes after injuries; bleeds that occur

without obvious cause are called spontaneous bleeding

episodes. Severe hemophilia A <1% of FVIII in the

blood, people with severe hemophilia A experience

bleeding following an injury and may have frequent

spontaneous bleeding episodes, often into their joints

and muscles (Pavlova and Oldenburg 2013).

Results had been reached in this study showing the

presence of partial deletions in tow brothers patients in

exon 23had been concluded refer to areas that failed to

be amplified by PCR, the sequencieng of this exon

confirm the presence of this tow mutions.

Discussion

The present study is concerned with screening of

some Libyan studied patients with hemophilia A and

the aim of the study was to identify CGA to TGA

mutation by Taq I restriction enzyme in exons 23 , 24 ,

and 26 A+B for the factor VIII (F8) gene that causes

hemophilia A among Libyan patients . Amplification of

areas that contain restriction enzyme sites such as Taq I

with CG dinucleotides in their recognition sequence are

especially useful locations to begin a rapid screeing of

hemophiliacs for mutations. Analysis of the five Taq I

sites in exons 18, 22, 23, 24, and 26 shows that there are

three nonsense mutations in patients HA579, HA360

and HA735 at codons 1941, 2116, and 2209,

respectively (Lavergne et al.1992).

These mutations were C to T transitions changing a

CGA codon for arginine to a TGA termination codon.

The patients all suffered with severe hemophilia

(Lavergne et al.1992). In this study no mutation of three

Taq I sites in coding region of factor VIII gene have an

in-frame CGA codon for arginine. In other studies it

was found that partial deletions involving exons 23, 24,

23-26 and 26 are resulted in severe hemophilia A cases

(Gitschier et al.1986; Youssoufian et al.1987; Lozier

2004). Exons 24-25, 25, 25-26, 23and 24 failed to

amplify in patients. This is the first example of a

moderate form of hemophilia A associated with a

deletion involving two exons (Lavergne et al.1992) in

this study partial deletions for mild hemophilia A in

exon 23 of the factor VIII for two patients of 43 patients

i.e approximately 4.65% of causative mutation in exon

23 failed to amplify in two brother patients.

These data may contribute to the knowledge on the

risk factors of inhibitor development that allows libyan

clinicians to assess whether an individual patient is at

high risk. We performed study of various types of F8

mutations and we obtained more precise estimates of

the relative risks according to the F8 genotypes in

patients with hemophilia A.

Further investigation will be continue this study on

patients from our Hemophilia Treatment Center in order

to reinforce our understanding in the molecular defect

of hemophilia A in Libya and to set up counseling

genetic and the prenatal diagnosis for Libyan families

with hemophilia A. Our study provides more precise

estimates of the relative risks for different F8 genotypes

10

Essarbout et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:7-12

. relative to exon 24 in libyan patients with Hemophilia

A. In future research on other possible genetic and

nongenetic risk factors, the predisposition related to the

hemophilic genotype should be taken into account. The

epigenetics study and gene gene interaction may open

new approaches, will facilitate a study about

implication of factor 8 gene in the ethiology of

hemophilia. The design of antagonistic inhibitors of the

factor VIII system (Lozier 2004; Fang et al.2007) could

provide novel anticoagulants for the treatment of

thrombotic disorders (Lavigne et al.2005).

Acknowledgements

We would like to express our sincere and thanks to

the staff of Biotechnology Research Center including

specifically: General director Prof. Dr. Mohamed El

sharief; Head of Genetic Engineering Department; Dr.

Amar Elslughy; Dr. Abdulmunam Abulayha and Eng.

Essam Sharfeddin.

References

Alan RG and David LL (1987). Hemophilia A (Factor

VIII deficiency) and related disorders ; Medicine

International (Hematology). Published by The

Medicine Group 42:1732-1736.

Antonarakis SE and Kazazian HH (1988). The

molecular basis of hemophilia A in man. Trends

Genet. 4:233-237.

Antonarakis SE (1995). Molecular Genetics of

Coagulation Factor VIII Gene and Hemophilia A.

Thromb Haemost. 74:322-328.

Bakija AT, Debeljak M, Zupan IP, Dolničar MB, Kovač

J and Jazbec J (2015). Specific and global

coagulation tests in patients with mild haemophilia

A with a double mutation (Glu113Asp, Arg593Cys).

Blood Transfus. 13:622-630.

Dorian J. Pritchard and Bruce R. Korf (2003); Oxford

Blackwell Science Publishing ; Medical Genetics at

a Glance, 115 pp.

Fang H, Wang L and Wang H (2007). The protein

structure and effect of factor VIII. Thromb

Res. 119:1–13.

Gad El- Mawla AG and El-Nahass MR. (1999).

Medical Physiology Blood. Dar El-Wafaa for

Printing ,Publishing & Distribution. Egypt. 186 pp.

Gitschier J, Wood WI, Shuman MA and Lawn RM

(1986). Identification of a missense mutation in the

factor VIII gene of a mild hemophiliac. Science

232:1415-1416.

Gouw SC, Marijke van den Berg H, Oldenburg J,

Astermark J, Philip G de Groot, Margaglione M,

Thompson A R., Waander van Heerde, Jorien

Boekhorst, Connie H. M, Saskia le Cessie and van

der Bom JG. (2012). F8 gene mutation type and

inhibitor development in patients with severe

hemophilia A: systematic review and meta-analysis.

Blood 119: 2922–2934.

Kumaran V, Benten D, Follenzi A, Joseph B, Sarkar R

and Gupta S (2005). Transplantation of endothelial

cells corrects the phenotype in hemophilia A mice. J

Thromb Haemost. 3:2022-2031.

Lavergne JM, Bahnak BR, Vidaud M, Laurian Y and

Meyer D (1992). A directed search for mutations in

hemophilia A using restriction enzyme analysis and

denaturing gradient gel electrophoresis ( A study of

seven exons in the factor VIII gene of 170 cases.

Nouv Rev Fr Hematol. 34: 85-91.

Lavigne-Lissalde G, Schved JF, Granier C and Villard

S (2005). Anti-factor VIII antibodies: a 2005

update. Thromb Haemost. 94: 760–9.

Lloyd HS and Samuel OT (1985). Pathophysiology

(The Biological Principles of Disease) (2nd Ed.);

W.B.Saunders Company; Philadelphia, London,

Toronto, Mexico City, Rio de Janeiro, Sydney,

Tokyo, HongKong, 1372pp.

Lozier J (2004). Overview of Factor VIII Inhibitors.

CMEonHemophilia.com. Retrieved 2009-01-07.

Mannucci PM and Tuddenham EG (2001). The

Hemophilias - From Royal Genes to Gene Therapy.

N Engl J Med. 345:384.

Millar DS, Steinbrecher RA, Wieland K, Grundy CB,

Martinowitz U, Krawczak M, Zoll B , Whitmore D,

Stephenson J , Mibashan RS, Kakkar VV and

Cooper DN (1990). The molecular genetic analysis

of haemophilia A; characterization of six partial

deletions in the factor VIII gene. Hum Genet.

86:219-227.

Pavlova A and Oldenburg J (2013). Defining severity

of hemophilia: more than factor levels. Semin

Thromb Hemost.39:702-10.

Plug I, Peters M, Eveline P. Mauser-Bunschoten, Arja

de Goede-Bolder, Lily H, Smit C, Willemse J,

Rosendaal FR and Johanna G. van der Bom (2008).

Social participation of patients with hemophilia in

the Netherlands. Blood. 111:1811-1815.

Sadler JE (1998).Biochemistry and genetics of von

Willebrand factor. Annu Rev Biochem. 67:395-424.

Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT,

Erlich HA and Arnheim N (1985). Enzymatic

amplification of B-globin genomic sequences and

restriction site analysis for diagnosis of sickle cell

anemia. Science 230:1350-1354.

Saiki RK , Gelfand DH, Stoffel S, Stephen J. S,

Higuchi R, Horn GT, Mullis KB and Erlich HA

(1988). Primer- directed enzymatic amplification of

DNA with a thermostable DNA polymerase. Science

239:487.

Santacroce R, Acquila M, Belvini D, Castaldo G,

Garagiola I, Giacomelli SH, Lombardi AM, Minuti

B, Riccardi F, Salviato R, Tagliabue L, Grandone E

and Margaglione M (2008). Identification of 217

unreported mutations in the F8 gene in a group of

1,410 unselected Italian patients with hemophilia A.

J Hum Genet. 53:275–284.

Schwaab R, Brackmann HH, Meyer C, Seehafer J,

Kirchgesser M and Haack A (1996). Haemophilia

11

Essarbout et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:7-12

A: Mutation type determines risk of inhibitor

formation. Thromb Haemost.74:1402-1406.

Ter Avest PC, Fischer K, Mancuso ME, Santagostino E,

Yuste VJ, Van Den Berg H M and Van Der Bom

JG (2008). Risk stratification for inhibitor

development at first treatment for severe

haemophilia A: a tool for clinical practice. J Thromb

Haemost. 6:2048-2054.

Youssoufian, H, Antonarakis SE, Aronis S, Tsiftis G,

Phillips DG and Kazazian, HH Jr (1987).

Characterization of five partial deletions of the

factor VIII gene. Proc Nat Acad Sci. 84: 3772-3776.

12

Bushwereb et al.

L .J. V. M. Sci. (2015) Vol. 1 (1): 1-4.

Study of Serotonin Transporters Gene in Sporadic Amyotrophic Lateral

Sclerosis in French Population

Julien Praline1,2

, Refaat M.Tabagh1,4*

, Maïté Amy1,2

, Patrick Vourc’h1,2,3

, Christian Andres1,2,3

and Philippe

Corcia1,2

¹Inserm U930, CNRS 2448, Tours, France,

²Universite´ Francois-Rabelais, Tours, France,

³CHRU de Tours, Laboratoire de Biochimie et BiologieMole´culaire, Tours, France, 4Zoology Department / Faculty of Science / University of Tripoli-Libya.

Received 11 October 2015/ Accepted 18 November 2015

Key words: Amyotrophic lateral sclerosis, 5HTTLPR, serotonin transporter, Genotypes, PCR

Introduction

Amyotrophic lateral sclerosis (ALS) is a fatal

neurodegenerative disorder described worldwide.

During the last 10 years, an extensive literature has

focused on genetic susceptibility factors in populations

from different origins. Currently, there is no universal

genetic factor associated with the majority of ALS

cases.

Amyotrophic lateral sclerosis (ALS), sometimes

called Lou Gehrig's disease, is a rapidly progressive,

invariably fatal neurological disease that attacks the

nerve cells and responsible for controlling voluntary

muscles (muscle action we are able to control, such as

those in the arms, legs, and face) (Kelly 2013). The

disease belongs to a group of disorders known as motor

neuron diseases, which are characterized by the gradual

degeneration and death of motor neurons (Ellison

2008).

ALS is characterized by stiff muscles, muscle

twitching. This results in difficulty speaking,

swallowing and eventually breathing (NINDS 2010).

The cause is not known in 90% to 95% of cases; about

half of these genetic cases are due to one of two

specific genes; it results in the death of the neurons that

control voluntary muscles and the diagnosis is based on

a person's signs and symptoms with testing done to rule

out other potential causes (NINDS 2015). About 5–10%

of cases are inherited from a person's parents (Kim and

Camilleri 2000).

We suggest two ideas the first that neurotransmitters

in particular the serotonin can have a net impact on the

phenotype, functional statue and survival. The second

we suggests that neurotransmitters transporter probably

involved in these modifications both in human and

SOD1 transgenic mice. These results showing the

involvement of serotonin in the rigidity, we propose to

analyses the polymorphism of this gene 5-HTT

serotonin transporter carries neurotransmitter to search

for a possible association between this gene and clinical

parameter ALS patients.

The serotonin is a neurotransmitter existing in both

central nervous systems (CNS) and GI tracts, and

regulates visceral sensation through a paracrine

signaling pathway (Kim and Camilleri 2000). Previous

studies have shown that elevated plasma serotonin is

associated with IBS-D and decreased plasma serotonin

is associated with IBS-C (Atkinson et al. 2006). The

serotonin secreted by enterochromaffin (EC) cells

which not attached to postsynaptic membrane and still

Original article

Abstract Amyotrophic lateral sclerosis (ALS) is a rapidly progressive, invariably fatal neurological disease that attack the

nerve cells and responsible for controlling voluntary muscles. The disease belongs to group of disorders known as motor

neuron disease which are characterized by gradual degeneration and death of motor neurons. Serotonin is a

neurotransmitter existing in both central nervous systems (CNS) and gastrointestinal tracts (GI) and regulates visceral

sensation through a paracrine signaling pathway. Our objective was to study if there is a link between the 5-HTTLPR

(Linked Polymorphism Region) allele of the serotonin transporter gene and the existence of pyramidal or extra-pyramidal

rigidity in different subgroup of ALS patients. This gene has never been studied in ALS. We analyzed the functional

polymorphism 5-HTTLPR of the SLC6A4 serotonin transporter gene in 209 patients with ALS and 214 control

population of 214 individuals. All subjects were of French origin dating at least three generations. The DNA was

extracted from blood cells. The analysis of polymorphism HTTLPR localized in the promoter of the gene of the

transporter of the serotonin (SCL6A4) was performed after PCR in 100ng of DNA. The results are analyzed by agaros gel

electrophoresis (2 %). We obtained tow bands LL genotype with 512pb or the short allele SS with 469pb. We found no

significant differences in allele and genotype frequencies in this 5-HTTLPR polymorphism studied in the SLC6A4 gene

of ALS patients versus control patients. However, further studies will be necessary to fully reject the implication of

SLC6A4in SLA. Indeed the expression of this gene is regulated by epigenetic processes, and these may still be impaired

in SLA. Moreover, effects on mRNA splicing, protein localization, and properties of 5-HTT could be possible

mechanisms for influencing SLA risk.

Libyan Journal of Veterinary and Medical Sciences December 2015 Vol. 1 (2): 13-17

*Corresponding Author: Refaat Mohamed Tabagh, Department of Zoology, Faculty of science, University of Tripoli.

Tripoli, Libya. Tele.+ 218092 404 65 67. E.mail: Refaat_tb@yahoo.com.

13

Praline et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:13-17

. in the synaptic cleft, this serotonin will be activated to

reuptake the serotonin back mechanism by the

transporter (SERT) and allow the retune of the

serotonin into enterochromaffin EC cells and activate

the effect of serotonin in GI tracts subsequently

(Bertrand and Bertrand 2010).

Pharmacological and genetic studies also support a

role for serotonin in corticogenesis, and brain

development in general, even prior to the formation of

synapses (Wellman et al 2007). One key regulator of

serotonin levels in the cortex and hippocampus is the

serotonin transporter (5-HTT), which is involved in the

reuptake of extracellular serotonin (Mamounas et al.

2000; Salichon et al. 2001). 5-HTT is a Na+/Cl-

dependant membrane transporter encoded by the

SLC6A4 gene (solute carrier family 6 member 4;

17q11.2) (Figure 1) (Heinz 2005). A polymorphism

(5HTTLPR) in the promoter region of SLC6A4

determines the neuroanatomical size and functional

coupling of the amygdala-frontal cortical circuit in

humans (Pezawas et al. 2005; Watson et al. 2008).

Figure 1: Schematic structure of the human SLC6A4

gene. Non-coding and coding exons are indicated by

white and black boxes, respectively. Locations of the

genotyped polymorphisms and alternative splicing are

indicated.

In present 70% of subjects of European populations

(Heils et al. 1995), it is frequency is lower in African

populations (37%) but nearly augment in Asian 90% in

term of frequency, the second allele (Heils et al. 1995).

Allele 4, 5 and 6 are very rare in Europe (Meyer-

Lindenberg et al. 2005).

Multiple genetics studies have shown a significant

association between the number of repetitions and

neurological disease. In promoter region of SLC6A4

gene the 5HTTLPR polymorphism determines the

neuroanatomical size and functional coupling of the

amygdala-frontal cortical circuit in humans (Heinz

2005). This circuit has been implicated in several

psychiatric disorders including Fragile X and Williams

syndrome, this two pathologies characterized by mental

deficiency (Pezawas et al. 2005).The association

between VNTR polymorphism and psychiatric disease

has been reported several times (Mazer et al. 1997).

These results demonstrate the importance of studying

the frequency of alleles of the VNTR in ALS to

determine if an association exists between the VNTR

genotype and presence of rigidity.

The serotonin transporter (5HTT) is a protein of 630

amino acids of the family Na+ dependent transporters,

with 12 transmembrane domains. The serotonin

transporter gene (SCL6A4) is located 17q11 near

NF1gene and bleomycin hydrolase gene. The SCL6A4

gene consists of 16 exons and extends over 38kb

(Bradley et al. 1997).

Among the described various polymorphisms, some

have functional effects, the polymorphism most studied

are: The insertion-deletion of 44pb in the promoter

region 5` (5-HT Transporter Linked-Polymorphic

Region, HTTLPR). This polymorphism is arepetition of

a member of 20-23pb. The allele contains 14 repeats

(Short S) and 16 repeats (Long L) U 18 repeats (very

long) (Heils et al. 1995). The allele is associated with

increased expression of RNA messanger in vitro (Heils

et al. 1996), And in vivo (Murphy et al. 2004).

A variable number of tandems repeat (Variable

Number of Tandem Repeats VNTR) intron 2 (Lesch et

al. 1994). The allele contains 12 repetitions are more

expressed but this expression also depends on

sequential variations and the tissues were the alleles are

expressed. A version of G to T in the site of

polyadenylation in the UTR3` region (5-HTT3`UTR-

Variant) (Kim et al. 2002), these allelic variant have

been studied in numerous pathology neuropsychiatric

.A lot of articles have been published on the subject last

10 years in particular depression, bipolar disorder,

mood, suicide, autism, and attention hyperactivity

deficit disorder.

SS genotype of 5-HTTLPR is associated with a risk

of depression or not correlate with treatment anti

depression, another neurological disease are studies for

example pulmonary hypertension, the genotype SS is

associated with late onset of Alzheimer disease and the

depression in the Parkinson`s disease (Meyer-

Lindenberg et al. 2005). This study was designed to research if there is association between polymorphism

5-HTTLPR of the gene encoding serotonin transporter

and the ALS phenotype according to weather patients

are rigid (extra-pyramidal rigidity, pyramid or not rigid)

after genotype study by PCR of ALS patients and

control (healthy subjects).

Materials and methods

Currently 209 patients with sporadic defined ALS

and 214 probable or possible controls were included in

this study, Clinical data and blood samples, collected

between 1996 and 2012, were obtained from 209 SALs

patients and 214 controls. We have our DNA bank

which reserved in -20Callowed us to use the DNA bank

for many years and we have a tissue culture of the

patients which reserved in -70 permitting us to use

DNA extraction and use our DNA bank for a long time

(over 100 years). The participants signed consent forms

approved by Medical Ethical Review Boards in French

that adhere to the principles described in the

Declaration of Helsinki. All subjects were of French

origin dating at least three generations. To maintain

comparability between groups, patients and controls

living in France, but of other ethnicity, were excluded

from the study.

The DNA was extracted from blood cells in the

usual methodology (sambrooke et al. 1989),the analysis

of polymorphism HTTLPR localized in the promoter of

14

Praline et al.

Libyan J. Vet. Med. Sci. Vol. 1(2) December 2015:13-17

the gene of the transporter of the serotonin (SCL6A4)

was performed after PCR in 100ng of DNA with 125

μMdNTP, 2% DMSO, 125 μMbuffer 1X, 0,4 U of

DNA polymerase DyNAzyme EXT (Finnzymes) and

200 pmol of every primer : forward, 5HTTF2 : 5’-

GGCGTTGCCGCTCTGAATGC -3’, reverse, 5HTTR2

: 5’-GAGGGACTGAGCTGGACAACCAC-3’. The

conditions of PCR are : 94°C5 min, 35 cycles à 94°C 30

s, 63°C 1 min, 72 °C 1 m in, puis à 72°C 10 min. The

results are analyzed by Agaros gel electrophoresis (2

%). We obtained tow bands LL genotype with 512pb or

the short allele SS with 469pb like show in the gel

electrophoresis photo (Figure 2).

The frequencies of polymorphism between patients

and controls were compared with a chi2 test. All

analysis was performed with JMP statistical software

version 7.0.2 (SAS) Institute, Cary, NC, USA).Allele

and genotype frequencies in patients and controls were

compared with a Chi test x². Odds ratios were estimated

for alleles and genotype (http://www. hutchon. net/

ConfidOR.htm). Linkage disequilibrium (parameter D’)

between markers was calculated using the software

Haploview v.3.32. LD patterns were analyzed by

Spearman rank correlation (Excel) between LD

measures.

Results

The Comparing genotypes and polymorphisms of

HTTLPR between patients and Controls (Table 1 and

2).The HTTPLR polymorphism is not significantly

associated with the Clinic form (bulbar or spinal) ALS

(Table 3).No significant difference was observed

between two groups of patients in the age of onset

(Table 4).

Figure 2: The PCR amplification step allowed differentiating between the short (S,484 bp)

Versus the long allele (L, 528 bp) of 5 - HTTLPR. Gel agar electrophoresis (2 %).

Table 1: The number of chromosomes and allele frequencies of L and

S HTTPLR for the Patients and controls (χ² = 0.02; p = 0.87).

Alleles Frequencies % Number Frequencies % Number

L 58.4 250 57.9 242

S 41.6 178 42.1 176

Total 100 428 100 418

Table 2: Genotypes of HTTPLR polymorphism for the patients and

controls (χ² = 0.02; p = 0.99).

Genotype Frequencies % Number Frequencies % Number

LL 36.5 78 35.9 75

LS 43.9 94 44 92

SS 19.6 42 20.1 42

Total 100 214 100 209

Table 3: Comparison of allele frequencies L and S HTTPLR between two groups

of patients according to the clinical form of the disease (χ² = 2.85; p = 0.09).

Alleles Frequencies % Number Frequencies % Number

L 47.5 56 56.6 172

S 52.5 62 43.4 132

Total 100 118 100 304

15

Praline et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:13-17

.

Table 4: The comparison of allele frequencies L and S HTTPLR between two

groups of patients according to age of disease onset (²= 0.02; p = 0.88).

Alleles Frequencies % Number Frequencies % Number

L 57.4 58 56.5 95

S 42.6 43 43.5 73

Total 100 101 100 168

Discussion and conclusions:

We here report the first genetic study on the

serotonin transporter gene in ALS, We have

investigated functional polymorphism 5-HTTLPR in

these gene in control individuals and ALS patients

matched for origin (Central France) and ethnicity

(Caucasian). Functional studies have reported that the S

allele of 5-HTTLPR was associated with a lower

expression of 5-HTT and a lower serotonin reuptake

activity (Pezawas et al. 2005).

Our results do not support a direct role for the S

allele of 5-HTTLPR in SLA. These preliminary results

concern the gene of serotonin transporter (SCL6A4).

This gene has never been studied in ALS. We did not

find any association between a polymorphism in the

promoter of this gene and ALS. The numbers of

patients are important enough that this conclusion

considered is solid. We also tried to search in different

disease subgroups (sex, age and ethnical groups) if

there were differences in serotonin transporter gene

genotype. No significant difference could be detected,

noted that the bulbar forms appear to be more S alleles

that spinal forms. This would be to check on a larger

population; in fact we do not have the sufficient

statistical power to conclude with certainty.

Wendland et al. (2006) suggested that the effect of

5-HTTLPR on SLC6A4 expression may be due to a

nearby (19 bp) rs25531 polymorphism in the promoter.

The G allele of this polymorphism is located in a

consensus binding site for AP2, a family of

transcription factors described as positive or negative

regulators of transcription (Eckert et al. 2005). Data

from Hu et al. (2000) has shown that the G allele of

rs25531 was associated with a decreased expression of

5-HTT mRNA compared to the A allele.

Serotonergic signaling systems have significant

interactions with overlapping functional targets

(Pezawas et al. 2005). Genetic epistasis between this

system was confirmed by studies on SLC6A4

transgenic mice (Daws et al. 2007). In the present study

on ALS patients, we observed no genetic interactions

between 5-HTTLPR polymorphism studied in SLC6A4.

However, further studies will be necessary to fully

reject the implication of SLC6A4in SLA. Indeed the

expression of this gene is regulated by epigenetic

processes, and these may still be impaired in SLA.

Moreover, effects on mRNA splicing, protein

localization, and properties of 5-HTT could be possible

mechanisms for influencing SLA risk.

References

Atkinson W, Lockhart S, Whorwell PJ, Keevil B,

Houghton LA. (2006). Altered 5-hydroxytryptamine

signaling in patients with constipation and diarrhea

predominant irritable bowel syndrome.

Gastroenterol. 130:34 – 43.

Bertrand PP and Bertrand RL (2010). Serotonin release

and uptake in the gastrointestinal tract. Auton Neuro

Sci. 153:47–57.

Bradley CC and Blakely RD (1997). Alternative

splicing of the human serotonin transporter gene. J

Neurochem. 69:1356-1367.

Daws LC, Munn JL, Valdez MF, Frosto-Burke T and

Hensler JG (2007). Serotonin transporter function,

but not expression, is dependent on brain-derived

neurotrophic factor (BDNF): in vivo studies in

BDNF-deficient mice. J Neurochem.101:641-651.

Eckert D, Buhl S, Weber S, Jager R and Schorle H

(2005). The AP-2 family of transcription factors.

Genome Biol. 6:246.

Ellison, edited by Seth Love, David N. Louis, David

W. (2008). Greenfield's neuropathology (8th Ed.).

London: Hodder Arnold. p. 947

Kelly Evelyn B. (2013). Encyclopedia of human

genetics and disease, Santa Barbara, Calif.:

Greenwood. pp. 79–80.

Heils A, Teufel A, Petri S, Seemann M, Bengel D,

Balling U, Riederer P and Lesch KP (1995).

Functional promoter and polyadenylation site

mapping of the human serotonin (5-HT) transporter

gene. J Neural Transm Gen Sect.102 (3):247-54.

Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel

D and Lesch KP (1996). Allelic variation of human

serotonin transporter gene expression. J Neurochem.

66(6): 2621-4.

Heinz A, Braus DF, Smolka MN, Wrase J, Puls I,

Hermann D, Klein S, Grüsser SM, Flor H,

Schumann G, Mann K and Büchel C (2005).

Amygdala-prefrontal coupling depends on a genetic

variation of the serotonin transporter. Nat Neurosci.

8:20-21.

Hu XZ, Lipsky RH, Zhu G, Akhtar LA, Taubman J,

Greenberg BD, Xu K, Arnold PD, Richter MA,

Kennedy JL, Murphy DL and Goldman D (2000).

Serotonin transporter promoter gain-of-function

genotypes are linked to obsessive-compulsive

disorder. Am J Hum Genet. 78:815-826.

Kim DY and Camilleri M (2000). Serotonin: a mediator

of the brain-gut connection. Am J Gastroenterol.

95:2698–2709.

Kim SJ, Cox N, Courchesne R, Lord C, Corsello C,

Akshoomoff N, Guter S, Leventhal BL, Courchesne

E and Cook EH (2002). Transmission

16

Praline et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:13-17

. disequilibrium mapping at the serotonin transporter

gene (SLC6A4) region in autistic disorder. Mol

Psychiat. 7: 278-288.

Lesch KP, Balling U, Gross J, Strauss K, Wolozin BL,

Murphy DL and Riederer P (1994). Organization of

the human serotonin transporter gene. J Neural

Transm Gen Sect. 95(2):157-62.

Mamounas LA, Altar CA, Blue ME, Kaplan DR,

Tessarollo L and Lyons WE (2000). BDNF

promotes the regenerative sprouting, but not

survival, of injured serotonergic axons in the adult

rat brain. J Neurosci. 20:771-782.

Mazer C, Muneyyirci J, Taheny K, Raio N, Borella A,

Whitaker-Azmitia P (1997).Serotonin depletion

during synaptogenesis leads to decreased synaptic

density and learning deficits in the adult rat: a

possible model of neurodevelopmental disorders

with cognitive deficits. Brain Res. 760:68-73.

Meyer-Lindenberg A, Hariri AR, Munoz KE, Mervis

CB, Mattay VS, Morris CA and Berman KF (2005).

Neural correlates of genetically abnormal social

cognition in Williams syndrome. Nat Neurosci.

8:991-993.

Murphy GM Jr, Hollander SB, Rodrigues HE, Kremer

C and Schatzberg AF (2004). Effects of the

serotonin transporter gene promoter polymorphism

on mirtazapine and paroxetine efficacy and adverse

events in geriatric major depression. Arch Gen

Psychiatry. 61(11):1163-9.

Ninds (2010). Motor Neuron Diseases Fact Sheet by

the National Institute of Neurological Disorders and

Stroke (NINDS) http://www.ninds.nih.gov.

Ninds (2015). Amyotrophic Lateral Sclerosis (ALS)

Fact Sheet by the National Institute of Neurological

Disorders and Stroke (NINDS).

Pezawas L, Meyer-Lindenberg A, Drabant EM,

Verchinski BA, Munoz KE, Kolachana BS, Egan

MF, Mattay VS, Hariri AR and Weinberger DR

(2005). 5-HTTLPR polymorphism impacts human

cingulate-amygdala interactions: a genetic

susceptibility mechanism for depression. Nat

Neurosci. 8:828-834.

Salichon N, Gaspar P, Upton AL, Picaud S, Hanoun N,

Hamon M, DeMaeyer E, Murphy DL, Mossner R,

Lesch KP, Hen R and Seif I (2001). Excessive

activation of serotonin (5-HT) 1B receptors disrupts

the formation of sensory maps in monoamine

oxidase a and 5-ht transporter knock-out mice. J

Neurosci. 21:884-96.

Sambrooke J, Fritsch EF and Maniatis T (1989).

Molecular cloning: a laboratory manual (2nd Ed).

Cold Spring Harbor, NY: Cold Spring Harbor

Laboratory Press.

Watson C, Hoeft F, Garrett AS, Hall SS and Reiss AL

(2008). Aberrant brain activation during gaze

processing in boys with fragile X syndrome. Arch

Gen Psychiatry. 65:1315-1323.

Wellman CL, Izquierdo A, Garrett JE, Martin KP,

Carroll J, Millstein R, Lesch KP, Murphy DL and

Holmes A (2007). Impaired stress-coping and fear

extinction and abnormal corticolimbic morphology

in serotonin transporter knock-out mice. J Neurosci.

27:684-691.

Wendland JR, Martin BJ, Kruse MD, Lesch KP and

Murphy DL (2006). Simultaneous genotyping of

four functional loci of human SLC6A4, with a

reappraisal of 5-HTTLPR and rs25531. Mol

Psychiatry. 113:224-226.

17

Bushwereb et al.

L .J. V. M. Sci. (2015) Vol. 1 (1): 1-4.

The Impact of Wheat Rhizosphere on the Distribution of

Burkholderia spp and Soil Bacteria

Merfat T. Ben Mahmud

Department of Soil and Water - Faculty of Agriculture, University of Tripoli- Tripoli-Libya.

Received 15 October 2015/ Accepted 25 November 2015

Key words: Rhizosphere, Wheat growth stages, Burkholderia, Soil bacteria

Introduction

Plant roots play important roles in shaping microbial

communities in soil by releasing a wide range of

compounds (Garbeva et al., 2008). Although root-

released products comprise of an important pool of

organic compounds for soil micro-organisms, their

composition and quality can vary according to plant

species, soil type and plant development stage

(Chaparro et al., 2013). Due to this variation in

exudation, different plant species growing in the same

soil type were known to select divergent bacterial

communities. However, when analyzing the microbial

community associated with the same plant species

growing in different soil type.

The soil type might exert a great influence on

microbial diversity (Wieland et al. 2001). In view of the

fact that the plant has a large impact on microbial

diversity, one might expect agricultural management to

play an important role as wells (Lupwayi et al. 1998).

Indeed, many agricultural practices, such as crop

rotation, continuous cropping and tillage, induce

changes in the microbial communities in soil (Alvey et

al. 2003; Lupwayi et al. 1998), which may persist long

after the management practice took place. Although

agricultural practices induce general changes in soil

microbial communities, specific microbial groups may

respond differently (Clegg et al, 2003).

A number of studies have reported that the

application of inorganic nitrogen had a significant

impact on Eubacterial and Actinomycete community

structures, whereas soil drainage significantly affected

the community structures of Burkholderia spp and

Pseudomonas spp. In addition, continuous wheat

cropping affected the community structure of

Burkholderia spp such that an increase in the

population of antibiotic producing Burkholderia spp

induced the natural suppression of Take-all disease in

wheat (Raaijmakers and Weller 1998).

Similarly, the establishment of apple orchards in a

field where wheat had previously been grown led to an

decrease of soil suppressiveness against Rhizoctonia

solani, which was correlated with a decrease of

Burkholderia cepacia and Pseudomonads putida

populations (Mazzola, 1999).

Considering the fact that agricultural management

and plant species affect soil microbial communities, the

main objective of this study was to get a better

understanding of how land use and crop species, such

as wheat affect the diversity of the genus Burkholderia.

As well as, this study aimed to address the effect of

the wheat rhizosphere on the distribution of

Burkholderia spp and soil bacteria which factor (land

use) had a greater influence on the soil-borne

populations by the enumeration on plates of rhizosphere

and non rhizosphere soil communities.

Materials and methods

The experiment was conducted in a growth chamber

in Soil microbiology lab at Faculty of Agriculture,

University of Tripoli. Winter wheat (Triticum aestivum

L.) was grown in glass plant tubes (25 x 150) mm were

filled with 20g soil to approximately 5cm from rim. Soil

were collected from two field sites from Wadi Elrabie,

East of Tripoli (Loam sandy soil, pH 8.6) and Janzour,

West of Tripoli (sandy soil, pH 8.1) with three

replicates of each of the two soil samples, giving a total

Original article

Abstract This study was conducted on the effect of the wheat rhizosphere on the distribution of Burkholderia spp. and soil

bacteria communities during wheat plant growth by the enumeration on plates of rhizosphere and non rhizosphere soil

communities in different type of soils, which were collected from different fields, Wadi Elrabie and Janzour (East and

west) of Tripoli, Libya. The results showed that the gram negative species of soil bacteria exceeded the remaining

bacterial population in the rhizosphere on contrast with non-rhizosphere which dominance of gram-positive cocci,

endospore and forming rods. There was no difference in the total bacterial population with plant age , but the types of

colony growth were reversed between the rhizosphere and non-rhizosphere soil in 5 week (seedling stage) and 20

weeks (maturity stage).The genus of Burkholderia prevail in the rhizosphere of the wheat particularly in the early

stages of plant growth (seedling stage). The changes in the trend of the calculated ratio of gram-negative bacteria in

the rhizosphere to that of the non-rhizosphere soil cannot be generalized to all species. Results obtained with

Burkholderia population in this experiment showed different picture.

Libyan Journal of Veterinary and Medical Sciences December 2015 Vol. 1(2): 18-21

*Corresponding Author: Merfat T. Ben Mahmud Department of Soil and Water - Faculty of Agriculture, University of

Tripoli – Tripoli - Libya

Tripoli - Libya. Email:dr.mbenmahmoud@yahoo.com

18

Ben Mahmud

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:18-21

. of 24 treatments, which explains three factors: one type

of plant, two soil type (Janzour and Wadi Elrabie soil)

with two sites (rhizosphere and non-rhizosphere soil)

and two stages of wheat growth (seedling and maturity

stage) in three replicate. All tubes were irrigated to field

capacity twice a week. One inoculated seed of wheat

was placed in each tube approximately 1cm below the

surface of the soil.

The bacteria counting were carried out at the end of

the growth cycle which was seedling stage

approximately 5 weeks and maturity stage 20 weeks

after sowing, by using the method of calculating the

number of probabilistic (Alexander 1973). Bacterial

strains were initially isolated from the rhizosphere and

non-rhizosphere soil of wheat roots. Plants were

uprooted from the tubes along with amount of non-

rhizosphere soil.

The non-rhizosphere soil was removed by gentle

shaking of the roots whereas the soil adhering strongly

to the root was referred to rhizosphere soil. Ten gm of

each soil samples were mixed thoroughly in 3 replicate,

then transferred to 250 ml flask with 100 ml sterile

distilled water and were shaken for 30 min at 150 rpm.

Immediately after shaking, a series of 10-fold dilution

in 0.8% (w/v) NaCl solution was prepared for each soil

sample by pipetting 1 ml of aliquot into 9 ml sterile

water. 0.1 ml of each dilution of the series was plated

into a Petri plate with soil extract agar for rhizosphere's

samples and with Dextrose ager for non-rhizosphere's

samples.

Bacteria Burkholderia isolated from soil samples

into plates with Burk’s agar medium.Three replicate

plates were made for each dilution plates were placed in

an incubator at 30o

C for 8 days to estimate

Burkholderia and soil total bacterial population, after

incubation, the plates dilutions of rhizosphere and non

rhizosphere microorganism were Gram-stained using

standard procedures.

Morphology characterisation was determined using

a compound microscope in oil immersion (1000 X)

about 100 colonies were chosen at random at all the

colonies from the rhizosphere whatever their size, shape

and colour were transferred onto other plate to check

for purity. All the colonies grown on the plates were

about 1mm diameter and white with flat margins

initially glossy and gummy but turned into glistening

colonies with clear slime upon further growth. Some of

the species were defined by direct use of microscopic

morphological characteristics and compared to some of

the known and available cultures and then were

characterised using the criteria of Bergey and Holt

(1994).

Results and discussion

This experiment showed the impact of the wheat

rhizosphere on the distribution of Burkholderia spp and

soil bacteria by the enumeration on plates of

rhizosphere and non-rhizosphere soil as shown in table

(1). A difference between the rhizosphere and non

rhizosphere concerned the colonies growth on the

plates. All morphological characteristics conformed to

descriptions of those known from the most of the

rhizosphere colonies of two stages of wheat growth

(seedling and maturity stages) from two soils (Wadi

Elrabie and Janzour). There had a very homogeneous

morphology bacteria rod, ovoid cells treated like

species of Burkholderia, Psedomonas, Azotobacter,

Agrobacterium and endospore as Bacillus sp,

Streptomyces. All colonies had grown after 4 days of

incubation, on the contrast the non rhizosphere soil had

a vast of colonies rod and ovoid, rod forming and

endosperm cells as Streptomyce,s Cellulomonas,

Azotobacter, Cytophaga and Pseudomonas grown after

4 days and some of them grow after 8 days.

Table 1: The common genuses of soil bacteria and their growth on plates listed downward in Wadi Elrabie and

Janzour soils.

Seedling stage

(5 weeks) Maturity stage

(20 weeks)

Rhizosphere

1- Gram negative bacteria, rod, and ovoid cells

and treated like species of Burkholderia,

Psedomonas, Azotobacter and Agrobacterium.

2- Bacteria gram positive, rod and endospore,

Bacillus sp

1- Gram negative bacteria, rod and ovoid

cells. Cytophaqa, Coccobacil,

Azotobater, Burkholderia.

2- Gram positive bacteria, endosperm

forming rod. Bacillus Streptomyces.

Non-

rhizosphere

1- Gram positive bacteria, Cocci, endospore

Staphylococcus, forming rod Streptomyces.

2- Gram negative bacteria, rod Pseudomonas,

Burlholderia and ovoid cells like species of

Azotobacter.

1- Gram positive bacteria. Streptomyces

forming rod Cellulomonas.

2- Gram negative bacteria, rod and ovoid

cells. Azotobacter and Cytophaga.

It can confirm the fact in a number of previous

researches revealed that gram-negative bacteria

population prevails in rhizosphere, while the gram-

positive bacteria population is numerically superior in

non rhizosphere and comes second in rhizosphere

(Macura 1967 and Briwb 1975). It also notes that the

plant age and stages of growth does not affect the

distribution of microbes in the appearance and

disappearance of some specie as a result of the nature of

the root outputs by releasing a wide range of organic

compounds that change from one stage to the other

stages of wheat growth. It had indicated the ratio

19

Ben Mahmud

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:18-21

between the numbers of gram negative bacteria in the

rhizosphere to their numbers in the non-rhizosphere

become even greater with plant age in between stage

seedling and maturity stage (Salles et al.(2006); Ben

Mahmoud 2008).

This study indicates the diversity of the

Burkholderia population (which was a negative-gram

bacteria) associated with rhizosphere was consistently

higher in the rhizosphere than in the non-rhizosphere

There was a greater number of Burkholderia population

at seedling stage (5 weeks ) in rhizosphere than in non-

rhizosphere soil, while thereafter the numbers of

Burkholderia declined to the lowest number at the

maturity stage (20 weeks) were recorded from 7 x 105

to 4 x 104 cfu /gram soil at Wadi Elrabie and from 5 x

104 to 2 x 10

3 cfu /gram soil at Janzour soil. However,

the other bacterial communities’ population of the non

rhizosphere in both soils were increased from seedling

to maturity stages of wheat growth, as shown in table (2

and 3).

Table 2: Total Burkholderia and soil bacteria in wheat rhizosphere and non rhizosphere in

Wadi Elrabie soil

Seedling stage

(5weeks) cfu /gram soil

Maturity stage

(20 weeks) cfu /gram soil

Burkholderia Soil bacteria Burkholderia Soil bacteria

Rhizosphere 7 x 105 4.5 x 10

2 4 x 10

4 8 x 10

3

Non- rhizosphere 5 x 102

6.5 x 104

2 x 102

7 x 105

Table 3: Total Burkholderia and soil bacteria in wheat rhizosphere and non rhizosphere in Janzour soil

Seedling stage

(5weeks) cfu /gram soil

Maturity stage

(20 weeks) cfu /gram soil

Burkholderia Soil bacteria Burkholderia Soil bacteria

Rhizosphere 5 x 104 3 x 10

2 2 x 10

3 7.3 x 10

4

Non- rhizosphere 2 x 102

4.5 x 103 1.2 x 10

2 3 x 10

5

To sum up, the Burkholderia population present in

the wheat rhizosphere higher than in non rhizosphere

(Pallud et al.2001) might be due to the high substrate

availability observed around the roots, indeed the

bacterial communities population of the wheat

rhizosphere seem to have lower level of culturability

than non rhizosphere as proven by Van Elsas et al.

(2002); Salles et al. (2006).

References

Alexander M. (1973). Most probable number methods

for microbial population, Agronomy Monograph

No. 9 part 2: 1467-1472.

Alvey S.. Yang C H., Buerkert A and Crowley D E.

(2003). Cereal/legume rotation effects on

rhizosphere bacterial community structure in west

african soils. Biol Fertil Soils. 37: 73-82.

Ben Mahmud, M., (2008). The effect of Burkholderia as

biofertiliser on cereal productivity. PhD

Dissertation, Biotechnology and Environmental

Biology (School of Applied Sciences) RMIT

University, Melbourne, Australia.

Bergey DH and Holt GJ (1994). Bergey's manual of

determinative bacteriology. Baltimore: Williams &

Wilkins (9th Ed.) 787 pages.

Briwb M E. (1975). Rhizosphere microorganims,

opportunists, bandits or benefactors. Soil

microbiology. Article review Walker, N. pp. 21-38.

Chaparro JM, Badri DV, Bakker MG, Sugiyama A,

Manter DK and Vivanco JM (2013). Root exudation

of phytochemicals in Arabidopsis follows specific

patterns that are developmentally programmed and

correlate with soil microbial functions. J. plos. org /

plosone / article. 10:1371-1388.

Clegg C D., Lovell R D L and Hobbs P J. (2003).

The impact of grassland management regime on the

community structure of selected bacterial groups in

soils. FEMS Microbiol Ecol. 43: 263-270.

Garbeva P V., Van Elsas J D., Van Veen J A.

(2008). Rhizosphere microbial community and its

response to plant species and soil history. Plant Soil

302: 19-32.

Lupwayi N Z., Rice W A., and Clayton G W.

(1998). Soil microbial diversity and community

structure under wheat as influenced by tillage and

crop rotation. Soil Biol Biochem. 30: 1733-1741.

Macura A. (1967). Physiological studies of rhizosphere

bacteria. In Gray T R. and Parkinson D. The Ecol.of

Soil Bacteria. Liverpool: University. pp.379- 395.

Mazzola M. (1999). Transformation of soil microbial

community structure and Rhizoctonia suppressive

potential in response to apple roots. Phytopathology.

89: 920-927.

Pallud C., Viallard V., Balandreau J., Normand P.

and Grundmann G. (2001). Combined use of a

20

Ben Mahmud

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:18-21

. specific probe and PCAT medium to study

Burkholderia in soil. J Microbiol Methods. 47: 25-

34.

Raaijmakers J. M and Weller D M. (1998). Natural

plant protection by 2,4- diacetylphloroglucinol -

producing Pseudomonas spp. in take-all decline

soils. Mol. Plant Microb. Interact. 11: 144-152.

Salles JF, Van Elsas JD and Van Veen JA (2006).

Effect of agricultural management regime on

Burkholderia community structure in soil. Microb

Ecol. 52: 267–279.

Van Elsas JD, Garbeva P and Salles JF (2002). Effects

of agronomical measures on the microbial diversity

of soils as related to the suppression of soil-borne

plant pathogens. Biodegradation. 13:29-40.

Wieland G., Neumann R. and Backhaus H. (2001).

Variation of microbial communities in soil,

rhizosphere, and rhizoplane in response to crop

species, soil type, and crop development. Appl

Environ Microbiol. 67: 5849-5854.

21

Bushwereb et al.

L .J. V. M. Sci. (2015) Vol. 1 (1): 1-4.

Clinical Outbreaks of Flavobacterium columnare among Tilapia Populations

from Lake Qarun, Egypt

Dina A. Mosselhy1, Mohamed A. El-Aziz

2, Mona M. Husien

1, Abdelsalam A. Abumhara

3 and Alaa E. Eissa

2, 3*

1 Fish Diseases Research Department, Animal Health Research Institute, El- Dokki, Giza, 12618, Egypt.

2 Department of Fish Diseases and Management, Faculty of Veterinary Medicine, Cairo University, 11221, Egypt. 3 Department of Poultry and Fish Diseases, Faculty of Veterinary Medicine, University of Tripoli, Tripoli, Libya.

Received 18 October 2015/ Accepted 25 November 2015

Keywords: Flavobacterium columnare, Tilapia, Lake Qarun, Water quality, Experimental infection

Introduction

Lake Qarun extremely affected by a combination of

human activities and climatic changes during the past

5000 years (Flower et al. 2006).The lake suffered

drastic chemical changes for several decades where it

has been used as a general reservoir for agricultural

wastewaters drainage as well as fish farms drainage

throughout Fayoum province (Authman and Abbas,

2007). Fathi and Flower (2005) reported that the

average water temperature of Lake Qarun reached its

maximum in August and September (30 °C) and 16 °C

as minimum value in February. The regular pH of the

lake is an alkaline pH, which has fluctuated between 8.2

in September / October and 9.5 in February.

Tilapias are fast-growing fish which are capable of

surviving in poor water conditions and can tolerate a

wide range of environmental variables (Amal and

Zamri-Saad, 2011). Disease is usually the outcome of

an interaction between the host, the pathogen and

external stressor(s) (Snieszko, ‎1974). F. columnare

infection usually occurs in fish exposed to poor water

quality (Tripathi et al. 2003). Hansona and Grizzle

(1985) induced Flexibacter columnaris (recently, F.

columnare) infections in channel catfish by exposure to

5 mg/L (ppm) nitrite for 7 days. Jeney and Jeney (1995)

concluded that F. columnare adherence to gill tissues

was enhanced by high nitrite concentration (5 mg/L),

high organic content (2 g/L) and high temperature

(28°C). Tripathi et al. (2003) reported that sudden

changes in water temperature of 5°C or more pose

significant stress, predisposing fish to infection by F.

columnare. Columnaris disease has also been reported

in cold water fish at temperatures ranging from 6 to 12

ºC (Tripathi, 2005). Kubilay et al. (2008) demonstrated

that mortality level in columnaris infected cultured

rainbow trout (Oncorhynchusmykiss) fry, reached

approximately 30% in a day when water temperature

increased to 16°C.

F. columnare is an opportunistic pathogen in which

temperature rise above 20 ºC enhances the bacterial

pathogenicity and virulence by enhancing bacterial

proteolytic enzymes secretion. Thus, increased

pathogen virulence together with sharp decrease in

dissolved oxygen due to temperature rise will

jeopardize the immune system of fish and increases the

potential of the ubiquitous bacterial invasion (Eissa et

al. 2010).

Members of the genus Flavobacterium are widely

distributed in soil and water. Flavobacterium species

induced diseases among fresh water and marine fish

(Husien, 1999). The taxonomy of F. columnare has

been changed several times over the years basis on

morpho-chemical criteria. The old taxonomical names

of the pathogen included, Chondrococcus columnaris,

Cytophaga columnaris and Flexibacter columnaris

(Bernardet and Grimont 1989). The most recent name

“Flavobacterium columnare” was approved by the

microbiological community after molecular typing of

the worldwide archived strains (Bernardet et al. 1996).

F. columare has been isolated from several fish species

worldwide such as Nile tilapia (O. niloticus) (Husien,

1994; Husien, 1999); fingerling and adult Nile tilapia in

Brazil (Figueiredo et al. 2005); Nile tilapia (O.

niloticus) and Nile catfish (Clarius gariepinus) in

Lower Egypt (Eissa et al. 2010); juvenile rainbow trout

in the southern part of Turkey (Kubilay et al. 2008),

some tropical fish species in Brazil (Pilarski et al.

2008).

Kubilay et al. (2008) discovered that in wet mount

Original article

Abstract During multiple clinical outbreaks that happened between the fall and winter of 2012. A total of 59 fish pathogenic

bacteria were retrieved form 150 clinically diseased Tilapia species collected from different regions through Lake Qarun.

The dermotropic yellow pigmented F. columnare have represented 3.4% of the retrieved Flavobacterial isolates. The

main clinical findings exhibited by F. columnare natural infection were deep ulcerations and tail rot. The lake’s poor

water quality such as alkaline pH , high levels of un-ionized ammonia, high nitrite concentrations, together with the

abrupt rise of water temperature have played a potential role in triggering F. columnare infection. To assess the

pathogenicity of the retrieved isolates, experimental infection was carried out by intraperitoneal injection of O. niloticus

with F. columnare isolates and mortalities were detected within 10 days. F. columnare isolates were sensitive to

Danofloxacin, Nalidix acid, Nitrofurantoin and Oxolinic acid while they were resistant to Amoxicillin, Cephalothin,

Gentamicin, Lincomycin, Oxytetracycline, Ampicillin, Tetracycline.

Libyan Journal of Veterinary and Medical Sciences December 2015 Vol. 1 (2): 22-28

*Corresponding Author: Alaa E. Eissa. Department of Poultry and Fish Diseases, Faculty of Veterinary Medicine, University

of Tripoli, Tripoli, Libya. P. O. Box 13662 Tripoli, Libya. Tele.+218 911571033, Email: aeissa2005@gmail.com.

22

Mosselhy et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:22-28

. Preparation of F. columnare showed a slow gliding

movement and characteristic column-like masses. F.

columnare isolates are positive for oxidase, catalase,

flexirubin pigment, H2S production, nitrate reduction

and gelatinase tests. Most of isolates grew on Shieh

agar supplemented with tobramycin with the

development of yellow rhizoid colonies. F. columnare

do not utilize carbohydrates. Growth can occur at 0.5%

NaCl but not in 1% NaCl and no growth occurred at

4°C. Eissa et al. (2010) have presented a full morpho-

chemical profile for F. columnare which included

positive catalase; chromo-shift after adding potassium

hydroxide 3 % onto the bacterial colonies on Hsu-

Shotts agar plates; Congo red binding ; gelatin

hydrolysis; growth at 25 ºC, 30 ºC and 37 ºC; growth in

the presence of Neomycin sulfate and Polymyxin B

sulfate.

Materials and methods

Fish sampling

A total number of 170 apparently healthy and 150

clinically diseased Tilapias were collected alive or

freshly dead from different localities of Lake Qarun

during the period from October 2011 to December 2012

during the course of three emergent outbreaks. The

fishes were kept on ice until transferred to the Fish

Diseases Research Laboratory for further processing.

Clinical and post mortem examination of naturally

infected fish were carried out according to the methods

described by Stosckopf (1993).

Isolation and purification of F. columnare

Skin and gills chunks from examined fish were

taken by sterile curved forceps and streaked directly

onto Hsu-Shotts agar medium (Bullock et al. 1986)

supplemented with 0.5 and 1 % NaCl (El-Nasr

pharmaceutical chemicals, Egypt). The inoculated

plates were incubated at 25ºC for 5-7 days. Presumptive single colonies from the achieved pure cultures were

picked and streaked onto different laboratory media:

Tryptic soya agar (TSA, Merck, Germany) with 3%

NaCl, MacConkey agar (Oxoid, England) and TCBS

agar (Oxoid, England).

Colonial and morphological characters

Colonial and morphological characters of F.

columnare were studied according to Austin and Austin

(2012).

Biochemical identification of F. columnare

Bacterial isolates were presumptively identified

using both cultural characteristics and conventional

biochemical tests recommended by Griffin (1992).

Biochemical tests include catalase test, adding

potassium hydroxide 3 % onto the bacterial colonies on

Hsu-Shotts agar plates, Congo red binding (by flooding

24 h cultures with 5 mL of Congo red dye), gelatin

hydrolysis, growth on TSA, growth at 25 ºC, 30 ºC and

37 ºC , growth at 0.5 % , 1 %, and 3 % NaCl. Motility

was detected by stabbing of the single colony from the

pure isolates into semisolid agar. Further identification

of F. columnare isolates was adopted by API® 20 E and

NE; according to the instructions of the BioMérieux

Company.

Water analysis

Collection of water samples for physico-chemical

parameters testing was conducted according to APHA

(1998). Water samples were collected concurrently with

fish samples from Shakshouk and Deir-El Birka drains

at Lake Qarun basin. Each sample was collected from

the mid zone of water source and at a suitable depth in a

sterile dry 500 mL glass bottle for chemical

examination.

Water temperature was measured by using floating

ordinary thermometer (Model Heto T-08- china), while

pH was measured using pH meter (Model 25025-

Jenway-Germany). Ammonia and nitrite were

determined using Colorimeter (Model Jenway 6030-

Germany) at wavelength 603 and 545 nm respectively.

Experimental infection

F. columnare was grown on Hsu-Shotts agar

medium with 0.5 % and 1% NaCl. The pure cultures

were harvested by cotton swab and suspended into

sterile saline according to Austin and Austin (2007).

A total of 30 O. niloticus with average weight (55±2

g) were used in the experiment. The fish were divided

into two groups. First group containing 15 O. niloticus

were divided into 10 fishes (I/M injected with F.

columnare at a dosage of 0.5 ml of 107 CFU/mL) and 5

fishes (S/C injected with the same dose) according to

the method described by Husien (1994). . The second

group (control group) comprises 15 O. niloticus that

were similarly divided into 10 fishes (I/M injected with

0.35 mL saline) and 5 fishes (S/C injected with the

same dose). The injected fish were kept under

observation for 10 days post challenge during which

mortalities, clinical signs and PM were recorded on a

daily basis. Koch’s pathogenicity postulates were

fulfilled by re-isolation of the infective pathogen for

verification of the specificity of death.

Antibiogram

The disc diffusion method was used as described by

Bauer et al. (1966).

Results

Incidence of natural infection of F.columnare among

examined Tilapia populations

F. columnare prevalence among naturally infected

Tilapia spp. was (3.4%) among the positive cases of

fishes (39) for the different retrieved pathogens. The

seasonal prevalence of F. columnare was recorded

100% in winter.

Clinical findings in naturally infected fishes

The clinical signs of the F. columnare naturally

infected fish included deep skin ulcerations, tail rot and

hemorrhage at the base of pectoral fins (Figure 1.A and

B). On postmortem examination, infected Tilapias

exhibited pale necrotic gills and enlarged and congested

liver.

23

Mosselhy et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:22-28

Figure 1: Naturally infected Tilapia spp., (A) showing tail rot. (B) showing deep ulceration on the

operculum under the eye.

Bacteriological examination

Morpho-chemical characteristics of retrieved

isolates

The colonial characters of retrieved isolates on solid

media were yellow rhizoid colonies adhering to the

Hsu-Shotts agar surface after 5-7 days of incubation

(Figure. 2. B). No growth was obtained on TSA 3%

NaCl after 7 days of incubation, also no growth on

MacConkey agar or TCBS agar. Gram stained smears

(Figure. 2. A) from pure colonies revealed the presence

of long Gram-negative bacilli. These morphological

characteristics were presumptive for F. columnare.

Biochemical identification of the retrieved isolates

using conventional biochemical tests

F. columnare were identified using a panel of

biochemical tests listed in table (1).

Further identification of the retrieved isolates by

API® 20 E and NE

The retrieved isolates were further biochemically

confirmed using the semi-automated API® 20 E and

NE. Isolates identities were confirmed through the API®

20 E and NE software matching system with an

accuracy percentage exceeding 98 % .

Intensity of F. columnare infection in skin of

examined fishes

The intensity of infection (The percentage of F.

columnare isolation) from skin of naturally infected

Tilapias was 100%.

Water quality assessment

The assessed pH of water samples was alkaline while

un- ionized ammonia, and Nitrite concentrations

exceeded the permissible limits (Table 2).

Figure 2: (A) Gram- negative long bacilli of F. columnare. (B)Yellow rhizoid colonies

of F. columnare adhering to Hsu-Shotts agar surface after 5-7 days of incubation.

24

Mosselhy et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:22-28

.

Table 1: Biochemical characteristics of F. columnare

Biochemical test Result

Oxidase +ve

Catalase +ve

Gram stain -ve long bacilli

KOH 3% Gm –ve (mucoid)

KOH 20% Chromoshift to pink-brown colonies

Congo red binding +ve and at washing with distilled water, no removal

of colonies

Indole -ve

Methyl- Red -ve

Voges-Proskauer -ve

Citrate -ve

Triple Sugar Iron Alkaline/Alkaline

Hydrogen sulfide production +ve

Glucose -ve

Sorbitol -ve

Sucrose -ve

Maltose -ve

Urease -ve (weak +ve)

Gelatin liquefaction -ve

O/F test glucose +/-

Growth at 4oC Slight growth after 48 hours incubation

Growth at 37oC No growth after 48 hours incubation

Growth on TSA +3% NaCl No growth

+ ve = Positive, -ve = Negative, O/F = Oxidation/ Fermentation, +/- = Positive/ Negative

Table 2: Results of water quality assessment

Locality

Water parameter

Shakshouk Deir-El Birka drain References

Temperature 19 ºC 22 ºC -

pH 8.51 7.55 -

Un-ionized toxic

Ammonia 0.0534 mg/L 0.0126 mg/L

Upper Limit 0.0125

mg/L,(Swann, 1997)

Nitrite 0.02 mg/L 0.02 mg/L 100 µg/L, (Ali, 2002)

25

Mosselhy et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:22-28

Experimental infection

A 60 % of O. niloticus I/M injected with F.

columnare were dead within 6 days post-infection and

40% of those S/C injected were dead within 6 days

post infection. It is worthy to mention that mortalities

were recorded on a daily basis throughout the 10 days

period of the experiment. The clinical signs and post

mortem examination of experimentally infected fishes

is illustrated in figure (4).

Antibiogram

Antibiograms of the presumptively identified F.

columnare revealed that all isolates were sensitive to

Danofloxacin, Nalidix acid, Nitrofurantoin and

Oxolinic acid. All isolates were also resistantto

Amoxicillin, Cephalothin, Gentamicin, Lincomycin,

Oxytetracycline, Ampicillin, Tetracycline and

Clamoxyl, while intermediate resistance was exhibited

against Colistinsulphate and Trimethoprim /

Sulphamethoxazole (Figure 5).

Figure 4: (A) O.niloticus experimentally infected (S/C) with F. columnare, Showed deep hemorrhagic ulceration on the

trunk. (B) O. niloticus experimentally infected (I/M) with F. columnare showed hemorrhagic musculuature, enlarged

and congested internal organs.

Figure 5: (A) F. columnare with intermediate resistance to CT and resistant to OT, CN,

AMX, MY. (B) F. columnare sensitive to F, OA, DFX and resistant to AML and AMP.

Discussion

The sharp environmental changes such as sharp

fluctuations in temperature, pH and dissolved oxygen

are highly incriminated as predisposing factors for

initiating F. columnare infection (Wakabayashi, 1991

and Tripathi et al. 2003). The fluctuations in water

temperature above 16 up to 25 ºC then 30 ºC is known

to enhance the bacterial pathogenicity and virulence by

increasing the bacterial growth rate; increases the

adhesion capacity of the bacterium to the fish tissues

(Decostere et al. 1999); activates the Chondrotin AC

lyase (Griffin, 1992) which degrades polysaccharides,

particularly those found in cartilaginous connective

tissue (Teska, 1993).

The sharp decrease in dissolved oxygen due to

temperature rise has suppressed the immune system of

fish with increasing the potentials of the ubiquitous

bacterial invasions (Amend, 1983; Bullock et al. 1986;

Suomalainen et al. 2005). Further, the increased

ammonia levels with consequent rise in water pH are

the most possible triggering factors for initiation,

establishment and spread of infection (Sniezko, 1974;

Holt et al. 1975; Morrison et al. 1981; Bullock et al.

1986; Suomalainen et al. 2005). Despite the fact that

early summer and early autumn are the flaring up

seasons for F. columnare (Eissa, 2010), yet, the

seasonal incidence of F. columnare was 100 % in

winter season, which is in partial agreement with

Peselis (2011) who concluded that Columnaris disease

could be enhanced when the fishes are in stressed

environments.

The skin ulcerations fin and gill rot can be mainly

attributed to Chondroitin AC lyase which is an enzyme

produced by F. columnare, that has the capability to

26

Mosselhy et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:22-28

. degrade polysaccharides, particularly those found in

cartilaginous connective tissue (Eissa et al. 2010).

The results of morpho-chemical testing of the

retrieved isolates were in full agreement with the

standard criteria of F. columnare described by Austin

and Austin (2012), Eissa et al. (2010) and Peselis

(2011). Controversially, the ability to grow at 4 ºC in

which slight growth took place after 48 hours of

incubation is against data described by Kubilay at al.

(2008) who detected no growth at such temperature. F.

columnare was 100% isolated from skin which is

compatible with the findings of Tripathi et al. (2005)

who declared that F. columnare was readily detected in

skin specimens from infected fish. However, the

bacterium was infrequently detected in liver, kidney and

spleen samples and suggested that Columnaris disease

generally occurs as a cutaneous disease that is

unassociated with systemic infection.

In respect to experimental infection of O. niloticus

with F. columnare, 60% mortality within 6 days of

(I/M) and 40% (S/C) injections were obtained. These

results relatively agreed with Husien (1994) who

reported 100 % mortalities within 5 days post S/C

injection of O. niloticus. Clinical signs and post mortem

examination of experimentally infected fishes were

almost similar to those of naturally infected fishes. This

confirmed that the recorded clinical and PM findings in

naturally infected fishes were due to Flavobacteriosis.

Ultimately, the antibiogram results of the confirmed

F. columnare isolates were consistent with similar data

recorded by Husien (1999) who reported complete

resistance to Tetracycline and Ampicillin. However, the

antibiogram data disagreed with Hawkeab and Thuneab

(2011) who mentioned that all F. columnare tested

strains were susceptible to Terramycin (Oxytetracycline

HCl).

Acknowledgments

Authors are grateful to all members of the

Department of Fish Diseases and Management, Faculty

of Veterinary Medicine, Cairo University and Fish

Diseases Research Department, Animal Health

Research Institute for facilitating the use of laboratory

facilities throughout the entire study.

References

Ali MHH (2002). Impact of agricultural and sewage

effluents on the Ecosystem of Lake Qarun, Egypt.

Ph.D. Thesis, Faculty of Science, Al-Azhar

University, Egypt.

Amal MNA and Zamri-Saad M (2011). Streptococcosis

in Tilapia (Oreochromisniloticus): A Review.

Pertanika J Trop Agric Sci. 34(2): 195 – 206.

APHA (American Public Health Association) (1998).

Standard Methods for Examination of water and

waste water. 20th

edition, APHA, Washington D. C.

USA.

Austin B and Austin DA (2007). Bacterial fish

pathogens: Disease of farmed and wild fish (4th

Revised Edition).Springer Praxis Publishing,

Chichester, UK.

Authman MMN and Abbas HHH (2007).Accumulation

and distribution of Copper and Zinc in both water

and some vital tissues of two fish species (Tilapia

zilli and Mugil cephalus) of Lake Qarun, Fayoum

Province, Egypt. Pakistan J Biol Sci. 10 (13): 2106-

2122.

Bauer AW, Kirby WM., Sherris JC, Turck M (1966).

Antibiotic susceptibility testing by a standardized

single disc method. Am J Clin Pathol. 45:493–6.

Bernardet JF and Grimont PAD (1989).

Deoxyribonucleic acid relatedness and phenotypic

characterization of Flexibacter columnaris sp. nov.,

nom. rev., Flexibacter psychrofilus sp. nov., nom.

ver., and Flexibacter maritimus. Int J Syst Bacteriol.

39 (3): 346-354.

Bernardet JF, Segers P, Vancanneyt M, Berthe M,

Kerters K and Vandamme P (1996).Cutting a

Gordian Knot: Emended classification and

description of the genus Flavobacterium, emended

description of the family Flavobacteriaceae, and

proposal of Flavobacterium hydatis nom. nov.

(basonym, Cytophaga aquatilis Strohl and Tait

1978) . Int J Syst Bacteriol. 46 (1):128- 148.

Buller NB (2004). Bacteria from fish and other aquatic

animals: a practical identification manual.

Cambridge: CABI Publishing.

Cruickshank R, Duguid JP, Marmion BP and Swain

RHA (1975). Medical microbiology. 2nd

Volume,

12th

Edition, Churchill living stone. Limited

Edinburgh, London and New York.

Eissa AE, Zaki MM and Abdel Aziz A (2010).

Flavobacterium columnare / Myxobolus tilapiae

concurrent infection in the earthen pond reared Nile

tilapia (Oreochromis niloticus) during the early

summer. Interdisc Bio Central. 2 (2): 1-9.

Fathi AA and Flower RJ (2005). Water quality and

phytoplankton communities in Lake Qarun (Egypt).

Aquat Sci. 67: 350- 362.

Figueiredo HCP, Klesius PH, Arias CR, Evans J,

Shoemaker CA, Pereira Jr DJ and Peixoto MTD

(2005). Isolation and characterization of strains of

Flavobacterium columnare from Brazil. J Fish Dis.

28:199-204.

Flower, RJ, Stickley C, Rose NL, Peglar, S, Fathi, A.A.

and Appleby PG (2006).Environmental changes at

the desert margin: an assessment of recent

paleolimnological records in Lake Qarun, Middle

Egypt. J Paleolimnol. 35: 1–24.

Griffin BR (1992): A simple procedure for

identification of Cytophaga columnaris. J Aquat

Anim Hlth. 4: 63- 66.

Hanson, LA and Grizzle JM (1985).Nitrite-Induced

Predisposition of Channel Catfish to Bacterial

Diseases. The Prog Fish Cult. 47(2): 98-101.

Hawkeab JB and Thuneab RL (2011). Systemic

Isolation and Antimicrobial Susceptibility of

Cytophaga columnaris from Commercially Reared

Channel Catfish. J Aquat Anim Hlth. 4(2):109-113.

Husien MM (1994). Further Studies on Columnaris

disease in Fresh water Fishes. Ph.D.Dissertation.

Fac. of Vet.Med., Cairo University.

27

Mosselhy et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:22-28

Husien MM (1999). Natural and Experimental Infection

of Flavobacterium Species in Freshwater Fish. Beni-

Suef Vet Med J. 9 (3-A): 311- 326.

Jeney Z and Jeney G (1995). Recent achievements in

studies on diseases of common carp (Cyprinus

carpio L.). Aquaculture . 129 (1- 4): 397–420.

Kubilay A, Altun S, Diler Ö and Ekici S (2008).

Isolation of Flavobacterium columnare from

Cultured Rainbow Trout (Oncorhynchus mykiss) Fry

in Turkey. Turk J Fish Aquat Sci. 8:165-169.

Peselis AA (2011). Cytotoxic activity of the bacterial

fish pathogen Flavobacterium columnare on fish

cells. M.Sc. Thesis, University of Rhode Island.

Pilarski F, Rossini AJ and Ceccarelli PS (2008).

Isolation and characterization of Flavobacterium

columnare (Bernardet et al. 2002) from four tropical

fish species in Brazil. Braz J Biol. 68(2): 409-414.

Snieszko SF (1974). The effects of environmental stress

on outbreaks of infectious diseases of fishes. J Fish

Biol. 6(2), 197-208.

Stosckopf M (1993). Fish Medicine. WB Saunders

Company, Philadelphia, Pennsylvania.

Swann L (1997). A Fish Farmer’s Guide to

Understanding Water Quality.Water Quality. Fact

Sheet AS-503.

Tripathi NK, Latimer KS and Rakich PM (2003).

Columnaris Disease in Freshwater Fish.

Compendium. 25(7): 528-536.

Tripathi NK, Latimer KS, Gregory CR, Ritchie BW,

Wooley RE and Walker RL (2005). Development

and evaluation of an experimental model of

cutaneous columnaris disease in koi Cyprinus

carpio. J Vet Diagn Invest. 17:45–54.

28

Bushwereb et al.

L .J. V. M. Sci. (2015) Vol. 1 (1): 1-4.

Effects of Mercury Chloride on Sperm Parameters and Pathological Changes in

Kidney of Mouse

Habiba A. El Jaafari1*, Amr M.Fathalla

1 and Suhera Aburawi

2

1Department of Zoology, Faculty of Science, University of Tripoli, Tripoli-Libya. 2Department of Pharmacology and Clinical Pharmacy, Faculty of Pharmacy, University of Tripoli, Tripoli-Libya.

Received 20 October 2015/ Accepted 25 November 2015

Key words: Mercury Chloride, Sperm, Mouse, Kidney

Introduction

There are a serious rise in the environment of toxic

chemicals and heavy metals. The accumulation of

heavy metals in the body of organisms causes

significant health risks. Mercury is one of the fairly

harmful heavy metals for lives (Gul et al. 2004) and it

has extremely toxic characteristic for organisms

(Sharma et al. 2005). Mercury is a naturally occurring

metal in organic (methyl mercury, ethyl mercury and

phenyl mercury) and inorganic forms (mercury

chloride) which possess different toxicity (Trasande et

al. 2005). The potential health effects of mercury have

been a matter of concern because of potential wide

human exposure consequent to its wide spread use.

It distributed throughout the environmental by both

natural sources and human activities and easily

accumulated in the animal tissues. Most of the mercury

in the atmosphere is elemental mercury vapor and

inorganic form, which may be deposited in water, soil

and sediments. Mercury vapor is highly lipophilic and

is efficiently absorbed through the lungs and oral

mucosa (Crinnion 2000). Mercury is widely used in

refinery, plastic and paints antiseptic, scientific

instruments, photography, fuel combustion, wastewater

treatment facilities, paper mills and medical and

agriculture field.

This metal easily penetrates into tissues such as

kidney, lung, blood stream, connective tissue, brain,

adrenal and other endocrine glands (ATSDR 1999;

Joseph et al.2001; Jagadeesan and Sankarsamipillai

2007) and it may be caused damages in all these tissues.

Reproductive hazards from metal exposure in males are

one of the fastest growing areas of concern in

toxicology today. Exposure to different heavy metals

causes irreversible toxic insult to male reproductive

system. Heavy metals produce cellular impairments at

structural and functional level in male reproductive

system. The effect of heavy metals, such as lead,

mercury, cadmium, chromium and arsenic on male

reproduction has been studied in details in various

experimental species.

Metals could interfere with the gametogenic cells or

Leydig cell or spermatozoa directly in semen. These

effects may results in reduced fertility or associated

with pregnancy wastage, congenital malformation

associated with genetic diseases. Potential toxicity of

Metals caused alteration in sperm morphology, count,

motilityas well as biochemical disruptions of enzymes

and hormones (Jagadeesan and Sankarsamipillai 2007).

Therefore, the present study aims to evaluate the effects

of mercuric chloride on sperm parameters and

histopathology on kidneys.

Materials and methods

Animals and Diet

Forty Swiss albino male mice 8 to 10 weeks of age

weighing 28-30 g were used for this study. These mice

were inbred in the animal house of the Zoology

Department/ Faculty of Science / University of Tripoli.

The mice were housed in plastic cages containing

wooden flakes and had free access to water and

standard diet (ad libitum).

Experimental design

Experiment was conducted for eight weeks. Animals

were divided into four groups, each group contain ten

animals. Group I was received an equivalent amount of

Original article

Abstract

Mercury chloride (HgCl2) is a toxic substance increasingly being recognized as a potential environmental pollutant.

In this study, sperm parameters have been studied to relate the effects of HgCl2 on mice fertility and to evaluate the

toxicity of HgCl2 on kidney. The kidney is well documented as the target organ for HgCl.2. Forty Swiss albino male

mice, eight to ten -week-old and weighing 28 - 30 g. Animals were divided into four groups, each group contain ten

animals and injected intraperitoneally weekly with 0, 0.5, 1.0 and 2.0 mg mercury chloride /kg body weight for eight

weeks respectively. Sperms of vas deferens were evaluated with respect to sperm count, motility, and morphology.

Total sperm count and motility were significantly decreased in dose dependent manner of Mercury chloride, while

sperm abnormality increased consistently at different doses of mercurial treatment over a period of eight weeks.

Maximum sperm abnormality among the treated groups was noted in the group given 2 mg/kg body weight. The

study revealed that Mercury chloride has a potency to alter sperm parameters. Also, histological alterations were also

observed in the Kidney.

Libyan Journal of Veterinary and Medical Sciences December 2015 Vol. 1 (2): 29 -32

*Corresponding Author: Habiba A. El Jaafari, Department of Zoology, Faculty of Science, University of Tripoli, Tripoli-

Libya, Tele: 0927227431, E. mail: habibaali350@gmail.com , Department of Zoology, Faculty of science, University of Tripoli. Tripoli, Libya. Tele.+ 218092 404 65 67. E.mail:

Refaat_tb@yahoo.com.

29

El Jaafari et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:29-32

. distilled water and served as control. Group II, Group

III and Group IV were injected intraperitoneally with

0.5, 1.0 and 2.0 mg mercury chloride /kg body weight /

weekly respectively.

Seminal Fluid collection

Groups of treated and untreated mice were killed

after 24 hours from the last injection by cervical

dislocation. Sperm of each mouse were obtained by

squeeze the vasa deferentia gently into 1ml normal

saline in small dish. The specimen was mixed gently

by a special dropper to distribute the seminal fluid.

Sperm suspension was incubated for 15 minutes at 32

ºC to allow sperm separation (El Jaafari 1995).

Determination of sperm count:

Sperm counts were made using the method by

Sakamoto and Hashimoto (1986) modified by El Jaafari

(1995). The sperm were counted by charging both

chambers of improved Neubauer Hemocytometer with

sperm suspension. Sperm count expressed as million

per millileters.

Examination of sperm morphological

For sperm morphology test, two smears were made

from each mouse, and allowed to dry in air. Smears

were stained with 1% eosin Y in water for 10 minutes.

From each mouse 500 sperms were examined at 400

magnifications for morphological abnormalities.

Results were expressed as percentage of abnormal

sperm (Otitoloju et al. 2010).

Determination of sperm motility

Sperms from both treated and untreated mice were

examined according to Ficsor and Ginsberg (1980) by

using the improved Neubauer hemocytometer

(American optical Co., Buffalo. N. Y). Numbers of

motile and non-motile sperms of treated and untreated

mice were counted under the X40.

Histological study

For histological examination, specimens from

kidneys tissue were taken immediately after sacrificing

mice, and fixed in 10% formalin solution. The fixed

specimens were then trimmed, washed, dehydrated, and

embedded in paraffin. Sections of 5 µm thickness were

cut with a manual microtome, stained with Hematoxylin

and Eosin (H&E). The stained sections were examined

under the microscope and the different cell types were

carefully studied and photographed (Bancroft and

Gamble 2002).

Statistical analysis

The statistical analysis was conducted using SPSS

(Software packing version 18). Treatment was

compared by applying one way ANOVA. Post hoc test

(LSD) was performed. The difference was considered

significant at p<0.05.

Results

The effect of mercuric chloride (HgCl2) on sperm

motility, count and abnormality is shown in (Table 1).

The results indicated that the administration with HgCl2

caused a significant (p≥0.05) decrease in both sperm

counts and sperm motility with associated significant

(p≥0.05) increase in the percentage of abnormal sperms

in dose dependent manner as compared with the control

group. Sperm morphology test of treated mouse with

different doses of mercuric chloride showed different

sperm phenotype abnormalities such as Club-shaped

head, Banana-like head, bent head, fused head, two

tails, lasso-like and folded mid piece.

Table 1: Toxic effect of mercuric chloride on sperm count, motility and morphology of mouse.

Treatments Sperm count

(106/ml)

Number of motile

sperm(106/ml)

Number of sperm with

abnormal morphology

Control 26.15 ± 0.33 10.87 ± 0.35

(41.56%)

11.00 ± 1.72

(2.2%)

Mercuric chloride

(0.5mg/kg) 20.9 ± 0.29*

7.00 ± 0.37*

(33.49%)

63.37 ± 3.47*

(12.67%)

Mercuric chloride

(1.0mg/kg) 17.52 ± 0.62*

3.62 ± 0.49*

(20.66%)

115.62 ±5.04*

(23.12%)

Mercuric chloride

(2.0mg/kg) 13.45 ± 0.43*

3.62 ± 0.49*

(26.91%)

171.62 ± 10.28*

(34.32%)

Parameters= mean± SE; *, significantly different compared to control mice at p≤0.05.

Numbers in parenthesis represent the percentage value.

Histopathological observations:

HgCl2 administration caused prominent

histopathological damage in kidneys compared with

those of control group mice (Figure 1). The kidney

sections from the control group preserved histological

structures with normal appearance of glomerulii,

proximal and distal convoluted tubules and collecting

tubules (Figure 1.A). In contrast, the kidney sections of

HgCl2 treated mice with 0.5mg/kg and 1.0 mg/kg

showed significant areas of tubular dilation with

hemorrhage and degeneration of renal corpuscles,

inflammation of renal epithelium, congestion of renal

lumen and cloudy swelling (Figure 1.B and Figure 1.C).

30

El Jaafari et al.

Libyan J. Vet. Med. Sci. Vol. 1 (2) December 2015:29-32

The kidney treated mouse with 2.0 mg/kg showed

hydropic degeneration of renal epithelial tubules

(Figure 1.D).

Figure 1: Histopathological changes in kidney of mouse: (A) photomicrographof untreated mouse kidney (control), (B)

Photomicrograph of treated mouse kidney with 0.5 mg/kg Hgcl2 showed renal tubular dilations with hemorrhage and

degeneration of renal corpuscles, inflammation of renal epithelial and congestion of renal lumen, Cloudy swelling, (C) Photomicrograph of treated mouse kidney with 1.0 mg/kg Hgcl2, (D) Photomicrograph of treated mouse kidney

with 2.0 mg/kg Hgcl2 showing hydropic degeneration of renal epithelial tubules.

Discussion

The mercuric chloride toxic effect is due to its

ability to forms organomercury complexes with proteins

(Lorshieder et al.1995). It has great affinity for thiol-

groups of Biomolecules, such as glutathione (GSH)

and sulfhydryl proteins, which may contribute to its

toxicity (Hansen et al.2006). In the present study the

administration of different doses (0.5, 1.0 and 2.0

mg/kg) of HgCl2 caused significant (p≤0.5) reduction in

both sperm count and sperm motility with associated

significant increase in the percentage of abnormal

sperms as compared with the control groups, which

assure with those results obtained by other investigators

(Otitoloju et al. 2010 and Rao and Sharma, 2001).

These changes may be attributed to impairment of

sperm maturation and secretory functions of epididymal

cells which might be due to oxidative stress or

insufficiency of androgens. It was also in agreement

with Khan et al. (2004) which reported that mercuric

chloride produced adverse effects on reproductive

performance of mice even though the route of

administration was different. Moreover, it was

consistent with the investigation of Fossato da silva et

al.(2011). Which relate the disturbance in sperm

parameter (increase in sperm abnormal shape and

decrease in both sperm motility and total sperm count )

to the effects of mercuric chloride on testicular

spermatogenic and steroidogenic functions in

experimental animals.

It is well known that mercuric chloride is one of the

pro-oxidants that induce oxidative stress which cause

lipid peroxidation and membrane damage leading to

loss sperm motility (Vachhrajani et al.1988). Mercury

can concentrate in the kidneys and testes, leads to

kidney failure and infertility through the effects on

epididymis and interfere in spermatogenesis (Eto et

al.1997), these facts might be the explanation for the

decrements in sperm count, motility and morphology in

this study.

Histopathological examination revealed that mice

administered with different doses of mercuric chloride

shows disturbance in structural integrity and cloudy

swelling compared with control group, it is well known

that the mercuric chloride accumulate more in renal

epithelium, so the endothelial damage by reactive

oxygen species could be the main sources for producing

large scale hemorrhages in kidney ,liver ,brain and

heart. Degenerative changes in the renal tubules

epithelium of kidneys may be due to deposit of

mercuric chloride in the kidneys, this results was in

agreement with other investigators (Oda et al.2012 and

Gado et al.2014). The pathological changes in the

kidney tissue include interstitial oedema, tubular

dilation, and sloughing of individual epithelial cells.

Also administration of mercury chloride dose 2.0 mg

/kg body weight causes hydropic degeneration in renal

epithelium.

31

El Jaafari et al.

Libyan J. Vet. Med. Sci. Vol.1 (2) December 2015:29-32

. Conclusion:

On the basis of sperm parameters, and kidney

pathological feature, our finding suggest that exposure

to mercuric chloride in male Swiss albino mice causes

severe tissue damage in all segments of kidneys and has

different effects on sperm parameter in short time. It

becomes clear that mercuric chloride exhibit

considerable toxic effect on most vital organs. So there

are urgent needs to develop preventive measures to

contain mercuric chloride toxicity.

References

ATSDR (Agency for Toxic Substances and Disease

Registry): Toxicological profile for mercury.

(1999). Atlanta: Department of Health and Human

Services, public health Service.

Bancroft JD, Gamble M (2002). Theory and practice of

histological techniques 5th

ed. Philadelphia:

Churchill Livingstone, pp.125-138.

Crinnion WJ (2000). Environmental medicine, part

three: long-term effects of chronic low dose mercury

exposure. Altern Rev Med.5:209-223.

Eljaafari HA (1995). Mutational effect of Acrylamide

on mouse testes and sperm parameters. M.Sc. Thesis,

Zoology department, Faculty of Science , University

of Tripoli. Tripoli- Libya.

Eto K, Yasutake A, Miyamoto K, Tokunaga H and

Otsuka Y (1997). Chronic effects of

methylmercury in rats.׀׀. Pathological aspects.

Tohoku J Exp Med.182:197-205.

Ficsor Gand Ginsberg LC(1980). The effect of

Hydroxyurea and Mitomycin C on sperm motility in

mice. Mutation Res.70:383-387.

Fossato da Silva DA, Teixeira CT, Scarno WR,

Favareto AA, Fernandez CDB, Grotto D, Barbosa

JrF and Kempinas WDG (2011). Effects of methyl

mercury on male reproductive functions in Wistar

rats. Reprod Toxicol.31:431-439.

Gado A, AbdelNasser I, Meshaal R, Majed MA, Fahad

IA, Faheid AA and Khalid AA (2014). Effect of

Carnitine against mercuric chloride- induced

Nephrotoxicity. J Am Sci.10(3):44-48.

Gul A, Yilmaz M and Selvi M (2004). The study of the

toxic effects of mercury-II- chloride to chub

Leuciscus cephalus. G.U.J.Sci.17:53-58.

Hansen J. Zhang H, Hones DP (2006). Differential

oxidation of thioredoxin-1 thioredoxin -2, and

glutathione by metal ions. Free Radic Biol

Med.40:138-145.

Jagadeesan G, Sankarsami Pillai S (2007).

Hepatoprotective effects of taurine against mercury

induced toxicity in rats. J Environ. Biol.28:753-756.

Joseph Mercola DO and Klinghardt MD (2001).

Mercury toxicity and systemic elimination agents. J

Nutr Environ Med. 11:53-62.

Khan AT, Atkinson A, Grahan TC, Thompson SJ, Ali S

and Shireen KF (2004). Effects of inorganic

mercury on reproductive performance of mice. Food

Chem Toxicol 42:571-577.

Lorschieder FL, Vimy, MJ and Summers AO (1995).

Mercury exposure from silver tooth filling:

emerging evidence questions a traditional dental

paradigm. FASEB J. 9:504-508.

Oda SS, El-Ashmawy IM (2012). Protective effect of

Silymarin on Mercury - induced Acute Nephro

Hepatotoxicity in Rats. Global Veterinarria

9(4):376-383.

Otitoloju AA, Otubanjo OA and Osunkalu VO (2010).

Preliminary study on the Induction of sperm head

abnormalities in mice, Mus musculus, exposed to

Radiofrequency Radiations from global System for

mobile Communication Base Stations. Bull Environ

Contam Toxicol (84):51-54.

Rao MV and Sharma PS (2001). Protective effect of

vitamin E against mercuric chloride reproductive

toxicity in male mice. Reprod Toxicol. 15(6):705-

712.

Sakamoto J and Hashimoto (1986). Reproductive

toxicity of acrylamide and related compounds in

mice: Effect on fertility and sperm morphology.

Arch Toxicol.59:201-205.

Sharma MK, Patni R, Kumar M and Kumar A (2005).

Modification of mercury induced biochemical

alterations in blood of Swiss albino mice by

Spirulina fusiformis. Environ Toxicol har.20:289-

296.

Stacchitti A, Borsani E, Rodella L, Rezzani R, Bianchi

R and Lavazza A (2003). Dose-dependent mercuric

chloride tubular injury in rat kidney. Ultrastructural

Pathol. 27(4), pp.253-259.

Trasande BL, Landrigan PJ and Schechter C (2005).

Public health and economic consequences of methyl

mercury toxicity to developing. Environ Health

Persp.113:590-596.

Vachhrajani K, Makhija S,Chinoy N, Chowdhury A

(1988). Structural and functional alterations in testis

of rats after mercuric chloride treatment. J Reprod

Bio Compara Endocrinol. 8:97-104.

32