Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
C H A R A C T E R I Z A T I O N OF OCTN1 A N D OCTN2
IN T H E H U M A N M A M M A R Y G L A N D
by
Bruce Chia- Wah Kwok
A thesis submitted in corfonnity with the requirements for the degree of Master of Science.
Graduate Department of Pharmacology
University of Toronto
O Copyright by Bruce Chia-Wah Kwok (2001)
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, 10- distribute or sell copies of diis thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither tbe thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the autbor's permission.
L'auteur a accordé une licence non exclusive permettant A la Biblioth&que nationale du Cana& de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la fonne de microfiche/nlm, de reproduction sur papier ou sur format dectronique.
L'auteur conserve la propndté du droit d'auteur qui protége cette Wse. Ni fa thèse ni des extraits substantiels de celle-ci ne doivent être imprimbs ou autrement reproduits sans son autorisation.
A B S T R A C T
Bruce Chia-Wah Kwok Characterization of OCTNl and OCTN2 in the Human Marnmary Gland Graduate Department of Pharrnacology, The University of Toronto Master of Science. 200 1
Breastfeeding provides the optimal source of nutrition for newbom infants. However, many
mothers require medication while nursing. Knowledge regarding the mechanisms of drug
transport into breast milk is lacking. The purpose of this thesis is to investigate whether two
members of the organic cation transporter family, hOCTNl and hOCTN2, are responsible for
cationic drug transport inio breast milk. Using RT-PCR, mRNA for both transporters were
found in human mammary gland derivatives. Functional transport experiments determined
the pH-dependency of ['"ITEA uptake, and ~a*-dependency of [3~]~-camit ine uptake in an
in vitro mammary epithelial model. In addition, mathematical modelling of TEA and L-
carnitine uptake found that transport was best described by two functionally distinct systems.
In conclusion, these findings suggest that, while hOCTN 1 may not contribute significantly to
TEA uptake in MCF-12A cells, hOCTN2 plays an important role in L-carnitine uptake.
Therefore, this transporter may participate in dnig transport within the mammary gland.
A C K N O W L E D G E M E N T S
My sincerest thanks go out to my supervisor, Dr. Shinya Ito, for allowing me to be a part
his lab, and providing me with guidance, encouragement, and support these past two years.
1 would also like to thank my advisor, Dr. Richard Romahel, for helping guide me in the
proper direction; Vicki Cook for her technical assistance; and Andrea Tropea and Bemice
Wang for taking some of the weight off my shoulders.
My special thanks go out to Diana Stempak, Daphne Chan, Kathy Aleksa, and Shannon
Dallas for helping me get this thesis to the state that it is in today. Your fkiendship and
support will never be forgotten.
To al1 my fiiends in the labs, at the desks, on the Motherisk phones, with multiple pagers,
and to everyone who stopped and shared a smile with me, you made coming to work that
much more Fun. Thank you. 1 will miss you all.
Lastly, I would like to thank my family for constantly being there for me and encouraging
me wherever 1 go.
iii
T A B L E OF C O N T E N T S
. . A B S T R A C T ............................................................................................. 11
... A C K N O W L E D G E M E N T S ..................................................................... 111
... L I S T OF T A B L E S ................................................................................ v ~ i i
L I S T O F F I G U R E S ............................................................................... ix
L I S T O F A B B R E V I A T I O N S ............................. ... ............................ xi
I N T R O D U C T I O N .............................................................................................................. 1
I Breastfeeding ......................................................................................................................... 2
I . 1 The Benefits of Breastfeeding ................................................................................... 2
........................................................ .......................................... 1.2 The Mammary Gland ... 3 Anatomy and Histology ..................................... .. ............................................... 3 Mammary Gland Changes during Pregnancy and Lactation .................................. 3
........................................................................................ ................... Breast Milk. ., 5 ....................................................................................................... Composition 5
........................................................................................................... Lactogenesis 7
Modes of Milk Secretion ....................................................................................... 7 ........................................................................................................ Golgi Route 9
................................................................................................ Membrane Route 9 .............................................................................................. Milk Fat Route 9
Transcytosis ..................................................................................................... 10 Paracellular Route ..................................................................... -10
2 Maternal Drug Use during Lactation .................................................................................... 10
2.1 Pediatric Handling of Drugs ........................................................................................ 1 1 2.2 Adverse Effects of Drug Use during Lactation ......................................................... 11
2.3 Factors that Influence the Excretion of Drugs into Breast Milk .................................. 12 2.3.1 Maternal Factors ................................................................................................... 12
............................................................................ 2.3.2 Physical Properties of the Drug 1 3 ............................................................................................ 2.3 .2.1 Molecular Weight 13
................................................................................................ 2.3.2.2 Lipid Solubility 13
................................................................................................ 2.3.2.3 Protein Binding 14 2.3.2.4 Ionization ..................................................................................................... 1 4
................................................................................................... 2.4 Milk-to-plasma ratio 15
................................................................................... 2.5 Mechanisms of Drug Transport 15 ............................................................................................................... 2.5.1 Difision 16
............................................................................................ 2.5.2 Facilitative Diffusion 16 2.5.3 ActiveTransport ........................................................................................... 1 7
..................................................................................................... 3 Organic Cation Transport 17
.................................................................................................. 3.1 MDR l/P-glycoprotein 18
................................................................. 3.2 Organic Cation Transporter (OCT) Family 19
............................................................................................................... 3.2.2 hOCTNI 21 ....... .............,...,.,,,.......,,.......,...*......,......,...,........,.......... 3.2.2.1 Tissue distribution .. 21 .......................................................................................... 3.2.2.2 Functional Activity 22
3.2.3 hOCTN2 ................................................................................................................ 23 . . ........................................................................................... 3.2.3.1 Tissue distribution. 23 ................................................ 3.2.3.2 Functional Activity ..................................... ... 25
4 Hypothesis ................ ... ................................................................................................. 30
5 Rationale .............................. ... ........................................................................................ 30
............................................................................................................................. 6 Objectives 31
M A T E R I A L S & M ETHOD S ............................................................... 32
.................................................................................................................... 7.1 Materials 32
7.2 Ce11 culture ................................................................................................................... 32 ......................................................................................... 7.3 Mamrnary tissue processing 32
...................................................................... 7.4 Kidney tissue processing -33
7.5 Total RNA isolation .................................................................................................... 33 . . ........................................................................................... 7.6 Reverse transcription (RT) 35 7.7 Polymerase chah reaction (PCR) .............................................................................. 35
.................................................................................................................. 7.7.1 Primers 35 7.7.1.1 hOCTN1 ........................................................................................................... 35 7.7.1.2 hOCTN2 .......................................................................................................... 36
....................................................................................................... 7.7.1.3 p-actin 3 6 7.7.2 PCR reactions ................................................................................................. 37
........................................................................................ 7.8 Subcloning of PCR products 38 ............................................................................................ 7.9 Isolation of plasmid DNA 39 ......................................................................................... 7.10 Restriction enzyme digests 4 0
7.11 Sequencing .................................................................................................................. 40
.................................................................................................. 7.12 Northem blot analysis 41 ........................................................................................... 7.12.1 Probe preparation 4 1
........................................ 7.12.2 RNA gel electrophoresis and transfer to membrane 4 2 ..................................................... 7.12.3 Hybridization with DIG-labelled ribuprobes 4 3
7.12.4 Immunological drtection ................................................................................... 43
...................................................................... 7.1 3 Electron microscopy of MCF- 12A cells 4 4
....................................................................... 7.14 Functional studies in MCF- 1 2A cells 44 ................................................................................................ 7.14.1 Plate preparation 4 4
7.14.2 Uptake experiments ............................................................................................. 45 ............................................... 7.14.3 Carnitine concentration dependence experiments 45
..................................................................................... 7.1 4.3.1 Mathematical fitting 4 7 ...................................................................... 7.14.3.2 Selection of a best-fit mode1 4 8 ....................................................................... 7.14.4 Inhibition of uptake experiments 49
............................................................................................................. 7.15 Dataanalysis 49
. . ........................................................................................ 8.1 Molecular charactenzation 5 0
......................................................................... 8.1.1 hOC'ITJ 1 a d hOCTN2 RT-PCR 50 ................................................................................................ 8.1.1 . 1 MCF- 12A cells 50
........................................................................... 8.1.1.2 Verification of PCR products 50 ................................................................ 8.1 . 1.3 HMEC and human mammary tissue 53
................................................ 8.1.2 Northem blot analysis of hOCTNI and hOCTN2 60
................................................................................... 8.2 Morphology of MCF- 12A cells 62
........................................................................................ 8.3 Functional characterization 6 2
14 ............................................................................... 8.3.1 [ C]TEA uptake experiments 65
................................................................ 8.3.1 . 1 pH dependency ......... ................. 6 5 14 8.3.1.2 [ CITEA concentration dependency ............................................................. 6 5
3 ....................................................................................... 8.3.2 [ H]L-carnitine uptake 6 9 8.3.2.1 Time course ...................................................................................................... 6 9 8.3.2.2 ~ a + dependency ............................................................................................... 71 8.3.2.3 Concentration dependence ............................................................................... 71
............. 8.3.2.4 Inhibition of ['HIL-camitine uptake by various cationic compounds 74
D I S C U S S I O N ......................................................................................... 77
. . 9.1 Molecular Charactenzation ....................... .................................................................... 77
........................... 9.1.1 Expression of hOCTNl and hOCTN2 in the Mammary Gland 77
........................... ................................................... 9.2 Morphology of MCF- 1 2A cells .. 79
. . 9.3 Functional Charactenzation.. ................................................................... 80 9.3.1 ["CITEA uptake in MCF- 12A cells ..................................................................... 80 9.3.2 ['HIL-~arnitine Uptake in MCF l2A cells ............................................................ 81
................................................................................................ 9.3.3 Clinical Relevance 83
.................................................................................................................. 10 Limitations 84 ............................................................... 1 O, 1 Limitations: moleculzu characterization 84 ............................................................... 10.2 Limitations: functional characterization 85
I 1 Future Studies .............................................................................................................. 85 ........................................................... 1 1 . 1 Future Studies: molecular characterization 85
11.2 Future Studies: fùnctional characterization .................... .., ................................. 86
C O N C L U S I O N S ..................................................................................... 88
L I S T OF R E F E R E N C E S ............................................................................................ 89
A P P E N D 1 X A ................................................................................................................... 99
vii
L I S T OF T A B L E S
table 1 Partial list of components found in human milk ......................................... 6
table 2 Matenal drugs with reported toxicity in breast-fed infants ........................... 12
....................... table 3 Summary of characteristics of the organic cation transporters 28
.............................. table 4 ["CITEA uptake kinetic parameters in MCF- 12A cells 67
.................... table 5 Ooodness-of-fit criteria for [ ' 4 ~ ] ~ ~ ~ uptake in MCF- I2A cells 69
........................ table 6 [3~]~-carnitine uptake kinetic parameters in MCF-I 2A cells 74
viii
figure 22 Inhibition of [3~]~-camitine by various compounds.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .76
L I S T O F A B B R E V I A T I O N S
ABC
AIC
ANOVA
ATP
BLM
'JP BPE
cDNA
Da
DEPC
DNA
dNTP
EDTA
hEGF
HEK
HMEC
HRPE
HSC
Ic50
IgA
kB
K m
LB
M/P ratio
MCF- 1 2A
MDR
MEBM
ATP-binding cassette
Aikaike's information criterion
analysis of variance
adenosine triphosphate
basolateral membrane
base pair
bovine piniitary extract
complimentary deoxyribonucleic acid
dalton
diethyl pyrocarbonate
deoxyribonucleic acid
deoxynucleotide triphosphate
ethylene diamine tetracetic acid
human recombinant epidermal growth factor
human embryonic kidney
hurnan myoepithelial ce11 line
human retinal pigment epithelia
Hospital for Sick Children
50% inhibitory concentration
immnunoglobulin A
kilobases
Michaelis constant
Luria-Bertani
milk-to-plasma h g concentration ratio
human mammary epithelial ce11 line
mu l t i hg resistance
mammary epithelitun basal medium
MEM
M-MLV-RT
MOPS
MPP'
mRNA
NaAc
NS
OCT
OD
PBS
PCR
p - a
P K ~ PSCD
RNA
rPm
RSS
RT-PCR
SC
SD
SDS
S WCHSC
TEA
T m
UV
vm, X-Ga1
minimum essentid media
Moloney Murine Leukemia Virus Reverse Transcriptase
3-[N-Morpholino]propanesulfonic acid
1 -methy l-4-pheny l p yridinium
messenger ribonucleic acid
sodium acetate
not significant
organic cation transporter
optical density
phosphate-bu ffered saline
polymerase chain reaction
P-glycoprotein
ionization constant
primary systemic carnitine deficiency
ribonucleic acid
revolutions per minute
residual sum of squares
reverse transcription-polymerase chain reaction
Schwartz criterion
standard deviation
sodium dodecyl sulphate
Sunnybrook and Women' s College Hospital
tetraethylamrnoniurn
annealing temperature
ul travioiet
maximal binding capacity
5-bromo-4-chloro-3 -indol yi-P-D-galactoside
xii
I N T R O D U C T I O N
Increasing evidence accumulates each year in support of hurnan milk as the best source of
nutrition for newborn infants (AAP, 1997). In fact, few substances are comparable at meeting
the nutritional demands and requirements that human infants need for the first four to six
rnonths of their development (Picciano, 2001). Over the past few years, a number of
pathways have been characterized that help explain the mechanisms by which mothers pass
on the many valuable nutrients and compounds (e.g. lactose, calcium, immunoglobulins) to
their children via breastfeeding (Burgoyne and Duncan, 1998; Shennan, 1998; Shennan and
Peaker, 2000). However, much less information is available conceming how potentially
harmfùl compounds, such as xenobiotics, are transferred into breast rnilk. Specifically, this
thesis focuses on the transport of cationic drugs (e.g. fluoxetine, atenolol, and
carbarnazepine) due to their clinical importance within society.
Members of the organic cation transporter (OCT) family are expressed in various organs
such as the liver, intestine, and kidney (Burckhardt and Wolff, 2000; Dresser et al., 2001; Ito,
1999; Koepsell, 1998). They have been found to transport cationic compounds, such as
endogenous neurotransmitters and exogenous h g s , into, within, and out of the body
(Koepsell, 1998). Thus, the aim of my research is to expand on this knowledge by
investigating whether a possible role for these transporters exists in the human mammary
gland. In doing so, we may gain a better understanding of how certain compounds become
transferred into breast milk. This will allow us to discover ways of minimizing inadvertent
drug exposure to the nursing infant through breastfeeding.
t Brcrstfdiag
1.1 The Benefits o f Breastfeeding
Many advantages of breastfeeding have been documented in the literature. Hurnan milk is
uniquely fomulated to meet the dietary needs of the infant (AAP, 1997). Studies have show
that breastfeeding can improve a child's general health and development, as well as
significantly decrease their risks for various chronic and acute diseases (AAP, 1997). These
include reports of breast milk lowering the incidence andlor severity of lower respiratory
infections (Frank et al., 1982; Lopez-Alarcon et al., 1997), necrotizing enterocolitis
(Winiko& 1982), and urinary tract infections (Pisacane et al., 1 Wî), as well as potentially
playing a role in preventing sudden infant death syndrome (Ford et al., 1993; McVea et al.,
2000), insulin-dependent diabetes mellitus (Mayer et al., 1988; Samuelsson et al., 1993), and
Crohn's disease (Koletzko et al., 1989).
Although infants benefit the most fkom breastfeeding, advantages are also extended to
their mothers, families, and society. Due to the high levels of oxytocin in their bodies,
mothers who breastfeed tend to have less postpartum bleeding, and experience faster uterine
involution (Chua et al., 1994). In addition, some studies have found that breastfeeding may
decrease the risks for ovarian cancer in these women (Risch et al., 1983; Rosenblatt and
Thomas, 1993). Finally, breastfeeding also presents a number of financial benefits. For
exarnple, families incur significant savings as they do not need to purchase infant formula for
their child. Furthemore, because of breastfeeding's ability to decrease the incidence of
illnesses, financial benefits extend into society in the form of reduced demand on the health
care system (Bal1 and Wright, 1999; Dagan and Pridan, 1982; Montgomery and Splett, 1997).
1.2.1 Anatomy and Histology
The human marnmary gland is composed primarily of skin, subcutaneous tissues, and the
corpus marnmae. This last structure contains the functional units of the gland and consists of
two major divisions: the parenchyma and the stroma. Making up the parenchyma are
ductular-lobular-alveolar structures that branch to form a tree-like arrangement. Alveoli are
found at the terminal ends of this branching and represent the secretory units of the rnammary
gland. Clusters of alveoli combine together to f o m lobuli, which then combine to become
lobules. The milk that is produced proceeds along lactiferous ducts, into lactiferous sinuses,
before reaching the nipple (see figure 1). The stroma represents the other part of the corpus
rnammae and is comprised of connective tissue, adipose tissue, blood vessels, nerves, and
lymphatics (Lawrence, 1989).
Histologically, in the resting marnas, gland, a layer of stratified squamous epithelium
lines the lactiferous ducts. Along the alveoli and alveolar ducts are a layer of secretory
epithelial cells that are cuboidal or low-columnar in shape. Microvilli can be found on the
apical surfaces of these cells (Neville, 1991). A loosely meshed network of myoepithelial
cells surrounds these mammary cells (Lawrence, 1989). During lactation, these cells contract
to eject milk from the lumen of the alveoli (Sherwood, 1993b).
1.2.2 Mammary Gland Changes during Pregnancy and Lactation
Full development of the alveoli and maturation of the mammary epithelium takes place
during pregnancy. This is due to the elevated levels of progesterone and prolactin circulating
ût the time. Although estrogen is also present, its role in marnmary gland development in
pregnancy is unclear (Neville, 1983). During pregnancy9 the xmmmary gland enlarges
because of the increased proliferation of parenchymal cells, as well as by distention of the
alveoli by early milk production (Neville, 2001). By mid-pregnancy, the alveoli are hlly
capable of secreting milk proteins, however, secretion is delayed until after parturition by the
presence of high levels of plasma progesterone due to pregnancy (Neville, 199 1).
By lactation, a substantial increase in the number of alveoli has occurred (Lawrence,
1989). This results in relatively less comective tissue and adipose tissue surrounding each
lobule. As lactation ends, and the child is weaned, there is a gradua1 resorption of the alveolar
complexes which allows the marnrnary gland to retum to its pre-pregnancy state (Neville,
199 1).
1.2.3 Breast Milk
1.2.3.1 Composition
Breast milk is a complex Buid composed of many different constituents. These include
solutions, colloids, fat-globule membranes, and living cells (Lawrence, 1994; Picciano, 200 1 ;
see table 1).
The composition of hurnan milk varies both arnong and within women. Some of the
factors that can affect composition include the stage of lactation, matemal nutrition, as well
as the time of day (Picciano, 2001). The first mammary secretion following parturition
consists of a thick, yellow fluid known as colostrum. This fluid is high in proteins,
immunoglobulins, water-soluble vitamins and minerais, as well as ions such as sodium,
potassium, and chloride; however, it is low in fat (Lawrence, 1994; Neville et al., 2001). As
breast milk matures, there is a decrease in the levels of total protein and immunoglobulins,
Non-protein nitrogen
I Water-soluble vitamins
Minera1 and Ionic Components
Cellular Components
lactalbwnin lactoglobulin caseins enzymes growth factors hormones secretory IgA and other immunoglobulins
camitine creat ine glucosamine nucleotides urea
lactose oligosaccharides
fat-soluble vitamins fatty acids tr igl ycerides
choline folate thiamine vitamins Bg, B12, and C
calcium magnesium sodium potassium chlorine phosphate
epithelial cells leukocytes lymphocytes macrophages neutrophils
Table 1: Partial list of componeats found in human milk (adapted fiom Picciano et al, 200 1 and Lawrence, 1 994)
which is accompanied by an increase in fat, lactose, and fat-soluble vitamins (Hibberd et al.,
1982).
1.2.4 Lactogenesis
The process of milk production is termed lactogenesis. During lactogenesis, the secretory
alveolar cells of the marnmary gland undergo a nurnber of cellular changes. These include
increases in the number of mitochondria to meet the greater mctabolic demands, as well as
changes in cellular morphology (Le. from cuboidal to more cylindrical shaped) (Lawrence,
1989). The basolateral membrane (BLM) of the cell also becomes extensively convoluted to
increase surface area and maximize the transfer of materials from the bloodstream
(Lawrence, 1989).
As mentioned earlier, the mamrnary gland is capable of producing milk by mid-
pregnancy, however, only following parturition does extensive milk production begin
(Neville, 1991). A large increase in milk volume usually occurs approximately 40 hours
postparnim (Neville et al., 200 1). The majority of al1 milk is synthesized during the process
of suckling. This production is regulated by the hormone prolactin (Shenvood, 1993b).
1.2.5 Modes of Milk Secretion
In order for compounds to enter breast milk, they must first cross the epithelial cells of
the marnrnary gland. Five major pathways involved in the secretion of milk constituents are
currently known. They are: 1) the Golgi route, 2) the membrane route, 3) the milk fat route,
4) transcytosis. and 5) the paracellular route (see figure 2).
Fat globules
lumen
Tight jundion
Membrane vesicles
Protein
Myoepithelial cell
Basement membrane
Figure 2: Modes of milk secretion acrws the mammary epitbelium This diagram depicts the major routes of transport across the mammary epithelium. These include: 1 ) the Golgi route, 2) the membrane route, 3) the milk fat route, 4) transcytosis, and 5) the paracellular route. Please refer to section 1.2.3.3 for further information conceming each route. (adapted fiom Shennan and Peaker, 2000)
1.2.5.1 Golgi Route
The major nutrients found in the aqueous phase of breast milk are secreted via the Golgi
route. Examples include casein, whey proteins, lactose, calcium, and a-lactalburnin (Neville,
1991). Proteins that are secreted via this route are first synthesized on ribosomes within the
mammary epithelium. Subsequently, they are tnuisported into the endoplasmic reticulum
where they are folded, modified, and transported through the Golgi system. Secretion into the
alveolar lumen is accomplished by exocytosis (Shennan and Peaker, 2000).
1.2.5.2 Membrane Route
With this route, substances cross the apical or BLM of the secretory cells via substiate-
specific channels and transporters. The few milk components that utilize this route are
relatively small molecules such as water, urea, glucose, sodium, potassium, and chloride
(Shennan, 1998). The mechanism of transport varies with each compound that uses this route.
For example, the GLUT family of glucose transporters utilizes facilitative diffision to
transport D-glucose, whereas Na' and K' concentration gradients are maintained by N~+/K+
ATPase activity (Kinura, 1969; Sheman, 1998)
1.2.5.3 Milk Fat Route
Lipids synthesized within the mammary gland epithelia are secreted through the milk fat
route. Using fatty acids and glycerol as precursors, triacylglycerols coalesce and migrate
towards the apical surface of the cell. From there, the lipids become encapsulated by the
plasma membrane and enter the milk. Substances secreted by this pathway include milk fat
and lipid-soluble hormones (Wendrinska et al., 1993).
This pathway allows intact proteins such as imrnunoglobulins, transfenin, and prolactin
to enter the milk within specialized vesicles (Hunziker and Kraehenbuhl, 1998; Ollivier-
Bousquet, 1998). They do so by binding with specific recepton on the BLM of the cell. From
there, they are intemalized within membrane vesicles and transported to the apical membrane
or to the Golgi apparatus (Neville et al., 1983).
1.2.5.5 Paraceilular Route
The paracellular route involves the passage of substances between epithelial cells. In most
cases, this method of transport does not play a major role since the gaps between cells are
closed during lactation by the formation of tight junctions (Neville et al., 1983; Neville,
1991). When these tight junctions become leaky, such as during pregnancy and mastitis, milk
components are allowed to pass freely between the milk and the bloodstream (Nguyen and
Neville, 1998).
2 Materna1 Drug Use during Lactation
Studies have found that approximately 90% of mothee take some form of medication
following the delivery of their child (Matheson, 1985; Passmore et al., 1984). The possibility
that these medications may result in adverse effects to the nursing infant is of serious
concem. It is generally accepted that most drugs, whether they are over-the-counter or
prescription medications, are found in the breast milk to some degree (Banta-Wright, 1997).
In the majority of cases, these drugs cm be safely taken since clinically significant amounts
(more than 10% of the weight adjusted matemal dose (Ito, 2000)) are not attained in the
infant. However, certain drugs have been found to accumulate in breast milk, thereby
increasing the amount of exposure ta the suckling child. This may lead to toxicity in the
child. Among these dmgs are a number of cationic compounds, such as atenolol and
fluoxetine.
2.1 Pediatric Handling of Drugs
The ability of neonates and infants to handle dmgs differs from that of adults. This can be
attributed to differences in absorption, distribution, metabolism, and excretion. In neonates,
several factors can affect drug absorption such as prolonged gastric ernptying time as well as
gastric and duodenal pH levels (Morselli, 1989). These and other factors rnay either increase
or decrease the amount of drug that is absorbed, depending on its physicochemical properties.
Distribution of dmgs in neonates and infants also differs fiom adults since neonates typicd:y
have greater total body water per body weight basis, as well as decreased plasma protein
binding (Morselli et al., 1980). In addition, studies have found that neonates have a
significantly lower metabolizing capacity than adults (Besunder et al., 1988; Cazeneuve et
al., 1994). For example, overall cytochrome P450 activity was found to be half the level of
that found in adults (Aranda et al., 1974). Since these enzymes play an important role in drug
metabolism, decreased activity may lead to increased concentrations of certain dmgs that are
biotransformed using these pathways. Lastly, excretion of dmgs in neonates is typically
decreased due to immature renal function (Morselli, 1989).
2.2 Adverse Effects of Drug Use during Lactation
In a follow-up study that looked at adverse effects in breastfed infants, it was found that
minor adverse events occurred in 1 1 % of those who were exposed to medications through
breast milk (Ito et al., 1993). However, none of these events required additional medical
assistance. Despite this finding though, there are a number of reports that demonstrate
significant toxicity in breast-fed infants from medications taken by their mothers (see table
2). This thesis focuses on one determinant of this toxicity; namely, the underlying
mechanisms of drug transport into breast milk.
atenolol phenobarbital chlorpromazine caEeine fluoxetine
1 indopthacin diaze am
Tabk 2: Maternal drugs with reported toxicity in breast-fed infants
Adverse effect
excessive P-blockade sedation lethargy, sedation imtability, poor sleeping imtability poor weight gain seizures sedation
2.3 Factors tbat Influence the Excretion of Drugs into Breast Milk
- -
Reference
Schimmel et al., 1989 Tyson et al., 1938 Wiles et al., 1978 Hill et al., 1977 Lester et al., 1993 Chambers et al., 1999 Eeg-Olofsson et al., 1978 Hagg and Spigset, 2000
2.3.1 Maternal Factors
A number of maternai factors are important in determining to what degree a drug is
transferred into breast milk. These include: 1) the dose of the drug, as well as its frequency
and route, 2) the clearance rate of the drug, 3) plasma protein binding, and 4) the degree of
metabolism (Wilson, 198 1). Al1 of these determine the final concentration of the drug within
the maternai circulation, which in tum will detemine the concentration of drug found in the
breast rnilk (Vorherr, 1974).
Other matemal factors that may also affect the transfer of dnigs into breast milk include
changes in the mammary gland due to lactation. lmmediately following the delivery of the
child, spaces between the mammary epithelial cells are wide enough to allow the passage of
large molecules such as immunoglobulins, cellular components, and proteins. Dunng this
time, dnigs have a greater chance of utilizing this paracellular route to enter the rnilk.
However, over the course of a few days, these spaces close and the formation of tight
junctions occur (Nguyen and Neville, 1998). Compounds must thereafler pass through the
epithelial layer to enter the milk.
2.3.2 Physical Properties of the Drug
2.3.2.1 Molecular Weight
The majority of drugs that nursing mothers take are less than 200 daltons (Da) in size,
however, they can range from drugs as small as 46 Da (e.g. ethanol) to drugs as large as 6000
Da (e.g. insulin) (Seeman and Kalant, 1998). When compared with protein molecules that are
millions of daltons in size, the rnajority of drug molecules have relatively low molecular
weights. This allows these smaller molecules to pass quite easily through biological barriers
and into the breast milk (Banta-Wright, 1997).
2.3.2.2 Lipid Solubility
The lipid solubility of a drug dictates not only its penetration through biological
membranes into breast milk, but also its accumulation within the milk fat (Wilson, 1981).
Due to the higher lipid content, lipophilic dnigs have a greeter chance of disuibuthg into
breast milk.
2.33.3 Protein Binding
A number of drugs are bound to proteins within the body, with most binding to
alburnin in serum. Within milk, a number of proteins, such as a-lactalbumin, lactofemn, and
immunoglobulin A (IgA), are also present (Lawrence, 1994). However, dmgs have not been
found to bind significantly to these proteins (Atkinson and Begg, 1988). In order to cross
membranes by diffision or reversed pinocytosis, the dmg must be in a free, unbound fom
(Endrenyi, 1998). Because of this, many highly protein-bound drugs are retained in the
plasma cornpartment and are not transferred into the breast milk.
2.3.2.4 Ionization
Depending on the pH of the sunounding medium and the ionization constant @Ka) of the
drug, ionization of compounds takes place to varying extents. Non-ionized dmgs are capable
of crossing lipid bilayers much more easily than ionized ones. Within the mammary gland,
the pH of plasma is slightly more alkaline (pH 7.4) than that of milk (pH 7.2) (Anse11 et al.,
1977). Due to this difference, drugs that are organic acids are more ionized in serum and will
therefore not cross into the breast milk. This results in a higher concentration of drug in
plasma compared with milk. On the other hand, organic bases will be more non-ionized
within the plasma. This allows these drugs to pass into breast milk across the membrane.
Once in the milk though, ionization of the drug may take place due to the increased proton
concentration. These drugs become ionized and are trapped in the breast milk. Given that
there is a constant equilibciurn between the ionized and non-ionized forms of the dmg, this
then leads to a greater concentration of dmg in the milk c o m p d with plasma (Seeman and
Kalant, 1998; Taddio and Ito, 1994; Wilson, 198 1).
2.4 Milk-to-plasma ratio
The milk-to-plasma drug concentration ratio (M/P) represents a ratio between the
concentration of drug found in breast milk and its concentration in matemal plasma. It is one
of the tools available to determine the extent of drug transfer during lactation. This measure
is influenced by physicochemical properties of the drug, such as protein binding,
lipophilicity, and ionization state (Fleishaker et al., 1987). Drugs with lower MIP ratios are
more iikely to result in lower milk concentrations than drugs with higher MIP ratios, with the
assumption that both drugs have similar clearance rates. Therefore, drugs with lower M R
ratios have a lesser chance of being associated with dose-related adverse effects in the
nursing infant compared with higher M/P ratio drugs (Bailey and Ito, 1997). Unfortunately,
one of the disadvantages of the M/P ratio is that it may Vary over time for a particular drug
(Taddio and Ito, 1994). One of the reasons for this variation is due to the changing
composition of breast milk over time (Picciano, 2001). Therefore, care must be taken to
report the exact stage of lactation at which these aiialyses occurred. However, when
accompanied by other information such as pediatric handling of the h g , the M/P ratio cm
prove very usefbl for evaluating the safety of medications in breastfeeding.
2.5 Mechanisms of Drug Transport
Drugs may be transported within the body by a number of different pathways and
systems. The routes that play the greatest role in drug transport are discussed here:
2 . 1 Diffusion
Since the majority of drugs are small molecules, difision plays an important role in the
transport of drugs across membranes. Water-soluble dmgs difise by utilizing aqueous
membrane pores, while lipid-soluble drugs pass between the lipid molecules of the
membrane (Wilson, 198 1).
The major determinant of dimision for water-soluble drugs is its molecular weight, since
the diameter of the membrane pores only permits drugs smaller than 150-200 Da to pass
through (Seeman and Kalant, 1998). Smaller water-soluble drugs, such as caffeine,
ephedrine, and low molecular weight diuretics, are transported via these charnels (Seeman
and Kalant, 1998).
Since membranes consist of a lipid bilayer, lipid-soluble drugs c m cross by diffusing
between the membrane molecules. This is accomplished through hydrophobic forces, since
the drug must first pass through a layer of unstirred water lining the ce11 membrane (Seeman
and Kalant, 1998). In the majority of cases through, the more lipid-soluble a dnig is, the
greater the rate of diffusion.
Lastly, factors such as the concentration and physicochemical properties of the drug, as
well as the surface area of the organ of absorption, also play a role in detemining how much
of the drug is taken across membranes by dimision.
2.5.2 Facilitative Diffusion
Facilitative difision of drugs requires the use of specialized carrier proteins that
transport compounds along a concentration gradient. These carriers form complexes with the
substrate, providing a faster rate of diffusion than fiee substrate alone (Seeman and Kalant,
1998). The substrate then dissociates once it has crossed the membrane. Exemples of the
drugs that are transported in this way include L-dopa and nucleotide anti-metabolites that are
used in cancer chemotherapy (Cass et al., 1999; Floud and Fahn, 198 1).
25.3 Active Transport
The active transport of dmgs goes against a concentration gradient and generally requires
energy in the form of ATP. This fom of transport is saturable and can be inhibited by
depleting ATP levels.
Although many drugs have a M/P ratio less than or equal to one, certain dmgs are known
to accumulate in higher amounts in milk than can be described by diffusion alone. The
transport of these drugs is thought to be carrier-mediated, possibly by similar mechanisms as
those that transport essential milk components. Cimetidine was one of the first drugs believed
to be actively transported into breast milk (Gerk et al., 2001b; McNamara et al., 1992; 00 et
al., 1995). In humans, its observed M/P ratio was 5.5 times higher than what was predicted
by diffusion (00 et al., 1995). The antibiotic, nitrofurantoin, was also found to be actively
transported into milk (Gerk et al., 2001a; Gerk et al., 2001b; Kari et al., 1997).
Unfortunately, the mechanisms by which these two drugs are transported into human miik
remain unknown.
3 Organic Cation Transport
Organic cations are compounds that contain a tertiary amine group or a quartemary
ammonium group (Groothuis and Meijer, 1996) (see appendix A). Their positive charge is
due to protonation of these groups at physiological pH. Endogenous organic cations include
neurotransmitters, such as dopamine and epinephrine, and arnino acids, such as glutamine. Of
the available therapeutic agents, it has been estimated that at least half are (partly) cationic in
nature (Groothuis and Meijer, 1996). These encompass a broad spectnun of clinically
important h g classes, including analgesics, antibiotics, antihistarnines, antiarrhythmics, and
antidepressants (Goodman and Gilman, 1990).
In order for these compounds to cross cellular barriers, two separate transport processes
must occur. First, the compound must cross the BLM for entrance into the ce11 (uptake).
Afterwards, it must cross the apical membrane to complete the transfer (emux). For
medications that undergo active transport, it is expected that transporter proteins must be
present on both the basolateral and apical surface to mediate the uptake and efflw,
respectively, of the drug. Some of the principal proteins involved in the transport of cationic
compounds within the hurnan body are described below.
3.1 MDRIIP-glycoprotein
The human MDRl gene codes for the drug efflux pump, p-glycoprotein (P-gp). This
transporter has been implicated in conferring multidrug resistance in a broad assortment of
cancer cells (Hrycyna et al., 1996; Juliano and Ling, 1976; Kartner et al., 1985). The 1280-
amino acid protein belongs to the family of ATP-binding cassette (ABC) ûansporters and is
responsible for the active extrusion of numerous drugs, many of which are cationic. These
include the vinca alkaloids (i.e. vincristine and vinblastine), steroids, cyclosporines, and other
hydrophobie cationic compounds (Ford and Hait, 1990). Although primarily found in cancer
cells, P-gp has also been detected in normal tissue, such as the proximal tubules of the kidney
and the biliary canalicular front of hepatocytes (Thiebaut et al., 1987). While its exact role in
these tissues is still unclear, it is speculated to facilitate the transport of biologically
important molecules, such as steroid hormones, peptides, and small lipophilic compounds,
across membranes (O'Brien and Cordon-Cardo, 1 996).
Although P-gp is best known for its ability to reduce the accumulation of cytotoxic drugs
within cells, its exact mechanism of action remains unclear. Some theorize that the drug may
become trapped within the inner and outer leaflet of the lipid bilayer and then get pumped out
of the cell (vacuum cleaner model; Gottesman and Pastan, 1993). Others speculate that the
drug is taken from the i ~ e r leaflet and shunled into the outer leaflet where it diffises into the
extracellular space (flippase model; Higgins and Gottesman, 1992). Regardless of the
mechanism, it is generally accepted that the direction of flow is from the basal to apical side.
This is supported by evidence indicating the increased presence of P-gp on the apical surface
of the ce11 (Ueda et al., 1997).
3.2 The Organic Cation Transporter (OCT) Family
To date, five members of the OCT farnily have been cloned in humans. These have been
designated OCT I,OCTZ,OCT3, OCTN 1, and OCTN2.
OCTl and OCT2 were the first memben of the organic cation transporter farnily to be
cloned in humans. Both were identified using homology screening of hurnan cDNA libraries
to rat (r)OCT 1 (Gorboulev et al., 1997). Human (h)OCT 1 mRNA was prîmady expressed in
the liver, but exhibited lower expression in kidney, intestine, and heart (Zhang et al., 1997b).
In contrast, hOCT2 was expressed predominantly in the kidney, but not in the liver, lung, or
intestine (Gorboulev et al., 1997). Although the subcellular localization of OCTl and 0CT2
has not been hl ly established in humans, rOCTl and rOCT2 were localized to the BLM
(Urakami et al., 1998, Sugawara-Yokoo et al., 2000).
Recently, Dhillon (1998) demonstrated that hOCTl mRNA expression was present in
human mammary tissue and ce11 lines using reverse transcription-polymerase chain reaction
(RT-PCR). hOCT2 mRNA was not expressed in these samples.
In terms of transport, both rat and human OCTl and 0CT2 were found to mediate the
uptake of prototypical organic cations such as tetraethylarnmonium (TEA) and I-methyl-4-
phenylpyridinium (MPP'; Gorboulev et al., 1997; Grundemann et al., 1994; Urakami et al.,
1998) This transport was inhibited by a number of cationic compounds, supporting the
observation that both of these transporters possess broad substrate specificity (Breidert et al.,
1998; Gorboulev et al., 1997). Uptake of TEA by hOCT1-iransfected HeLa cells was
saturable with an apparent Michaelis constant (Km) of 229 pM (Zhang et al., 1998). In
addition, studies in X laevis oocytes demonstrated that this transport was membrane
potential-dependent (Zhang et al., 1997). Therefore, it was suggested that OCT1 was
localized to the BLM and functioned in the uptake of dmgs into cells. Similarly, OCT2 was
also found to transport TEA in a potential-dependent fashion (Okuda et al., 1999). With a Km
value of 76 f 13 FM, hOCT2 exhibited higher afinity for TEA than hOCTl (Gorboulev et
al., 1997).
As a recent addition to the OCT family, 0CT3 was first cloned from a rat placenta1
cDNA library, with its human ortholog cloned shortly thereafter. High expression of this
transporter was found in the human placenta and kidney (Kekuda et al., 1998; Wu et al.,
2000b). mRNA expression of this transporter was also detected in brain tissue (Wu et al.,
1998a). Although few studies have been perfonned, hOCT3 does mediate the uptake of
organic cations such as TEA (Kekuda et al., 1998; Wu et al., 2000b) This transport was
electrogenic, suggesting that 0CT3 is also localized to the BLM (Kekuda et al., 1998).
Various cationic compounds, including comrnonly prescribed medications such as
desipramine and clonidine. as well as several cationic neuroactive agents such as
amphetamine, were found to inhibit this transport (Wu et al., 1998a; Wu et al., 2000b). When
hOCT3 was transfected into human retinai pigment epithelial (HRPE) cells, saturable MPP'
uptake was seen, with a Km of 47 f 5 PM. This uptake was inhibited by TEA, with an
inhibitory constant (Ki) value of 1372 f 278 pM (Wu et al., 2000b).
The first member of the novel organic cation transporters was cloned fiom human fetal
liver in 1997 (Tamai et al., 1997). Analysis of the cDNA revealed that the 2 135 base pair
nucleotide coded for a 551-amino acid residue protein. This protein was believed to reside
within the membrane and possess 11 putative membrane-spanning domains according to
hydropathy analysis. Four N-glycosylation sites, five protein kinase C phosporylation
domains, a sugar transport protein signature, as well as a nucleotide binding site sequence
were also potentially detected (Tamai et al.. 1997). Compared with other rnembers of the
OCT family, hOCTNl shares 31% and 33% arnino acid similarity to hOCTl and hOCT2,
respectively. This classified hOCRI1 as a member of a distinct division of the organic cation
transporter famil y (Burckhardt and Wolff, 2000).
3.2.2. 1 Tissue distribution
Based on Northern blot analysis, hOCTNl exhibited strong mRNA expression in human
fetal liver, kidney, and lung (Tamai et aL, 1997). lnterestingly though, hOCTNl &A did
not show my expression in adult liver, but exhibitrd strong expression in kidney, trechea, end
bone mmow. Weaker expression was seen in skeletal muscle, prostate, lung, pancreas,
placenta, heart, uterus, spleen, and spinal cord (Tamai et al., 1997). Tamai et al. (1997) also
examined several human cancer ce11 lines and detected hOCTN1 in A459 ( h g carcinoma),
SW480 (colorectal adenocarcinoma), K-562 (myelogenous leukemia), and HeLa ceIl S3.
3.2.2.2 Functioaal Activity
Initial studies on the function of hOCTNl were performed on transfected human
embryonic kidney cells (HEK293) using TEA as a mode1 cationic compound. When cells
were incubated with increasing concentrations of TEA, Km and maximal binding capacity
(V,) values of 0.436 f 0.041 m M and 6.68 f 0.345 n m o h g protein13 min were obtained
by non-linear least-squares analysis (Tarnai et al., 1997). A linear Eadie-Hofstee plot
suggested a single fûnctional binding site for TEA. Further characterization of this transporter
also revealed that depletion of cellular ATP resulted in a 50 to 62% decrease in the amount of
uptake. Since OCTN1 does possess a nucleotide binding motif, Tarnai et al. (1997) suggested
that transport of TEA may partially act through an active process. Lastly, TEA uptake was
found to be pH-dependent, with less uptake observed at acidic pH. Further work by Yabuuchi
et al. (1999) confirmed this observation with their work on hOCTN1 cDNA-injected oocytes.
By examining the efflux of TEA-loaded cells, they found the greatest efflux at acidic pH.
Since uptake of TEA was not membrane potential-dependent, hOCTNl was speculated to
function as a proton-organic cation antiporter (Yabuuchi et al., 1999). Lastly, various cationic
compounds were found to inhibit the uptake of TEA. Uptake of organic cations such as
carnithe, verapamil, and quinidine confirmed the broad substrate specifity of OCTNl
(Yabuuchi et al., 1999).
3.2.3 hOCTN2
A few years after the cloning of OCTNI, OCTN2 was isolated and cloned from a human
placental trophoblast ce11 line (JAR cell) using homology screening (Wu et al., 1998b). The
cDNA for this transporter was 3252 base pairs long and coded for a 557 amino acid residue
protein. OCTN2 was found to be most similar to OCTNI, with 75.8% similarity, but still
shared 33.1% similarity with both hOCTl and hOCT2 (Tamai et al., 1998). This suggested
that OCTN2 was a member of the organic cation transporter family. Through hydropathy
analysis, OCTN2 was believed to possess 12 putative membrane-spanning domains. In
addition, there were three possible N-glycosylation sites and six possible protein kinase C
phosphorylation sites (Tarnai et al., 1998). Wu et al. (1 W8b) also suggested that both the
amino terminus and the carboxy terminus of the hOCTN2 protein resided on the cytoplasmic
side of the membrane based on similar transporters with 12 transmembrane domains. Like
hOCTN1, OCTN2 also possesses a unique sugar transport protein signature (Tamai et al.,
1998; see figure 3).
3.2.3.1 Tissue distribution
Northern blot analysis of several human tissues found that hOCTN2 was present in a
number of fetal and adult organs. Strong expression of hOCTN2 mRNA was found in fetal
kidney, with weak expression in fetal liver, lung, and brain (Tarnai et al., 1998). in adult
tissues, Tamai et al. (1998) found strong expression in kidney, skeletal muscle, placenta,
kart, prostate, and thyroid, and weak expression in liver, lung, brain, small intestine, uterus,
ATPIGTP binding motif ' 5 ,
Figure 3: Putative aodel of hOCTN2 This mode1 is based on hydropathy experiments suggesting 12 putative transmembrane domains (Wu et al. 1998). Potential protein kinase C-dependent phosphory lation sites are represented by stars ( t). Potential sites for N-gly cosy lation are depicted wit h arrowheads (A). Potential sites for protein kinase A-dependent phosphorylation are shown as diamonds (4).
thymus, spinal cord, and other tissues. When various human ceIl lines were analyzed,
hOCTN2 was also expressed in various normal and cancerous ceIl lines. These included
strong expression in placental trophoblast ce11 lines (JAR and BeWo), an intestinal ce11 line
(Caco-2), a cervical carcinoma ce11 line (HeLa S3), a lung carcinoma ce11 line (SW 480): and
a breast cancer ceIl line (MCF-7; Tarnai et al., 1998).
Although OCTN2 was found to be expressed in the plasma membrane of transfected
fibroblast ce11 lines (Lamhonwah and Tein, 1999), exact subcellular localization remains
unknown. Using an anti-peptide antibody to mice OCTN2, Tamai et al. (2001) were able to
localize the protein to the apical membranes of renal epithelial cells in mice. Because of the
close similarities between mice and rat OCTN2, positive signals were also detected in the
apical membranes of rat renal tubular epithelial cells. In both species, no staining was
detected in the basolateral membranes of these cells (Tamai et al., 2001).
3.2.3.2 Functional Activity
Using transfected models and various ce11 lines, the transport function of hOCTN2 has
been investigated by a number of groups (Ohashi et al., 1999; Tamai et al., 1998; Wagner et
al., 2000). Initially, it was found that OCTNZ was capable of transporthg TEA in a pH-
dependent fashion (Wu e t al., 1998b). Uptake seen in these OCTN2-cDNA transfected HeLa
cells was dso inhibited by a number of cationic compounds such as MPP', cimetidine,
procainamide, and nicotine at concentrations of 5 m M (Wu et al., 1998b). While other
researchers saw similar observations, Tarnai's group was the first to show that OCTNZ was a
high affinity, sodium-dependent carnitine transporter (Tamai et al., 1998). Although the
importance of camitine will be addressed in the following section, information on its
transport by OCTN2 will be described here.
Two unique features conceming OCTNZ function have emerged. Firstly, although
carnitine is zwitterionic at physiological pH, it is transported by OCTN2 (Tamai et al., 1998).
Secondly, OCTN2 was found to transport organic cations in a sodium-independent manner,
but carnitine in a sodium-dependent fashion (Ohashi et al., 2001 ; Wu et al., 1999). This was
observed in a number of studies where sodium was replaced by other cations in the transport
buffer. In each case, a significant decrease in the amount of carnitine uptake was seen
(Ohashi et al., 2001 ; Tamai et al., 1998; Wu et al., 1999; Tamai et al., 2001). Further studies
revealed that this dependence on sodium was due to a coupling of carnitine transport with
sodium ions (Tarnai et al., 2001). The proposed mechanism was a CO-transport of one L-
carnitine molecule with one Na'. This was supported by the determinarion of a Hill
coefficient close to unity by various groups (Tamai et al., 2001 ; Wagner et al., 2000). Due to
this coupling of ~ a ' with carnitine transport, OCTN? was therefore considered electrogenic
(Tamai et al., 2001; Wagner et al., 2000). Changes in pH were not found to produce a
significant change in L-camitine uptake, although a slight decrease was seen at acidic pH
(Ohashi et al., 1999).
Uptake of L-carnitine by OCTN2 was saturable, with reported Km values between 2.6 and
4.3 pM (Tamai et al., 1998; Tamai et al., 2001). A V,, value of 2.94 f 0.12 nmoVmg
proteid3 min was also obtained (Tarnai et al., 1998). Linear Eadie-Hofstee plots indicated
that a single funftional site was present for this transporter (Tamai et al., 1998). These results
supported OCTN2's high for L-camitine.
Like the other members of the OCT f k l y , OCTN2 exhibits broad substrate specificity.
Although it has a high affinity for L-carnitine, this protein also transports the stereoisomer,
D-camitine, as well as structurally analogous compounds such as acetyl-D,L-çarnitine and y-
butyrobetaine (Tamai et al., 1998). Studies have also found that TEA and carnitine transport
via OCTNZ is inhibited by a nurnber of pharmacologically relevant compounds such as P-
lactam antibiotics (Ganapathy et al., 2000), cimetidine (Ohashi et al., 1 999; Wu et al., 1 998b;
Wu et al., 1999), verapamil (Ohashi e t al., 1999; Ohashi et al., 2001; Wagner et al., 2000),
emetine (Ohashi et al., 1999; Wagner et al., 2000), quinine (Ohashi et al., 1999), and
desipramine (Wu et al., 1999).
The differential ability of OCTN2 to transport various organic cations has raised some
interesting questions as to its possible mechanism of action. In a study by Seth et al. (1999),
the hypothesis that the carnitine-binding site differed from the organic cation-binding site was
investigated. By using cross-species OCTN2 chimeras, a spatial separation in these two
binding sites was identified. Based on their observations, it was speculated that mutations in
the carnitine-binding site of OCTN2 would not necessarily affect the organic cation-binding
site, and vice versa (Seth et al., 1999).
3.3 Carnitine
Carnitine (P-hydroxy-y-N-trhethylarninobutyrate) is an essential CO-factor in the
catabolism of long-chain fatty acids for energy (Lawrence, 1994; see Appendix A for
structure). It functions by facilitating the transport of these fatty acids from the cytoplasm,
across the imer mitochondrial membrane, and into the mitochondna (Ramsay et al., 200 1).
In adults, approximately 75% of carnitine is obtained through exogenous sources, with the
tissue distribution
liver kidney mammary gland brain
kidney (low) placenta intestine (low) small intestine (low)
spleen (low)
selected -8 that interad with
OCT$ (K, vdue in kM)
556
kidney placenta
liver skeletal muscle
heart (low) lung (low)
1372 (Ki value) N/A
acebutolol(96) desipramine (1 6) cirnetidine (ND) cimetidine (1 66) procainamide (50) clonidine (373) clonidine (0.55) quinine (3.4) desipramine (1 4)
desi prarnine (5.3) midazolam (3.7) nicotine (ND)
procainamide (73.9) quinidine ( 1 7.5) quinine (22.6) verapamil(2.9)
l
procainamide (738)
55 1
kidney tmhea
bone marrow skeletal muscle
small intestine (low) lung (low)
557
kidney skeletal muscle
placenta kart
liver (low) small intestine (low)
cephaloridine (ND) cefepime ( 1 700) ci metidine (ND) cephaloridine (230) nicotine (ND)
procainamide (ND) quinidine (ND) quinine (ND)
verapamil (ND)
choline (ND) cimetidine (ND) clonidine (ND)
desiprarnine (ND) nicotine (ND)
quinidine (ND) verapamil (ND)
Table 3: Summary of cbaracteristics of tbe orgaoic cation transporters NIA indicates that data is currently not available. ND indicates that the compound has been shown to interact with the transporter; however, a Km or Ki value has not yet ken established. " adapted from Dresser et ul., 2001.
remaining 25% k i n g produced endogenously in the iiver and kidney fiom the amino acids
lysine and methionine (Arenas et al., 1998). However, evidence suggests that the carnitine
biosynthesizing ability in neonates is limited since their kidney and liver have not f i l ly
matured (Penn e t al., 1980). Therefore, at birth, the neonate depends on fetal carnitine stores,
their limited endogenous biosynthesis, and exogenous sources. Breast milk provides an ideal
source of exogenous camitine for newborns (Lawrence, 1994). Once infants are capable of
producing their own carnitine, reliance on exogenous sources declines. This was observed in
rats, where carnitine levels in breast milk decreased dramatically around the time that the
pups began developing the ability to synthesize their own carnitine (Robles-Valdes et al.,
1 976).
When children have a carnitine imbalance within their bodies, they may suffer from
something known as primary systemic camitine deficiency (PSCD). This autosomal recessive
disorder is characterized by decreased carnitine levels within the body (Scaglia and Longo,
1999). If left untreated, progressive cardiomyopathy and skeletal myopathy may result
(Breningstall, 1990). Nezu et al. (1999) were the first to discover that this was due to
mutations in the SLC22a.5 gene that codes for OCTN2. Evidence now suggests that OCTN2
funciions in the plasma membrane to transport carnitine fiom the extracellular space into
cells so that it can be used by the mitochondria (Ramsay et al., 2001). Since then, other
groups have discovered various mutations in the OCTNZ gene that have resulted in PSCD
(Lamhonwah and Tein, 1998; Mayatepek et ai., 2000; Vaz et al., 1999). Treatrnent for this
disorder is supplementation with high doses of carnitine (Scaglia and Longo, 1999).
4 Hypothesis
Members of the organic cation transporter (OCT) family, in particular OCTNl and
OCTN2, are expressed in the human marnmary gland, contributing to the transport of cationic
compounds and camitine into breast milk.
5 Rationale
The use of medicines while breastfeeding is a concern for many mothers because of the
possibility that their child may be inadvertently exposed to the drug and its potential adverse
effects. Studies have found that cationic drugs, such as cimetidine, are actively transported
into the breast milk of rats and humans (00 et al., 1995). Unfortunately, the mechanism by
which this transport occun remains unknown.
The possibility that hOCTNl and hOCTN2 plays a role in drug transport during lactation
was investigated for the following reasons:
1. Members of the OCT family have been found to transport cationic drugs such as
cimetidine (Dresser et al., 2001). Therefore, they may play a role in the transport of
other drugs into breast milk.
2. Members of the OCT family have been characterized within the human renal system.
In particular, hOCTNl is believed to play a role in the elimination of drugs in renal
epithelial cells because of its proton antiport mechanism (Yabuuchi et al., 1999). Like
urine, the pH of breast milk is also slightly acidic. Therefore, a possible antiport role
for hOCTN 1 may exist within the rnarnmary gland.
3. Using RT-PCR, Dhillon (1998) detennined that hurnan mammary tissue expressed
hOCTl rnRNA. Although hOCTNl and hOCTN2 expression and function were not
investigated in that study, due tu theic similatities, they are potential candidates that
may help explain the active transport of dmgs into milk.
4. Carnitine is a physiologically important compound found in breast milk since
newborns have a limited ability to synthesize it (Sheman and Peaker, 2000). The
finding that hOCTN2 is a high-afinity camitine transporter raises the possibility that
it may be expressed within the mammary gland to mediate its transport.
6 Objectives
6.1 Molecular Characterization
Using RT-PCR and Northern blotting, mRNA expression of hOCTN 1 and hOCTN2 will
be determined in a human mammary epithelial ce11 line (MCF- 12A), a human myoepithelial
ce11 line (HMEC) and human mammary tissue.
6.2 Functional Characterization
The uptake of [ ' 4 ~ ] ~ ~ ~ and ['HIL-carnitine will be examined using an in vitro
mammary gland mode1 (MCF-12A). The results found using this mammary epithelial ce11
line can then be compared with documented characteristics of transporters identified in other
ce11 lines.
M A T E R I A L S & M E T H O D S
7.1 Materials
~ - ~ - m e t h ~ l - ~ ~ ] c a m i t i n e hydrochoride (80 Cilmrnol) was purchased from American
Radiolabeled Chemicals Inc., (St. Louis, MO, USA). D-[ l met mannitol (5 8.1 mCi/mmol),
[1-14~]tetraethylammonium bromide (2.4 mCiImmol), and D-[l mannit mannitol (26.3
Ci/rnrnol) were purchased from New England Nuclear Life Science Products, Inc. (Boston,
MA, USA). Al1 other chemicals were purchased fiom Sigma-Aldrich Canada (Oakville, ON)
unless otherwise specified.
7.2 Cell culture
The MCF-12A ce11 line (a human mammary gland epithelial cell line) was obtained from
the Amencan Type Culture Collection (Rockville, MD, USA). Cells were maintained in a 1 : 1
mixture of Ham's F12 medium and Dulbecco's modified Eagle's medium supplemented with
5% horse serum, 2 m M glutamine, O S pg/mL hydrocortisone, 20 ng/mL epidermal growth
factor, 10 pg/mL insulin, and 0.1 pg/ml cholera enterotoxin. Cells were kept at 37'C under
95% Oz and 5% CO2 in a humidified incubator. When cells reached 80-90% confluency, they
were subcultured by trypsinization.
The HMEC ce11 line (a human mammary myoepithelial ce11 line) was obtained from
Clonetics (San Diego, CA, USA). Cells were cultured in mammary epitheliurn basal medium
(MEBM) supplemented with 10 @ml human recombinant epidermal growth factor (hEGF),
5 pg/n~l insulin, 0.5 pg/ml hydrocortisone, 50 pg/ml gentamicin, 50 nglml amphotericin-B,
and 0.52 mglm1 bovine pituitary extract (BPE). Cells were maintained at 37OC in an
atmosphere of 95% Or and 5% CO2. Cells were subcultured with 0.025% trypsin/0.01%
EDTA when they reached 80990% confluency.
7.3 Mammary tissue processiag
Discarded mammary gland tissue was obtained fiom women undergoing elective bilateral
breast reduction operations at the Sumybrook and Women's College Hospital (SWCHSC;
Toronto, ON, Canada). Al1 operations were perforrned by plastic surgeon Dr. John L.
Semple. Immediately following surgery, tissue was transported on ice to the Hospital for Sick
Children (HSC; Toronto, ON, Canada) where dissection occurred. Excess adipose tissue was
removed and the parenchyma (the ductal-lobular-alveolar structures) was isolated, snap
fiozen in liquid nitrogen, and stored at -80°C until needed for RNA preparation. Al1
procedures were reviewed and approved by the HSC and SWCHSC Research Ethics Review
Boards.
7.4 Kidney tissue processing
Normal human kidney tissue fiorn a 55 year-old male was obtained from the Cooperative
Human Tissue Network (Southem Division). The sample was immediately stored at -80°C
until needed for RNA preparation.
7.5 Total RNA isolation
Total RNA from al1 tissues and ce11 lines was isolated using the ~Rlzol" Reagent
(GIBCO BRL, Burlington, ON). Al1 procedures were performed as described in the ~RIzo l@
Reagent instruction manual with the following variations: 100-200 mg human tissue was
pulverized in liquid nitrogen using a mortar and pestle, and then homogenized in an
appropriate volume of TRIZOI@ Reagent (1 mL ragent per 100 mg tissw) with a hand-held
rotor-stator homogenizerlPolytron. Al1 other reagents were also scaled up accordingly in
volume. In addition, because marnmary tissue contains a significant proportion of adipose
tissue, an additional centrifugation step was performed following homogenization. These
samples were centrifbged at 12,000 x g for 10 minutes at 4OC in a Sigma 3K30 centrifuge
(Sigma Laboratoiy Centrifuges, Osterode am H m , Germany). The fat layer was subsequently
removed while the cleared homogenate solution was transferred to a fiesh tube and
processed. For MCF-12A cells, 2 mL of TRizolO Reagent was added to cells (90.95%
confluent) grown in a 60x 15 mm tissue culture dish (Becton Dickinson, Franklin Lakes, NJ,
USA). 75% ethanol used in RNA wash was previously chilled on ice to prevent RNA
degradat ion.
Following isolation of the nucleic acid pellet, RNA was dissolved in 25 pl of diethyl
pyrocarbonate (DEPC)-treated water and incubated with 15 U/5O pl DNase I (Phmacia
Biotech, Baie d'Urf, PQ) for 15 min at 37OC to remove of any contaminating genornic DNA.
The enzyme was then inactivated by incubation at 5S°C for 10 min. Al1 samples were stored
at -80°C until needed.
The concentration and purity of the isolated RNA was determined by spectrophotometric
readings using ultraviolet light. Absorbance at 260 nm allows for the calculation of RNA
concentration (1 OD reading = 40 pghL RNA), while the 0D26dOD280 ratio indicates RNA
purity, with a ratio of 1.8-2.0 being high purity. In addition, RNA integrity was determined by
visualization of intact ribosomal 28s and 18s bands following electrophoresis on a 1%
agarose gel (1% agarose (wlv), 1 x TAE (40 mM Tris base, 40 mM acetic acid, 1 m M EDTA,
pH 8.0)) stained with ethidium bromide (0.5 mgImL) under ultraviolet light. Al1 samples used
for reverse transcription were of high purity (ODz&ODzeo ratio between 1.8 and 2.0) and
integrity (agarose gel visualization).
7.6 Reverse transcription (RT)
Reverse transcription is a process whereby template RNA is used to synthesize
complementary DNA (cDNA) via the actions of a reverse transcribing enzyme. RNA samples
were heat denatured for 3 min at 90°C prior to reverse transcription. 1 pg of total RNA was
added to a 20 pl reaction volume containing: 1 x PCR Buffer, 1 m M dNTPs, 7 pM oligo d(T),
1.75 mM MgCI2, 10 mM dithiothreitol (DTT), 5 UIpI RNA Guard (Rnase Inhibitor), 10 Ulpl
Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV-RT), and DEPC-treated
water. A negative control reaction included al1 reagents except the RT enzyme to test for
genomic DNA contamination. Samples were incubated at room temperature for 10 min,
followed by incubation at 42OC for I hour. All cDNA reaction mixtures were stored at -20°C
until needed.
7.7 Polymerase chah reaction (PCR)
7.7.1 Primers
7.7.1.1 hOCTN 1
Primers for hOCTN 1 were determined using Primer3 (www.genome. wi .mit.edu/cgi-
bin/orimed~rimer3 wwwcai), an online primer selection program. After inputting the
complete sequence and adjusting the desired parameters (e.g. annealing temperature (Tm),
regions of the sequence to be included or excluded, primer size), a number of primer choices
were selected and ranked. The primer sequences used for al1 hOCTNl PCR amplification
reactions were :
Forward primer: 5'- CTGGATGCTCCTAATTTACATGG - 3 '
Reverse primer: 5'- AGGAGACTCTCTAGAAATGGTTGG - 3'
Primer specificity was confirmed by comparing the sequence sirnilarity against al1
sequences in Genbank using BLAST. The expected PCR product starts at position 1227 and
ends at position 201 1 on the hOCTN 1 cDNA sequence, resulting in a 785 base pair Fragment.
7.7.1.2 hOCTN2
Primers for hOCTN2 were designed in a similar fashion to those of hOCTN1. Primer
sequences used for a11 hOCNT2 PCR amplification reactions were:
Fornardprimer: 5' - GTGCTGTTGGGCTCCTTCATTTCA - 3'
Reverse primer: 5' - AGCTOCATGAAGAGAAGGACACTG - 3'
Cornparison of these primer sequences with al1 known nucleic acid sequences using a
BLAST query (Genbank) was perfomed to ven@ primer specificity. The expected PCR
fragment starts at position 580 and ends at position 1379 on the hOCTN2 cDNA sequence,
resulting in a product size of 800 base pairs.
Amplification of p-actin was performed using primers published by Giannone et al.
(1998). These primers amplified a region of -450 bp.
7.7.2 PCR reactions
PCR was used to ampli@ the target regions of the hOCTNl (785 bp), hOCRJ2 (800 bp),
and P-actin (450 bp) cDNA. Al1 reactions were performed using a Perkin-Elmer GeneArnp
PCR System 2400 automated thermocycler (Norwalk, CT, USA). In a typical PCR reaction,
three major phases are performed in succession: 1) denaturation, which causes the double-
stranded DNA to dissociate into single strands; 2) annealing, where the primers hybridize to
their specific sites on the template DNA; and 3) extension, whereby new DNA is synthesized
through extension of the primers, by the DNA polymerase enzyme Thermus aquaticus (Taq).
Through repetitions of these three phases (typically 30 to 35 cycles), the target DNA found
between the two primers is exponentially arnplified.
For each cDNA reaction mixture synthesized in the RT stage, a 50 pl PCR reaction was
prepared containing: I x PCR buffer, varying amounts of MgC12 (2.25 mM for hOCTN 1, and
2.5 m M br hOCTN2 and p-actin), 1.0 FM each of forward and reverse primers, varying
amounts of cDNA reaction mixture (20 pl for hOCTNl and hOCTN2, 10 ul for P-actin), and
DEPC-treated water. A negative control reaction, containing no cDNA, was also performed
to test for contamination. For al1 reactions, an initial denaturation was carried out at 95OC for
5 min in order to separate the template strands, with the addition of 0.05 U/pI Taq DNA
polperase to each tube at 4:30 min ("hot start"). This was followed by 30 cycles of
amplification, consisting of denaturation for 30 sec at 95*C, annealing for 30 sec at 56OC and
58OC for hOCTNl and hOCTN2 respectively, and extension at 72OC for 1 min and 55 sec for
hOCTN 1 and hOCTN2 respectively. Amplification of p-actin was performed using either
PCR conditions. A final extension periad was performed for 15 min at 72OC. Al1 samples
were stored at 4OC until needed.
PCR products were resolved by electrophoresis on 1% agarose gels (stained with 0.5
mg/ml ethidium bromide) and visualized under UV light. The size of the arnplified products
was determined by CO-migration of a standard 100 bp ladder (Pharmacia Biotech, Baie
d'Urfe, PQ; MBI Fermentas Inc., Burlington, ON).
7.8 Subcloning of PCR products
In ordcr to produce a large quantity of the PCR-generated fragment for use in restriction
enzyme analyses and DNA sequencing, hOCTNl and hOCTN2 PCR products were
subcloned into E. coli cells.
PCR products were excised from the agarose gel following electrophoresis, and placed in
an Ultrafiee-DA Centrifuga1 Filter Device (Millipore, Bedford, MA, USA). This device
contains a Gel Nebulizer that converts the agarose into a fine slurry that is captured by the
filter. Meanwhile, the isolated DNA is allowed to pass through. Samples were purified
through centrifugation at 5,000 x g for 10 min at 4OC in a Sigma 3K30 centrifuge (Sigma
Laboratoty Centrifuges, Osterode am Harz, Germany).
Purified hOCTNl and hOCTN2 PCR products were then subcloned into the [email protected]
vector in accordance with the instruction manual accompanying the Original TA cloningB
Kit (Invitrogen, San Diego, CA, USA). Briefly, each 10 pl ligation reaction contained: 10- 1 1
ng purified PCR product, 1 pl 10x ligation buffer, 50 ng [email protected] vector, 4.0 Weiss units T4
DNA ligase, and sterile water (if needed, to bring total volume up to 10 pl). Reactions were
incubated overnight at 14OC. One hot@ competent cells were mixed with 2 pl 0.5 M P-
mercaptoethanol and then transformed with 2 pl ligeted vecton by ineubation on ice for 30
min, followed by heat shock at 42OC for 30 sec. Once back on ice, 250 pl SOC medium was
added and cells were allowed to recover in a shaking incubator at 37OC for 1 hour at 225 rpm.
AAer incubation, 50 pl and 200 pl aliquots of the transformed cells were spread ont0
Luria-Bertani (LB) a g a plates (1 .O% bacto-tryptone (wh), 0.5% bacto-yeast extract (wlv),
0.5% NaCl (wh), and 1.5% agar (wlv)) containing 100 @ml ampicillin and 5-bromo-4-
chloro-3-indolyl-P-D-galactoside (X-Gal) solution (400 mg X-Ga1 in 10 ml
dimethylformamide; 40 pl spread on each plate). Plates were incubated at 37OC for 18 hours
and then transferred to 4'C for 2-3 hours to allow for proper colour development. Since
proper insertion of the PCR product into the vector disrupts the lac Z gene, recombinants that
have successfully incorporated the ligated vector (and hence the PCR product) emerge as
white colonies. Recombinants that do not contain the PCR product manifest as blue colonies
since expression of the lac Z gene metabolizes X-Ga1 to form a blue-coloured product.
Therefore, white colonies were placed in LB broth (1% bacto-tryptone (w/v), 0.5% bacto-
yeast extract (w/v), 0.5% NaCl (w/v), and 10 m M glucose) containing 50 pgfml ampicillin
and allowed to grow in a shaking incubator at 37OC for 15-1 8 hn at 225 rpm.
7.9 Isolation of plasmid DNA
Plasmid DNA was extracted fkom the bacterial cells using the ~ 1 ~ ~ r e p @ Miniprep Kit.
Briefly, 2 ml of bacterial culture (grown ovemight) was centrifbged at 13,000 rpm for 2 min
to form a cellular pellet. Cells were resuspended in 250 pl Buffer P l (0.05 M Tris-CI, pH 8.0,
0.01M EDTA, 0.4 mg/ml RNase A) by vortexing, then lysed by addition of 250 pl Buffer P2
(0.2 M NaOH, 1% SDS(w1v)). The mixture was neutralized by adding 350 pl Buffer N3 (3 M
potassium acetate, 115% glacial acetic acid (vlv)). Following centrifugation at 13,000 rpm
for 10 min to separate the pelleted bactenal lysate from the plasmid DNA, the supernatant
was transferred into a QIAprep spin colurnn. Men spun through this column, there is
selective adsorption of the plasmid DNA, while RNA, cellular proteins, and metabolites pass
through. The adsorbed plasmid DNA was then be eluted by addition of 50 pl sterile water.
Samples were stored at -20°C until use.
7.10 Restriction enzyme digests
Subcloned PCR products were mapped via restriction enzyme digests by Pst 1 and Bgl II
for hOCTN1, and Pst 1 for hOCTN2. Digested products were visualized on 1% agarose gels
stained with 0.5 mg/ml ethidium bromide. This procedure was performed for two reasons.
The first was to confirm that hOCTNl and hOCTN2 were indeed amplified in the PCR. The
second reason was to detennine the orientation of the PCR fragment once inserted into the
vector. Through the use of restriction enzyme digests, preliminary results can be obtained to
see whether the correct region on the cDNA was targeted.
7.1 1 Scquencing
In order to confirm whether the PCR fragment was actually amplified from the hOCTNl
and hOCTN2 cDNA, unidirectional sequencing analyses were performed. Sequencing of both
hOCTNl and hOCTN2 PCR products were performed at the DNA Sequencing Facility
(Centre for Applied Genomics, Hospital for Sick Children, Toronto, ON). This was
accomplished by a Pharmacia A.L.F. automatic sequencer using dideoxy sequencing of DNA
with fluorescein-labeled primer. Sequence data were analyzed using BLAST queries.
7.12 Northern Mot asalysis
7.12.1 Probe preparation
Northem blot analysis was performed using the DIG system of non-radioactive nucleic
acid labelling and detection (Roche Molecular Biochemicals, Indianapolis, M, USA). To
ensure that each probe was transporter-specific, the hOCTN 1 and hOCTN2 PCR-amplified
Fragments were used as the transcriptional template to produce the digoxigenin-labelled
riboprobe.
hOCTNl and hOCTN2 PCR products were purified as described above (Material and
Methods, Subcloning). Pior to labelling of the PCR product with digoxigenin, both
fragments were ligated to a T7 promoter adapter using the Lig'nScribeTM RNA polymerase
promoter addition kit (Ambion, Austin, TX, USA). This adapter would allow the T7 RNA
polymerase to transcribe the DNA fragment into RNA. Briefly, 25 ng of purified PCR
product was incubated with 1 pl 10x ligation buffer, 1 pl T7 promoter adapter, 1 pl DNA
ligase, and DEPC-treated water (to bring volume up to 10 pl) at room temperature for 15
min. Following the ligation, PCR was performed as described above to ampli@ the antisense
probe. Each 50 pl reaction contained: 2 pl ligation reaction, 5 pl 1 Ox PCR buffer, 1 pl 10
m M dNTPs, 1.25 pl 10 pM PCR adapter primer (supplied with kit), 1.25 pl 10 p M gene
specific primer (used reverse OCTNl or OCTN2 primer to ampli@ transcription template for
antisense riboprobes), DEPC-treated water (to bring volume up to 50 pl), and 0.5 pl Taq
polymerase. PCR reactions for hOCTNl and hOCTN2 were performed as described above.
Al1 samples were stored at -20°C until needed.
Purified PCR products containhg the T7 promoter adapter were then used as templates to
generate DIG labelled RNA according to the instructions found in the DIG Northern Starter
Kit Instruction Manual (Roche Molecular Biochemicals, Indianapolis, M, USA). Using this
technique, RNA is labelled with digoxigenin-1 1-UTP via an in vitro transcription reaction.
Briefly, each 20 pl reaction via1 contained: 150 ng purified PCR product, 4 pl 5x labelling
mix, 4p1 Sx transcription buffer, 2 pl T7 RNA polymerase, and DEPC-treated water (if
necessary, to bring the total volume to 20 pl). Reactions were incubated at 42OC for 1 hour. 2
pl DNase 1 was used to remove the template DNA by incubation at 37OC for 15 min.
Reaction was terminated by the addition of 2 pl 0.2 M EDTA (pH 8.0). To establish labelling
eficiency, the generated RNA probe was senally diluted and subjected to immunological
detection with anti-digoxigenin-AP and CDP-Star (ready-to-use; please refer to section
7.12.4 for complete method).
7.12.2 RNA gel electrophoresis and transfer to membrane
Total RNA fiom MCF-12A cclls, HMEC, mammary tissue, and kidney tissue were
isolated as described above. Between 10-30 pg were denatured in 20 pl loading buffer (250
pl 100% forniamide, 83 pl 37% formaldehyde, 50 1 IOx MOPS (3-[N-
Morpholino]propanesulfonic acid), 50 pl 100% glycerol, 10 pl 2.5% bromphenol blue, 57 pl
DEPC-treated water) at 6S°C for 10 min. Al1 RNA samples were then loaded onto 1.2%
formaldehyde-agarose gels (1.2% agarose (w/v), 16.7% 37% forrnaldehyde (v/v), 83% 1 x
MOPS (v/v)) and electrophoresed in 1 x MOPS at 80V for -3 hr. Following electrophoresis,
gels were rinsed in 20x SSC (3 M NaCl, 0.3 M sodium citrate, pH 7.0) 2 x 20 min on a
rocking platfom at room temperature. The RNA was then ~ s f e r r e d onto nylon membranes
for -16-20 brs by capillary action in 20x SSC, as desciibed by Sambrook et al. (1989).
Following transfer, membranes were placed on Whatmann 3MM-paper soaked with 10x SSC
and the RNA was imrnobilized by UV crosslinking using a UV ~tratalinker@ Mode1 1800
(Stratagene, La Jolly, CA, USA). Membranes were then rinsed briefly in double distilled
water and allowed to air dry. Eficiency of transfer was determined by removing the portion
of the membrane containing the RNA ladder, and staining it with a methylene blue solution
(0.04% methylene blue (wlv), 0.5 M NaAc).
7.12.3 Hybridization with DIG-labelled riboprobes
To minimize non-specific binding, membranes were prehybridized in plastic
hybridization bags containing 10 mi DIG EasyHyb solution (Roche, Indianapolis, iN, USA)
at 5g°C for 2-3 hrs in a shaking water bath. This was followed by hybridization where
membrane were incubated in 7.5 ml DIG EasyHyb solution containing 150 ng of denatured
hOCTNl or hOCTN2 DIG-labelled antisense riboprobe at 5S°C for 18-20 hrs in a shaking
water bath. Membranes were then washed 2 x 5 min in 2x SSC, 0.1% SDS at room
temperature, followed by two 15 min washes in 0 . 5 ~ SSC, 0.1% SDS at 68OC to remove any
unbound probe.
7.12.4 Immunological detection
Following stringency washes, membranes were rinsed briefly in washing buffer (O. 1 M
maleic acid, 0.15 M NaCl, 0.3% Tween 20 (v/v), pH 7.5). Blocking of the membranes took
place for 30 min, followed by incubation in antibody solution (anti-digoxigenin-AP diluted
1:10,000 in blocking solution) for 30 min. Membranes were then washed 2 x 15 min in
washing buffer, and equilibrated for 5 min in detection buffer (0.1 M Tris-HCl, 0.1 M NaCl,
pH 9.5). Eaçh membrane was then wvered in CDPStar (ready-to-use), exposed to X-ray
film for 10-30 min and developed in a Kodak X-OMAT 2000A processor (Eastman Kodak
Company, USA). The molecular size of each signal was determined by matching the band
against the methylene blue-stained RNA ladder.
7.13 Electron microscopy of MCF-12A cells
MCF-12A cells were grown on Transwell-clear tissue culture inserts (Costar Corp.,
Cambridge, MA, USA) at a starting density of 0 . 5 ~ Io6 cells/filter. Inserts were placed in 6-
well cluster plates and 2 mls of MCF-12A media (as described earlier) were added to the
upper and lower compartments. Plates were maintained under an atmosphere of 95% O2 and
5% CO2 at 37OC. Cells were processed and examined at the Electron Microscopy Laboratory
(Division of Pathology, Hospital for Sick Children, Toronto, ON). A JSM-820 scûnning
electron microscope (JEOL, Japan) was used to obtain scanning electron micrographs. For
transmission electron microscopy, 80 nm thin sections were exarnined in a JEM-1230
transmission electron microscope (JEOL, Japan). Images were recorded with a CCD carnera
integrated into the microscope.
7.14 Functional studies in MCF-12A cells
7.14.1 Plate preparation
MCF-12A cells were cultivated, as described above, in 6-well cluster plates (without
filters) at a starting density of 0 . 5 ~ 106 cells/well. Plates were incubated under an atmosphere
of 95% O2 and 5% COz at 37OC for 48 hours. One hour pnor to the experiment, the MCF-
12A media was removed and replaced with either OCTN 1 uptake buffer (25 mM HEPES,
125 mM NaCl, 4.8 mM KCl, 1.2 m M Ca&, 1.2 mM KH2P04, 1.2 mM MgSOc 5.6 m M
glucose; pH 7.5) for experiments using [ 1 4 ~ ] ~ ~ ~ experiments, or OCTN2 uptake buffer (25
mM Tris/HEPES, 140 mM NaCI, 5.4 rnM KCl, 1.8 mM CaCI2, 0.8 m M MgSOs, 5 mM
glucose; pH 7.5) for ['HIL-cmitine experiments.
7.14.2 Uptake experiments
2 mL of radiolabelled uptake buffer containing either: 1) 65 ph4 [ ' 4 ~ ] ~ ~ ~ and 25 nM
[3~]mannitol, or 2) 1 nM ['HJL-carnitine, 1 pM L-carnitine, and 0.86 pM [14~]mannitol,
were added to each well following the above pre-incubation. Cells were incubated at 37OC for
a designated arnount of time (% hour for [ 1 4 c ] ~ ~ ~ , 1 hour for [ 3 ~ ] ~ - c m i t i n e ) to allow for
uptake of the radiolabelled compounds. At appropriate times, cells were washed twice with 1
mL ice-cold PBS (2.7 mM KCI, 1.5 mM KH2P04, 137 m M NaCI, 8 mM Na2HP04). In order
to determine how much radiolabelled drug was taken up into the cells, 600 pl of 0.01N
NaOH was added to each well and incubated at 3 7 O C for 1 hour to solubilize the cells. 300 pl
aliquots of each sample were placed in scintillation vials containing 2 mL of Ready SafeTM
liquid scintillation cocktail (Beckman Coulter Inc., Mississauga, ON). The associated
radioactivity was measured using a Beckman LSSOOOCE Scintillation Counter (Beckman
Coulter Inc., Mississauga, ON; see figure 4). For Na+-free uptake experiments, NaCl was
replaced isotonically with lithium chloride, potassium chlonde, or choline chloride. AI1
experiments were performed in triplicate.
7.14.3 Carnitine concentration dependence experiments
To determine the effects of varying camitine concentration on the amount of uptake seen,
increasing amounts of [3~]~ ta rn i t ine were added to each well on the day of the experiment.
MCF- 1 2A cells a lncubate cells for set time period
wash Mice with ice-cold PBS, and solubilize cells with
Measure amount of radiolabelled dmg found in tells
Figure 4: Flow chart of a typical uptake expriment using MCF-12A cells.
Non-specific [3~]~-camitine uptake was carried out in a similar fashion except that it was in
the presence of 1000-fold excess unlabelled L-carnitine. Cells were incubated for 1 hour at
37OC to allow for uptake to occur, then washed and solubilized as described above.
7.14.3.1 Mathematical ftîing
Determination of kinetic parameters for TEA and L-carnitine uptake were detennined by
simultaneously fitting the total and non-specific uptake data at various substrate
concentrations to single- and double-system Michaelis-Menten models containing a non-
speci fic uptake component.
The equations used were as follow:
total uptake = z(V,, [Cl 1 Km + [CI) + A [Cl
non-specific uptake = A [Cl ; where C represents the substrate concentration,
V,, represents the maximal binding capacity,
Km is the Michaelis constant,
and A represents a non-specific uptake constant.
Non-linear data fitting was performed using MLAB (Civilized Software, Bethesda, MD,
USA). This program uses the Marquardt-Levenberg least-squares method for curve fitting; a
method that has been found to provide superior fitting efficiency at multi-cornpartment
models with relatively few data points (Ito et al., 1999). Using this method, the curve of best
fit is obtained when the residual surn of squares (RSS) is minimized. When the experimental
data was fit to these equations, several initial estimates of the parameters were used to ensure
that the best possible fit was achieved.
7.14.3.2 Selection of a best-fit mode1
In order to determine which Michaelis-Menten model best fit the experimental data, a
combination of several assessrnent tools were utilized. The first test that was performed on
the fitted data was the runs test (Motulsky and Ransnas, 1987). This test was accomplished
by graphing a residual plot (i.e. the independent variable versus the residual (the distance
from the dependent variable to the fitted curve)) and observing whether or not the residuals
showed a systematic pattem (e.g. were al1 the negative residuals clustered together in one
section of the graph?). If the residuals showed a statistically significant systematic pattem,
then the data was not well described by that model, and the fitted curve was discarded.
Similarly, if data was mathematically fitted to a given model, but the parameten sought did
not converge to meaningful values, then there was adequate reason to discard that model (Ito
et al., 1999).
If a model passed both of these tests, then further statistical analyses were used to
determine which of two or more models provided the best fit for the data. Data fitting using
the least-squares method returns a RSS that indicates the average deviation of the fitted curve
fiom the data. An F-test was used to compare the RSS of the two Michaelis-Menten models
to determine if a significant difference existed (i.e. p < 0.05). If there was a statistically
significant difference, the model with the greater RSS was rejected in favour of the other.
However, when comparing two models with a diflerent number of parameters, care must be
taken since the increased nurnber of parameters provides more flexibility to the curve fitting
method (Ito et al., 1999). In other words, the more complex model tends to fit data closer
than a simpler model, thereby resulting in a lower RSS. Therefore, in combination with the F-
test, the Aikailce's information criterion (AIC) and Schwartz criterion (SC) were aiso used to
select the model of best fit.
AIC = n ln(S) + 2r
SC = n ln(S) + r ln(n) ; where n is the number of data points,
S is the weighted residual sum of squares,
and r is the number of parameten being estimated.
The model with the lowest AIC and SC was considered the simplest model that still
provided a fitting that was statistically as good as more complex models (Ito et al., 1999).
Therefore, in cases where the RSS of two models was not statistically different, the model
with the lower AIC and SC was seiected as the better model.
7.14.4 Inhibition o f uptake experiments
In addition to the radiolabelled dnigs or ['HIL-carnitine), varying arnounts of
organic cation inhibitors (e.g cimetidine, atenolol, carbarnazepine, guanidine) were added to
the uptake buffer to determine their effects on TEA or carnitine uptake. Stock solutions of
each inhibitor were prepared and added to the radiolabelled uptake buffer just before use. The
time allowed for uptake to occur was % hr for TEA experiments, and 1 hr for camitine
experiments. The remaining procedures were performed as described above.
7.15 Data analysis
Data were analyzed using Student t-test or ANOVA, where appropriate. Al1 data were
expressed as mean f standard deviation (SD) unless otherwise stated.
RESULTS
8.1 Molecular characterization
RT-PCR was used to determine the expression of hOCTNl and hOCTN2 in a nurnber of
human marnmary gland derivatives. These included a non-tumorigenic, human marnmary
epithelial ce11 line (MCF-IZA), a human mammary myoepithelial ce11 line (HMEC), and
human mammary tissue donated fiom women undergoing elective bilateral breast reduction
surgery. RT-PCR was cliosen as the initial method of detection since it provided the greatest
level of sensitivity. This was important since our study is the first to examine the expression
of these transporters within the mamrnary gland.
8.1.1 hOCTN1 and hOCTN2 RT-PCR
8.1.1.1 MCF-12A cells
MCF-12A cells were selected to develop and optimize the RT-PCR method. In order to
detect the presence of hOCTNl and hOCTN2 mRNA within these cells, primers were
designed that annealed to specific regions on their respective genes. These primers amplified
a fragment of 785 bp for hOCTN1, and 800 bp for hOCTN2. As seen in figure 5, when
hOCTN1-specific primers were used, a signal in the 785 bp region was detected in this ce11
line. A signal in the region of 800 bp was visible when hOCTN2-specific primers were used
(figure 6). These results suggested that the mRNA transcnpt of both hOCTNl and hOCTN2
were expressed in MCF-IZA cells.
8.1.1.2 Verifcation of PCR products
To v e n e that the products seen were the amplified regions of hOCTNl and hOCTN2,
Figure 5: hOCTNl mRNA expression ln MCF-12A cells RT-PCR was perforrned on a human mammary epithelial ce11 line, MCF- 1 ZA, using primers specific to hOCTNl (lane 1) and P-actin (lane 2). Following electrophoresis on a 1% agarose gel stained with ethidium bromide, a 785 base pair product was detectable with the hOCTNI primers. Amplification with p-actin specific primers resulted in a 450 bp PCR product. Negative control (lane 3) consisted of first-strand synthesis reaction in the absence of M- MLV-RT.
Figure 6: hOCTN2 mRNA expression in MCF-12A celb RT-PCR was perfonned on a hurnan mamrnary epithelial ce11 line, MCF-12A, using primers specific to hOCTN2 (lane 1 ) and p-actin (lane 2). Following electrophoresis on a 1% agarose gel stained with ethidium bromide, an 800 base pair product was detectable with the hOCTN2 pnmea. Amplification with P-actin specific primers resulted in a 450 bp PCR product. Negative control (lane 3) consisted of first-strand synthesis reaction in the absence of M-MLV-RT.
restriction enzyme mapping was performed. This was performed to rule out the possibility
that the bands were due to artefacts of the PCR procedure, or a result of non-specific
mealing of the primers. For hOCTN1, the gel-purified PCR product was subcloned into the
p ~ ~ @ 2 . 1 vector and subjected to digestion by Bgl II and Pst 1 (in two separate reactions). The
hOCTN2 PCR product was similarly subcloned and digested with Pst 1. The anticipated
fragment sizes for each of these digested vectors are depicted in figure 7 and 9. Digested
products were visualized on a 1% agarose gel as seen in figures 8 and 10. The results of this
mapping provided M e r evidence that the amplified sequences belonged to hOCTNl and
hOCTN2. Final verification of both products was accomplished by unidirectional sequencing
of the subcloned fragment. These results established that the PCR amplified fragments were
the hOCTN 1 and hOCTN2 products (results not shown).
In summary, RT-PCR anal ysis revealed that MCF- 12A cells expressed both hOCTN 1 and
hOCTN2 mRNA.
8.1.1.3 HMEC and human mammary tissue
In addition to MCF-12A, HMEC and hurnan mammary tissue were also used to examine
hOCTNl and hOCTN2 mRNA expression. HMEC is an established ce11 line derived from
non-tumorigenic, human mammary myoepithelial cells. Marnmary tissue was obtained from
healthy, non-lactating women undergoing breast reduction surgery. For the latter samples,
analysis was performed on the parenchymal tissue, which was dissected imrnediately
following each surgery. As seen in figure II and 12, both HMEC and mammary tissue
produced a signal in the region of 785 bp and 800 bp, for hOCTN1 and hOCTN2,
Pst 1 Bgl II
A. bOCTN 1 PCR product (785 bp)
Figure 7: Restriction enzyme digest maps of suboloncd bOCTNl PCR product Lines represents specific cut sites for each endonuclease on either the PCR product or the cloning vector. Expefted fragment sizes are listed in brackets.
Figure 8: Restriction enzyme digests of bOCTNl PCR product hOCTNl PCR product was subcloned into the p ~ ~ m 2 . 1 vector and digested with Bgl II and Pst 1 to determine the orientation and verify its identity. Al1 digestion products were resolved on a 1% agarose gel (stained with 0.5 mg/ml ethidium bromide) and visualized under UV light. See figure 6 for restriction enzyme digest maps for this transporter. (* this last band was not have visible due to its small size)
Pst 1
- -
1
A. hOCTN2 PCR product (800 bp)
Figure 9: Restriction e n q m e digest maps of su bcloaed hOCTNl PCR product Lines represents specitic cut sites for each endonuclease on either the PCR product or the cloning vector. Expected fragment s izes are listed in brackets.
I l 5 bp*
Figure 10: Restriction enzyme digests of hOCTN2 PCR product hOCTN2 PCR product was subcloned into the p ~ ~ @ 2 . 1 vector and digested with Pst 1 to detemine irs orientation and ven@ its identity. Al1 digestion products were resolved on a 1% agarose gel (stained with 0.5 mglm1 ethidium bromide) and visualized under UV light. See figure 8 for the hOCTN2 restriction enzyme digest map. (* this last band was not clearly visible due to its small size)
Figure 11: bOCTNl mRNA expression in mammary gland derivatives RT-PCR was perfomed on a human mammary epithelial ceIl line (MCF-12A; lane l), a human myoepithelial ce11 line (HMEC; lane 2), human mammary tissue taken frorn a woman who underwent elective breast reduction operations (lane 3), and human kidney tissue (used as a positive control; lane 4). The 785 base pair product was visualized following electrophoresis on a 1 % agarose gel stained with ethidium bromide.
Figure 12: hOCTN2 mRNA expression in mammry gland derivatives RT-PCR was performed on a hurnan mamrnary epithelial ce11 line (MCF- 12A; lane 1 ), e human myoepithelial ceIl line (HMEC; lane 2), human marnmary tissue taken fiom a woman who undenvent elective breast reduction operations (lane 3), and human kidney tissue (used as a positive control; lane 4). The 800 base pair product was visualized following electrophoresis on a 1% agarose gel stained with ethidium bromide.
respectively. in both cases, healthy. human kidney was used as a positive control tissue.
Although restriction enzyme digests and sequencing were not performed on these PCR
fragments, because they migrated at the same molecular weight as the MCF-12A products, it
was reasonable to assume that these signals represented the amplified regions of hOCTNl
and hOCTN2.
Therefore, similar to MCF- 12A cells, mRNA expression of both hOCTN 1 and hOCTN2
were also present in HMEC and human mammary tissue through RT-PCR analysis.
L1.2 Northern blot analysis of hOCTNl and bOCTN2
Northem blotting is a less sensitive method of detection compared with RT-PCR;
hnwever, it provides a direct mesure of mRNA expression within a sample. This technique
was perfonned as a preliminary step to ensure hOCTNl and hOCTN2 riboprobe specificity.
These probes would then be used for friture Ni situ hybridization studies. The goal was to
detemine the localization of hOCRJl and hOCTN2 mRNA within the marnmary tissue.
For these preliminary Northem blot analyses, approximately 15 to 30 pg of total RNA
fiom MCF-12A and HMEC were fixed to nylon membranes and hybridized with transporter-
specific riboprobes (see figure 13). Using this technique, a band in the 2.1 kB region was
detected in MCF- 12A and HMEC cells using hOCTN 1 specific riboprobes. Following
hybridization with hOCTN2-specific probe, a signal in the 3.2 kB region was detected.
Human kidney was used as a positive control tissue and expressed both the hOCTNl and
hOCTN2 signals. An additional band in the region of 4 kB was also detected in this tissue for
hOCTN2.
Figure 13: Northern blot analysis of hOCTNl and hOCTN2 Total RNA fiom MCF-12A cells (-1 5 pg; lane l), HMEC cells (-30 pg; lane 2), and human kidney tissue (-30 pg; lane 3) was electrophoresed on a 1.2% formaldehyde-agarose gel for -3 hours, transferred ont0 a nylon membrane, and hybridized with a digoxigenin-labelled hOCTNl (A) or hOCTN2 (B) riboprobe. A signal in the region of 2.1 kB was detected in al1 three samples was detected for hOCRI1. For hOCTN2, a signal in the region of 3.2 kB was detected for both MCF-l2A and HMEC RNA. Kidney appeared to possess two bands, one at 3.2 kB, and another at 4 kB. These experiments were used as a preliminary step to venQ probe specificity to hOCTNl and hOCTN2 for future in situ hybridization studies on hurnan mammary tissue.
8.2 Morphology of MCF-12A cells
Electron microscopy was used to investigate the morphological features of MCF-12A
cells. As shown in figure 14, these cells were found to possess numerous finger-like
processes that emerged fiom the ce11 surface when examined with a scanning electron
microscope. A transmission electron micrograph of MCF-12A cells is shown in figure 15.
Once again, processes were visible on the upper surface of the cells. Junctional complexes
could also be seen attaching adjacent cells. Cellular components such as the nucleus,
mitochondria, and endoplasmic reticulum were also visible.
8.3 Functional characterùation
Members of the organic cation transporter family have al1 demonstrated the capacity to
transport a wide assortment of cationic compounds. By studying uptake of these compounds
within an in vitro model, we attempted to capture an integral component of cationic drug
transport in the human mamrnary gland. This method would also allow us to describe the
characteristics of this model, and compare them with published data from transporter-
transfected ce11 lines.
For these experiments, MCF- 12A cells were grown as a monolayer on the bottom of 6-
well cluster plates. ['"CITEA and [3~]~-carnitine were used as tracer compounds to
investigate drug uptake because of their relatively specific afinity to hOCTNl and hOCTN2,
respectively .
Figure 14: Scanning electron micrograph of MCF-12A cells MCF-12A cells were grown as a monolayer on tissue culture inserts until near confluency. Cells were processed and examined using a scanning electron microscope. Microvilli (M) are visible as finger-like processes on the surface of the cells. (Magnification 3000x)
Figure 15: Transmission electron micrograph of MCF-12A oells MCF-12A cells were grown as a monolayer on tissue culture inserts until near confluency. 80 nm sections were cut and exarnined using a transmission electron microscope. Microvilli (M) are visible on the upper surfhce of the cell. Junctional complexes (JC) can aiso be seen between adjacent cells. (Magnification 12,000~)
8.3.1 [ ' ~ J T E A uptake experiments
TEA is a cationic compound commonly used to investigate the function of most members
of the OCT farnily. Experiments were performed to characterize these various transporters
based on published transport characteristics such as pH or N$-dependency.
Previous work in our laboraiory revealed that [ ' 4 ~ ] ~ ~ ~ uptake in MCF-12A cells
progressed linearly up to 1 hour, afier which it reached a plateau. Therefore, in al1 [ ' 4 ~ ] ~ ~ ~
uptake experiments, cells were incubated for 30 minutes unless otherwise stated.
8.3.1.1 p H depeadency
Studies have demonstrated that OCTNl functions in a pH dependent fashien (Ohashi et
al., 2001; Sesaki, 2000). Therefore, using our in vitro MCF-1 2A mammary gland model,
[ ' 4 ~ ] ~ ~ ~ uptake was examined in transport buffers of varying pH (ranging fiom 6 to 9; see
figure 16). A 36% decrease in ["CITEA uptake was observed when pH was reduced from 8
to 6. When pH was increased above 8, the amount of [ ' 4 ~ ] ~ ~ ~ uptake was also decreased
(3 1%).
8.3.1.2 ["CITEA concentration dependency
Previous work by Dhillon (1998) demonstrated that saturable TEA uptake was exhibited
in MCF-12A cells. As part of this thesis, 1 analyzed his data with the intention of detennining
whether this uptake was best descnbed by a one- or two-system Michaelis-Menten model
containing a non-specific component. Analysis was performed by simultaneously fitting the
total and non-specific [ 1 4 ~ ] ~ ~ ~ uptake data using a mathematicai modelling prograrn
(MLAB).
Figure 16: pH dependency of [ ' ~ J T E A uptake in MCF-12A cells MCF-12A cells were seeded ont0 6-well cluster plates and cultured for 72 heurs. This was followed by incubation with 65 p M [ ' 4 ~ ] ~ ~ ~ in transport buffers, varying in pH from 6 to 8, for 1 hour. Cells were then solubilized with 0.01 N NaOH to determine the amount of uptake. Both acidic and basic pHs caused a decrease in the amount of uptake seen.
Analysis of the fitted curve using the runs test failed to show any systematic deviations
fiom the experimental data. In addition, al1 parameters were found to converge to meaningful
values (see table 4). Subsequent testing of the two models using an F-test was therefore
required in order to determine goodness-of-fit. Goodness-of-fit analyses for both the one- and
two-system [ 1 4 ~ ] ~ ~ ~ uptake models are shown in table 5. Analysis of the RSS by an F-test
did not show a significant difference between the two models. When AIC and SC were
calculated, lower values were seen with the two-system model. Uptake of [ 1 4 ~ ] ~ ~ ~ using the
two-system model was found to be saturable (see figure 17).
1 ["CITEA uptake mode1 1 Km 1 ~~~ 1 1 one-system 1 19.40 m M 1 87.15 nmol/mg protein/0.5 hr 1 two-system
Table 4: ["CITEA uptake kinetic parameters in MCF-12A cells Total and non-specific [ 1 4 ~ ] ~ ~ ~ uptake data (Dhillon, 1998) were simultaneously fitted to a one- or two-system Michaelis-Menten equation. Kinetic parameters were obtained using a mathematical modelling progrm (MLAB).
[14C] TEA concentration (mM)
Figure 17: Concentration dependencyof ['%]TEA uptake in MCF-12Acells Total ['%]TEA uptake was measured in the presence of increasing amounts of substrate (0.1 m M to 50 mM; Dhillon, 1998). Total (O) and non-specific (A) ["CITEA data were fitted to a two- system Michaelis-Menten equation containing a non-specific uptake component using a mathematical rnodelling program (MLAB). Curves of best fit were cdculated for total ["CITEA uptake (dashed line), and non-specific ["CITEA uptake (dotted line). Specific TEA uptake (solid line) represents total uptake minus non-specific uptake. Results are expressed as means +/- SEM (n=3).
RSS df
F-test
Table 5: Goodness-of-fit criteria for [ ' ~ J T E A uptake in MCF-12A ceIls Total and non-specific [''CITEA uptake data (Dhillon, 1998) were fitted to a one- or two- system Michaelis-Menton mode1 containing a non-specific uptake component. Goodness-of- fit for each mode1 was tested by comparing the respective RSS using an F-test. Further assessment using AIC and SC were performed if no significant difference was detected. (NS = not significant)
AIC SC
8.3.2 ['HI Lcamitine uptake
L-carnitine is a zwitterionic compound that has demonstrated a high affinity to OCTN2.
The following experiments c haracterize the uptake properties of this compound in MCF- 12A
cells.
one-system
3.4775 6
8.3.2.1 Time course
We investigated the tirne dependency of [3~]~-camitine uptake in MCF-12A cells. As
shown in figure 18, there was a linear increase in the amount of carnitine uptake as time
progressed.
two-systern 0.8239
4
17.22 17.8 1
F = 6.44 ( p = 0.056) NS 8.26 9.24
time (min)
Figure 18: Time course of [J~]~-carnit ine uptake in MCF-12A cells Uptake of 1 FM ['HIL-carnitine uptake was perfonned in the presence (e) and absence (O) of ~ a + ai pH 7.5 and 37OC for 1 hour. Negligible uptake was observed at 4 O C (A). Results are shown as mean k SD (n=3).
Uptake was perfomed at 37OC in the presence of ~a'. When ~ a ' was replaced with Li', a
66.7% decrease was seen in the amount of uptake O, < 0.001). Negligible uptake of L-
camitine was exhibited at 4*C in the presence of ~ a ' , regardless of time.
Based on these results, for al1 future ['HIL-carnitine uptake experiments, MCF- 12A cells
were incubated for 1 hour so that uptake would be o c c h n g within the linear range.
83.2.2 ~ a + dependency
When extracellular sodium was replaced with other ions (i.e. K', ~i ' , and choline), there
was a significant decrease in the arnount of carnitine uptake @ < 0.001; see figure 19).
Replacement with choline resulted in the greatest decrease (93.1%) while potassium and
lithium decreased carnitine uptake by 68.5% and 60.1% respectively.
8.3.2.3 Concentration dependence
To determine the saturability of carnitine uptake, MCF-l2A cells were incubated with
increasing amounts of [ 3 ~ ] L-camitine. Non-speci fic [3~]~-carnitine uptake was
experimentally obtained by the addition of 1000-fold excess unlabelled L-carnitine. Kinetic
parameters were calculated by simultaneously fitting the total and non-specific [)H]L-
camitine uptake data to Michaelis-Menten equations using MLAB.
Residual plots for both the one- and two-system [3~]~-carnitine uptake models are s h o w
in figure 20. Based on this data, a systematic pattern of deviations fiom the curve existed
with the one-system mode1 (Le. clustering of positive residuals at lower substrate
concentrations). A residual plot of the two-system mode1 failed to exhibit a system pattern for
its residuds.
Na+ (control) K+ choline Li+
figure 19: Cation dependence of [3~]~-carnitine uptake in MCF-12A cclls. Uptake of 1 pM t~]~-carnitine was performed in sodiumîontaining or sodium-fkee transport buffers. In the sodium-fkee buffers, sodium chloride was replaced by potassium chloride, lithium chloride, or choline chloride. The uptake was measured at pH 7.5 and 37OC for 1 hour. Results are shown as means f SD ( ~ 3 ) .
log ['H 11-carnitine concentration (mM)
TV 10-3 IO-* mT IO* tol
log ~H]L-carnitine concentration (mM)
Figure 20: Residual plots for [3~]~-carnitine uptake modelling results in MCF-I2A celIs Total and non-specific [3~]~-carnitine uptake were simultaneously fitted to either a one- or two-system Michaelis-Menten equation using MLAB. Residuals (Le. the vertical distance from the data point to the fitted c w e ) for the (A) one- and (B) two-system models were calculated and graphically represented. Systemic patteming (i.e. clustering of positive residuals at the lower substrate concentrations) was seen in the one-system model, but not the two-system model.
['HJL-camitine uptake Linetic parameters for the two-system mode1 are shown in table 6.
Saturable ['HIL-carnitine uptake was observed for this model (see figure 2 1)
two-system
[3H'J~-carnitine uptake model
Table 6: [3~]~-carnitine uptake kinetic parameters in MCF-12A cella Kinetic parameters b r L-carnitine uptake in MCF-I2A cells were mathematically calculated using MLAB.
Km
8.3.2.4 Inhibition of ('~1~-carnitine uptake by various cationic compounds
The effects of increasing concentrations of various cationic compounds on carnitine
uptake in MCF-12A cells is show in figure 22. Of the compounds used, L-carnitine and
veraparnil showed the greatest amount of inhibition with apparent 50% inhibitory
concentrations (ICso) of approximately 20 FM. The apparent ICro for cimetidine was
approximately 1 mM. ICso values for the remaining drugs could not be accurately determined
since higher concentrations of the inhibitors were not investigated. However, the apparent
order of potency was: carbarnazepine > TEA > choline > atenolol. Guanidine did not
significantly inhibit carnitine uptake @ = 0.195).
['HI L-carnitine concentration (mM)
Figure 21: Concentration dependency of ['H1L-carnitine uptake in MCF-12A eells Total ( 0 ) and non-specific ( A ) ['HIL-camitine uptake was measured in the presence of increasing amounts of substrate ( 1 pM to 5 mM). Both sets of &ta were simultaneously fitted to a two-system Michaelis-Menten equation containhg a non-specific uptake component using a mathematical modelling pro- (MLAB). Cumes of best fit were calculated for total [)H]L- camitine uptake (dashed line), and non-specific [%IL-camitine uptake (dotted Iine). Specific TEA uptake (solid line) represents total uptake minus non-specific uptake. Al1 results are expressed at rneans +/- SD (n=3 to n= 10).
al 120 - Y Ca * 100- 4 !! 8 0 - .- CI .-
BO-
8 4 0 - m CI C
@ 20-
8 O -
Figure 22: Inhibition of [ ' ~ ~ c a r n i t i n e uptake by various compounds 1 pM [3~~-camitine uptake was measured in the presence of increasing concentrations of various organic cations at pH 7.5 and 37°C for 1 hour. Inhibiton used included L-camitine (a), veraparnii ( 3. ), cimetidine (m), carbarnazepine ( ), TEA ( A), choline (e), atenolol (r ), and guanidine (* ). Al1 results are shown as means f SD (n=3).
D I S C U S S I O N
The transport of dmgs into breast milk is of clinical concem since transfer of certain
medications in the nursing child can result in adverse effects (sec table 2). Although
nurnerous studies have investigated drug transport within the body, particularly in the kidney
and liver, very little is currently known about the mechanisms of drug transport in the
mammary gland. A better understanding of these processes will enable us to identify ways of
minimizing the transfer of medications into breast milk.
The purpose of this thesis was to further characterize the transport of compounds within
the marnrnary gland, and determine whether this transport could be attributed to two
members of the OCT family, hOCTNl and hOCTN2. In order to accomplish these goals, the
mRNA expression of these two transporters was examined in human marnmary gland ce11
lines and tissue. In addition, functional studies were performed to detennine whether the
transport detected in an in vitro mamrnary gland mode1 could be attributed to these
transporters.
9.1 Molecular Characterization
9.1.1 Expression of hOCTNl and hOCTN2 in the Mammary Gland
Expression of hOCTN l and hOCTN2 mRNA was investigated in three types of human
mamrnary gland derivatives, namely, a human marnrnary epithelial ce11 line (MCF-12A), a
human mammary myoepithelial ce11 line (HMEC), and hurnan mammary tissue.
Initial detection of hOCTNl and hOCTN2 mRNA was performed on MCF-IZA cells.
RT-PCR analysis of this ce11 line revealed that both hOCTN1 and hOCTN2 were expressed
at the mRNA level. Although previous studies have demonstrateci expression of these
transporters in a number of cancerous ce11 lines, including a breast carcinoma cell line (MCF-
7) (Tarnai et al., 1997; Wu et al., 1998b), this study is the first to detect their expression in
normal marnmary tissue. This finding is clinically signi ficant since MCF- 1 2A cells have been
shown to express many conventional mammary epithelial markers such as cytokeratins and
milk-fat globule antigens (Pauley et al., 1993). As a result, these cells likely represent the
portion of the marnmary gland that would be most directly involved in the transport of
compounds into breast milk. Therefore, the finding that hOCTNl and hOCTN2 were
expressed here suggests that these transporters may be involved in drug transport.
hOCTNl and hOCTN2 mRNA were also expressed within HMEC cells. This ce11 line is
derived fiom normal mammary tissue and, unlike MCF-12A, represents cells of a
myoepithelial nature based on positive cytokeratin 14 staining (product sheet, Clonetics).
These results were somewhat surprising since myoepithelial cells would not be expected to
play a signifiant role in mammary gland transport. However, a recent study by Péchoux et
al. (1999) discovered that myoepithelial cells in mature human breast are actually derived
fiom a subset of luminal epithelial cells. Therefore, HMEC may represent a hybnd ce11 line,
possessing both myoepithelial-like and epithelial-like characteristics. Since RT-PCR is an
extremely sensitive method of detection, even a very low arnount of mRNA within these cells
would be amplified and detected (Chelly et al., 1989).
Lastly, human mammary tissue obtained fiom breast reduction surgeries was tested for
hOCTNl and hOCTN2 expression. Although the signal was not as intense as the previous
two ce11 lines, expression of the two transporters was observed. The most probable
explanation for this apparent decrease in expression may be due to tissue processing
following surgery. Although meticulous care was taken to dissect away as much of the fat
and the blood vessels fiom the alveolar-ductular structures as possible, it was likely that
remnants of these contaminating structures remained. However, it is evident from the RT-
PCR analysis that the human mammary gland does express hOCTNl and hOCTN2 at the
mRNA level.
In total, this brings the number of transporters expressed in the human mammary gland to
three: hOCT 1 (Dhillon, 1998), hOCTN 1, and hOCTN2. However, it remains unknown as to
where these transporters are localized within marnrnary tissue. Northem blot analysis was
conducted to verify the transporter specificity of each probe that would be used for future in
situ hybridization studies. Results fiom this experiment showed that each probe hybridized
specifically to its respective transporter transcript. These results were in agreement with those
reported by Wu et al. (1998b). Even the observation that two hybridization signals were
present in total kidney RNA was reproduced when the hOCTN2 probe was used. At present,
the identity of this extra signal remains unknown.
Unfortunately, we were unable to perforrn the in sitlr hybridization experiments due to
time constraints. However, the findings that hOCTNl and hOCTN2 mRNA were present in
al1 sarnpIes tested suggested a possible role for these transporters within the marnrnary gland.
9.2 Morphology of MCF-12A cells
The discovery that hOCRJ 1 and hOCTN2 is expressed at the mRNA level in MCF- 12A
cells mises the possibility that these transporters are fùnctionally active in this ce11 line. As
mentioned eariier, because these cells are epithelial in nature, they likely represent the
secretory portion of the mammary gland. The addition of electron micrographs of these cells
provided M e r morphologicai evidence in support of this. The finger-like processes
observed on the extemal surface most likely represent the microvilli that are present on the
apical surface of mammary epithelial cells. In order to detemine whether the processes seen
were localized solely to the upper surface of these cells, transmission electron microscopy
was performed. Although processes were visible on the upper membrane, minimai extensive
folding of the lower membrane was seen. These observations suggested that the ce11 line
became polarized (i.e. possessed an apical and basal surface) when grown on a solid support.
MCF-12A cells were also confinned to be epithelial in nature based on the presence of
morphological features, such as junctional complexes, that were visible in both SEM and
TEM scans (Ackerly, 2001). As a result, this ce11 line was determined to be a good
representation of mammary epithelial cells found in vivo.
9.3 Functional Characterization
9.3.1 ["CJTEA uptake in MCF-12A cells
TEA is an organic cation that possesses some affinity to al1 memben of the OCT family
(Dresser et al., 2001). Previous studies in our laboratory established that MCF-12A cells
were capable of [''CITEA uptake (Dhillon, 1998). This thesis extends to investigate different
characteristics of this uptake.
Our first finding was that [ 1 4 ~ ] ~ ~ ~ uptake in MCF-12A cells occurred in a pH-
dependent fashion. This was consistent with results from Tamai et al. (1997) who showed
that hOCTN1-transfected HEK293 cells shared similar transport characteristics from pH 6
and 7.5. However, while their uptake reached a plateau from pH 7.5 onwards (to pH 8.5), our
data showed a decrease in uptake between pH 8 and 9. Although this phenornenon was
similar to results seen by Wu et al. (2000s) in fiCTN1-transfected HRPE cells, the reason
for this decrease is unknown. One possibility is fluctuations in the ce11 membrane fluidity at
higher pHs. Because these transporters are al1 membrane bound, this could have resulted in
conformational changes leading to transporter inactivity. However, within the normal
physiological range, the decreased uptake of [ ' 4 ~ ] ~ ~ ~ in MCF-l2A cells suggests that
hOCTN 1 may be present.
As mentioned earlier, Dhillon (1998) demonstmted saturable [ ' 4 ~ ] ~ ~ ~ uptake in MCF-
12A cells. Using this data, we examined whether this uptake was best described by a one- or
two-system Michaelis-Menten equation. Based on the statistical criterion described in the
methods, the results of our fitting suggested that two functionally distinct systems were
responsible for [ ' 4 ~ ] ~ ~ ~ uptake in these cells. The first system had a Km value around 1.6
mM, while the second exhibited much lower affinity for TEA (Km = 73.6 mM). In the
literature, hOCTN1-transfected HEK293 cells were s h o w to have a Km value of 436 pM
(Tamai et al., 1997). Since this affinity is higher than what we found, hOCTNl may not
provide a significant contribution in MCF-12A cells with regards to TEA uptake. However,
given that mRNA expression was detected, other roles for this transporter rnay exist.
9.3.2 [ 3 ~ ~ ~ - ~ a r n i t i n e Uptake in MCF-12A cells
Although hOCTN2 has been s h o w to mediate the transport of TEA, studies have found
that this transporter has a much higher affinity for carnitine (Seth et al., 1999; Tamai et al.,
1998). Since carnitine is an important compound found in breast milk, understanding of its
transport mechanism within the mamrnary gland is of clinical importance.
In MCF-12A ceiis, [ 3 ~ ] ~ - c a r n i t ~ uptake was found to be partially Na+-dependent.
Although uptake increased linearly with time in both the presence and absence of ~ a + , there
was a significant decrease when Na' was replaced with another cation. Of the known
members of the OCT family, hOCTN2 is the only one that is known to transport Lcarnitine
in a ~a'odependent manner (Tamai et al., 1997). Interestingly though, in a similar experiment
performed by Tamai et al. (1997) using hOCTN2-transfected HEK293 cells, two
discrepancies m s e when compared against our results. The first was that camitine uptake
became saturated after only 10 minutes of uptake. The second was that replacement of ~ a +
caused carnitine uptake to diminish almost to the sarne level seen in control cells (Le. plasmid
only-transfected cells). Therefore, [)H]L-carnitine uptake in the marnmary epithelial cells was
found io exhibit similarities to hOCTN2 transport, namely Na+-dependent uptake. However,
because depletion of ~ a + did not result in complete abolishment of [3~]~-carnitine uptake (as
seen with uptake performed at 4*C), a ~a+-independent mechanism may exist.
These last results suggested the possibility that MCF-12A cells mediate [3~]~-camitine
uptake through two functionally distinct systems. Indeed, we found that [ 3 ~ ] ~ s a m i t i n e
uptake was best described by a two-system Michaelis-Menten model. Although we attempted
to fit the data to a one-system model, this model was rejected because al1 of the positive
residuals were found clustered at the lower substrate concentrations, while the negative
residuals were located at the higher ones. Such clustering indicated that the data were not
well described by that equation (Motulsky and Ransnas, 1987). In contrast, the two-system
model provided a better fit to the data since it did not demonstrate these systematic patterns.
Therefore, ['HIL-cmitine uptake in MCF-12A cells was saturable and best described by
a two-system model. Yokogawa et al. (1 999) found a similar high- and low-affinity carnitine
uptake model in cultured human hepatoma HLF ceiis ùi this study, they concluded that the
high-afEnity component was mediated by a transporter with very similar properties to
hOCTN2. Based on findings in this study, it is very likely that the ~a'gde~endent, high-
afEnity ['HIL-camitine uptake component in MCF-12A cells is also mediated by a hOCTN2-
like transporter. The ~a+-dependent uptake, similarities in Km values (5.1 FM vs. 4.3 pM
(Tamai et al., 1998)), as well as the detection of its mRNA transcript within the ce11 line,
M e r supports this conclusion.
9.3.3 Clinical Relevance
The observation that ['HIL-camitine was transported by mammary epithelial cells
suggests a clinical relevance since other drugs may be transported into breast milk by the
same system, namely hOCTN2. Several test compounds were therefore used to determine
whether an inhibitory effect could be seen on carnitine uptake. Verapamil was the only drug
tested that inhibited ['HIL-carnitine uptake at low concentrations. Therefore, this drug may
affect the transport of L-carnitine into breast milk. However, for the other drugs tested, 50%
inhibition of [3~]~-carnitine uptake was not observed until millimolar concentrations were
reached. Since the therapeutic serum concentrations of most dmgs fa11 within the micromolar
range (Goodman and Gilman, 1990), minimal inhibition would likely take place. Therefore,
these results show that these drugs will:
1) not become transferred into the breast milk in sufficient arnounts to increase the
infant's exposure if the drug itself is found to be a substrate of the transporter, and
2) not suficiently inhibit the uptake of matemal carnitine into mamrnary epitheliai cells.
However, even though an insufficient amount of drug may be transported into the breast
milk, other factors (e.g. infant rnetabolism and clearance) can also lead to toxicity in the
infant.
10 Limitations
Throughout the course of this study, several limitations have emerged. The most
significant is the assumption that what is observed in normal, resting mamrnary ce11 lines and
tissue reflects what is happening in the lactating marnmary gland. However, due to obvious
ethical concems, lactating mammary tissue is virtually impossible to obtain. Therefore, the
results obtained in this study must be carefùlly interpreted.
10.1 Limitations: molecular characterization
Ideally, in order to confirm that hOCTNl and hOCTN2 were present in human mammary
gland, protein expression levels should have been examined. However, at the time of our
experimental design, no commercially- or independently-constnicted antibodies were
available. As a result, RT-PCR was selected to detect mRNA levels of these two transporters.
While this method affords a high level of sensitivity, there are two major limitations
associated with this technique. Firstly, detection of mRNA within a ce11 line or tissue does
not necessarily imply that its protein is translated. Secondly, this technique does not
determine specific localization of these transporters within different ce11 types in mammary
gland tissue. A technique that would have allowed us to determine which cells expressed
mRNA levels of these transporters is in situ hybriditation. Unfortunately, time constraints
prevented us fiom completing this portion of the study.
10.2 Limitations: functional characterization
Aside from the limitation that MCF-12A cells do not accurately represent lactating
marnrnary epithelial cells, this ce11 line has been very usefùl in the study of marnmary gland
drug transport. However, evidence from this study suggests that a number of different
transporter systems may be present. As such, these transporters may be functioning in tandem
to transport a single substrate. Should these transporters possess similar fbnctional
characteristics, this would make it very dificult to distinguish between them.
In addition, results obtained using MLAB must also be interpreted with caution. Without
a proper understanding of the selected modeiling equations, the theoretical results generated,
and the limitations of nonlinear regression in general, the analysis of the data may be
inappropriate and the results misleading.
1 1 Future Studies
11.1 Future Studies: molecular characterization
Molecular characterization results to date show promise that hOCTNl and hOCTN2 may
be present within the marnmary gland. However, further studies are necessary. As mentioned
earlier, the detection of genes at the mRNA level does not necessarily imply that the
functional protein is produced. Therefore, future work should involve examining protein
levels of these transporters through the use of Western blot analysis or
immunohistochemistry of mamrnary tissue. The latter procedure could prove more usehl
since localization of the protein would enable us to determine which ce11 types within the
marnmary gland expresses these transporters. Until antibodies become available, completion
of the in situ hybridation could be performed to fulfill this goal.
In order to accurately depict the expression of hOCTNl and hOCTN2 within lactating
mammary gland, a more closely related system needs to be obtained. Sloughed-off epithelial
cells comprise approximately 4% of the cellular component found in breast milk (Lawrence,
1994; Neville, 1991). Characterization of these cells would provide a better understanding of
their expression levels during lactation.
11.2 Future Studies: functionat characterization
Although characterization of [%]TEA and [3~]~-carnitine transport was accomplished
within the MCF-12A cells, additional studies would be beneficial. For instance, the finding
that hOCTNl may not contribute extensively to the uptake of [ ' 4 ~ ] ~ ~ ~ has Ied to the notion
that hOCT3 may be a possible candidate. Studies on this transporter in transfected ce11 lines
have found that uptake of TEA was influenced by changes in pH. In addition, TEA was found
to inhibit MPP' uptake in these cells with a Ki value of 1.4 mM (compared with the Km value
of 1.6 mM obtained in this study; Wu et al., 2000b). Therefore, functional and molecular
characterization of this new transporter may indicate a role for hOCT3 in the mammary
epithelium.
If we assume that the mRNA expressed within these cells was translated to functional
protein, then the major role of hOCTN 1 remains unknown at this tirne. One possibility is that
this transporter may function in the secretion of cationic compounds fiom these cells. Until
now, the focus of our experiments has been on the uptake of compounds into mamrnary
epithelium. Secretocy mechanisms are the next logical avenue for investigation since these
processes will be responsible for the transport of these compounds into breast milk. Tamai et
al. (1997) have suggested that hOCTNl may play a role in the active secretion of cationic
compounds across the rend epithelial bru&-border membrane. Furiher studies in this
direction would deterrnine whether secretion of cationic compounds across marnmary
epithelial cells is mediated by hOCTN 1.
Although this study was the first to show that hOCTN2 was responsible for ~ a + -
dependent, high-afinity uptake of L-camitine, further studies are needed to investigate the
mechanisrns behind the obsewed Na'-independent and low-affinity components. Whether
another member of the OCT family, or other carnitine transporters (e.g. ATB'*+ (Nakanishi et
al., 2001)), are responsible for this uptake will need to be investigated by examining mRNA
or protein expression levels of these candidate proteins and determining their functional
characteristics.
Lastly, fbrther investigations into the inhibitory effects and transport of commonly
prescribed medications are needed if we hope to achieve an understanding of the clinical
significance of the transporters found within the mammary gland.
C O N C L U S I O N S
Currently, very little is known about the mechanisms involved in the transport of drugs
into breast milk. Two members of the OCT family of transporters, hOCTNl and hOCTN2
have been s h o w to mediate the transport of cationic drugs within various organs of the body.
In the current study, we investigated the possibility that these transporters played a role in
drug transport within the human mammary gland.
Through RT-PCR and Northern blot analysis, it was found that both hOCTNl and
hOCRJ2 were expressed at the mRNA level in two different rnammary ce11 lines and
mamrnary gland tissue. Functional analyses using a human mammary epithelial cell line
(MCF-12A) showed that these cells exhibited pti-dependent ["CITEA uptake, as well as
~a+-dependent [3~]~-carnitine uptake. Although the data suggested that the contribution of
hOCTNl to the uptake of TEA into these cells may not be significant, L-carnitine uptake was
found to be mediated by a hOCTN2-like transporter. Lastly, L-camitine uptake was not
significantly inhibited by commonly prescribed cationic medications at therapeutic
concentrations.
This study has provided valuable insight into the existence of transporters within the
mammary gland and their role in dtug transport into breast milk. It is hoped that the
knowledge generated will act as a catalyst for further studies into this clinically important
field.
L I S T OF R E F E R E N C E S
Ackerly,C. 2001. Department of Pathology, Hospital for Sick Children, Toronto, Ontario, Canada. Personal Communication.
American Academy of Pediatrics (1997). Breastfeeding and the use of human milk. Pediatrics 100, 1035-1039.
Ansell,C., Moore,A., and Barrie,H. (1977). Electrolyte pH changes in hurnan milk. Pediatr.Res, 11, 1 177- 1 179.
Aranda,J.V., MacLeod,S.M., Renton,K.W., and Eade N.R. (1974). Hepatic microsomal drug oxidation and electron transport in newbom infants. J-Pediatr. 85,534-542.
Arenas,J., Rubio,J.C., Martin,M.A., and Campos,Y. (1998). Biological roles of L-carnitine in perinatal metabolism. Early Human Development 53 Suppl., S43-SSO.
Atkinson,H.C. and Begg,E.J. (1 988). Prediction of drug concentrations in human skim milk from plasma protein binding and acid-base characteristics. Br.J Clin Pharmacol. 25, 495- 503.
Bailey,B. and Ito,S. (1 997). Breast-feeding and matemal drug use. Pediatric Clinics of North America 4 4 4 1-54,
Bal1 TM and Wright AL (1999). Health care costs of formula-feeding in the first year of life. Pediatrics 103, 870-876.
Banta-Wright,S.A. (1 997). Minimizing infant exposure to and risks fiom medications while breastfeed ing. S. Perinat.Neonat.Nurs. 11, 7 1 -84.
Besunder W, Reed MD, and Blumer JL (1988). Principles of dnig biodisposition in the neonate. A critical evaluation of the phannacokinetic-phamiacodynarnic interface (Part 1). Clin Pharrnacokinet 14, 189-2 16,
BreidertJ., Spitzenberger,F., Grundemann,D., and Schomig,E. (1 998). Catecholamine transport by the organic cation transporter type 1 (OCT 1). Br. J.Pharmacol.l25,2 18-224.
Breningstal1,G.N. (1 990). Carnitine deficiency syndromes. Pediatr.Neuro1. 6,75-8 1 .
Burckhardt,G. and Wolff,N.A. (2000). Structure of renal organic anion and cation transporters. Am.J.Physio1 Renal Physiol 278, F853œF866.
Burgoyne,R.D. and Duncan,J.S. (1998). Secretion of milk proteins. J.Mammary Gland Biol.Neoplasia 3,275-286.
Cass,C.E., Young,J.D., Ba1dwin.S.A.. CabriWA., Gr-., GriffithsN., Jennings,L.L., Mackey,J.R., Ng,A.M., Ritze1,M. W., Vickers,M.F., and Ya0,S.Y. (1 999). Nucleoside transporters of mammalian cells. Pharm.Biotechno1. 12 ,3 1 3-3 52.
Cazeneuve,C., Pons,G., Rey,E., Treluyer,J.M., Cresteil,T., Thiroux,G., D'Athis,P., and Olive,G. (1 994). Biotransfomation of caffeine in human liver microsornes fiom foetuses, neonates, infants and adults. Br.J Clin.Pharmaco1. 3 7,405-4 12.
Charnbers,C.D., Andcrson,P.O., Thornas,R.G., Dick,L.M., Felix,R, J., Johnson,K.A., and Jones,K.L. (1999). Weight gain in infants breastfed by mothers who take fluoxetine. Pediatrics 104, e6 1.
Chelly,J., Concordet,J.P., Kaplan,J.C., and Kahn,A. (1 989). Illegitimate transcription: transcription of any gene in any cell type. Proc.Nat1.Acad.Sci.U.S.A 86,261 7-2621.
Chua,S., Amlkumaran,S., Lim,l., Selamat,N., and Ratnarn,S.S. (1 994). Influence of breastfeeding and nipple stimulation on postpar?um uterine activity. Br.J 0bstet.Gynaecol. 101, 804-805.
Dagan,R. and Pridan,H. (1982). Relationship of breast feeding versus bottle feeding with emergency room visits and hospitalization for infectious diseases. Eur.J.Pediatr. 139, 192- 194.
Dhillon,U. The role of OCTl and OCT2 in the human marnmary gland. 1998. University of Toronto. (Thesis/Dissertation)
Dresser,M., Leabman,M., and Giacornini,K. (200 1). Transporters involved in the elimination of drugs in the kidney: Organic anion transporters and organic cation transporters. J.Pharm.Sci. 90,397-42 1.
Eeg-Olofsson,O., MalmrosJ., Elwin,C.E., and Steen& (1 978). Convulsions in a breast-fed infant after materna1 indomethacin. Lancet 2 ,2 15.
Endrenyi,L. (1998). Drug distribution. In Principles of medical phmacology, H. Kalant and W. H. E. Roschlau, eds. (New York: Oxford University Press), pp. 28-37.
Fleishaker,J.C., Desai,N., and McNamara,P.J. (1987). Factors affecting the milk-to-plasma drug concentration ratio in lactating women: physical interactions with protein and fat. J.Pharm.Sci 76, 189- 193.
Floud,A. and Fahn,S. (1 98 1). L-DOPA (L-3,4-dihydroxyphenylalanine) uptake by hurnan red blood cells. Biochim.Biophys.Acta 645, 1 65- 169.
F0rdJ.M. and Hait,W.N. (1990). Phmacology of drugs that alter rnultidrug resistance in cancer. Pharmaco1.Rev. 42, 155-199.
FordJLP., Taylor,B.J., Mitcheii,E.A., Eiuight,S.A., Stewart,A.W ., Becrof$D.M., Scragg,R., Hassall,I.B., Bany,D.M., Allen,E.M., and . (1993). Breastfeeding and the risk of sudden infant death syndrome. Int.J.Epidemio1. 22, 885-890.
Frank AL, Taber LH, Glezen WP, Kasel GL, Wells CR, and Paredes A (1982). Breast- feeding and respiratory virus infection. Pediatrics 70,239-245.
Ganapathy,M.E., Huang, W ., Rajan,D.P., Carter,A.L., Sugawara,M., Ise ki,K., Leibac h,F.H., and Ganapathy,V. (2000). beta-lactam antibiotics as substrates for OCTN2, an organic cationkamitine transporter. J.Biol.Chem. 2 75, 1699- 1 707.
Gerk,P.M., Kuhn,R.J., McNamara,P.J., and Desai,N. (2001a). Active transport of nitrofurantoin into human milk. Phmacotherapy 2 1,669-675.
Gerk,P.M., O0,C.Y ., Paxton,E. W., Moscow,J.A., and McNamara,P. J. (200 1 b). Interactions between cimetidine, nitrofurantoin, and probenecid active transport into rat milk. J.Phannacol.Exp.Ther. 296, 175-1 80.
GimoneJ.V., Li,W., Probst,M., and Okey,A. (1998). Prolonged depletion of AH receptot without alteration of receptor mRNA levels after treatment of cells in culture with 2,3,7,8- tetrachlorodibenzo-p-dioxin. Biochem.Pharmacol5j, 489-497.
Goodman and Gilman (1990). The Pharmacological Basis of Therapeutics. (Elmsford, New York: Pergamon Press Inc.).
Gorboulev,V., Ulzheimer,J.C., Akhoundova,A., Ulzheimer-Teuber,I., Karback,U., Quester,S., Baumann,C., Lang,F., Busch,A.E., and Koepsell ,H. (1 997). Cloning and characterization of two human polyspecific organic cation transporters. DNA and Ceil Biology 16,887 1-88 1.
Gottesman,M.M. and Pastan,I. (1993). Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu.Rev.Biochem. 62,427.
Groothuis,G.M. and Meijer,D.K. (1 996). Drug traffic in the hcpatobiliary system. J Hepatol. 24 Suppl 1,3028.
Grundemann,D., Gorboulev,V., GambaryqS., Veyhl,M., and Koepsel1,H. (1994). Drug excretion mediated by a new prototype of polyspecific transporter. Nature 3 72,549-552.
Hagg,S. and Spigset,O. (2000). Anticonvulsant use during lactation. Drug Saf 22,425440.
Hibberd CM, Brooke OG, Carter ND, Haug M, and Harzer G (1982). Variation in the composition of breast milk dunng the first 5 weeks of lactation: implications for the feeding of preterm infants. Arch Dis Child 57,658-662.
Higgins,C.F. and Gottesman,M.M. (1992). 1s the multidrug transporter a flippase? Trends Biochem Sci. 17, 18-2 1.
Hill RM, Craig JP, Chaney MD, Tennyson LM, and McCulley LB (1977). Utilization of over-the-counter drugs during pregnancy. Clin Obstet Gynecol20,38 1-394.
Hrycyna,C.A., Zhang,S., Ramachandra,M., Ni,B., Pastan,I., and Gottesman,M.M. (1 996). Functional and molecular characterization of the human multidrug transporter. In Multidrug resistance in cancer cells: Molecular, biochemical, physiological and biological aspects, S. Gupta and T. T s u ~ ~ o , eds. (Chichester: John Wiley & Sons Ltd.), pp. 29-38.
Hunziker W and Kraehenbuhl JP (1998). Epithelial transcytosis of imrnunoglobulins. J.Mammary Gland BioLNeoplasia 3,287-302.
Ito,S. (1 999). Drug secretion systems in renal tubular cells: Functional models and molecular identity. Pediatr.Nephro1. 13,980-988.
Ito,S., Woodland,C., Sarkadi,B., Hockmann,G., Walker,S.E., and Koren,G. (1 999). Modeling of P-glycoprotein-involved epithelial drug transport in MDCK cells. Am.J.Physio1 Rerial Physiol277, F84-F96.
Ito,S. (2000). Drug therapy for breast-feeding women. N.Engl. J Med. 343, 1 18- 126.
Ito,S., Blajchrnan,A., Stephenson,M., Eliopoulos,C., and Koren,G. (1 993). Prospective follow-up of adverse reactions in breast-fed infants exposed to materna1 medication. Am.J Obstet.Gyneco1. 168,1393- 1399.
Juliano RL and Ling V (1976). A surface glycoprotein modulating drug pemeability in Chinese hamster ovary ce11 mutants. Biochim.Biophys.Acta 455, 152-162.
Kari,F. W., Weaver,R., and Neville,M.C. (1 997). Active transport of nitrohirantoin across the mammary epithelium in vivo. J.Pharmacol.Exp.Ther. 280,664-668.
Kartner,N., Evemden-Porelle,D., Bradley,G., and Ling,V. (1985). Detection of P- glycoprotein in multidrug-resistant ce11 lines by monoclonal antibodies. Nature 316, 820- 823.
Kekuda,R., Prasad,P.D., Wu,X., Wang,H., Fei,Y.J., Leibach,F.H., and Ganapathy,V. (1 998). Cloning and functional characterization of a potential-sensitive, polyspecific organic cation transporter (OCT3) most abundantly expressed in placenta. J.Biol.Chem. 273, 1 597 1 - 15979.
Kinura,T. (1969). Electron rnicroscopic study of the mechanism of secretion of milk. I.Jap.Obst.Gynaecol.Soc. 21, 30 1-308.
Koepsel1,H. (1998). Organic cation transporters in intestine, kidney, liver, and brain. Annu.Rev.Physiol60,243-266.
Koletzko S, Sherman P, Corey M, Grifiths A, and Smith C (1989). Role of infant feeding practices in development of Crohn's disease in childhood. Br.Med. J 298, 16 17- 16 18.
Lamhonwah,A.M. and Tein,I. (1998). Carnitine uptake defect: frameshift mutations in the human plasmalemmal carnitine transporter gene. Biochem.Biophys.Res.Commun. 252, 396-40 1.
Larnhonwah,A.M. and Tein,I. (1 999). GFP-Human high-aftinity carnitine transporter OCTN2 protein: subcellular localization and fùnctional restoration of carnitine uptake in mutant ce11 lines with the carnitine transporter defect. Biochem.Biophys.Res.Commun. 264,909-914.
Lawrence,R.A. (1989). Anatomy of the human breast. In Breastfeeding: A guide for the medical profession, S. Bircher, ed. (Si. Louis: The C.V. Mosby Company), pp. 28-47.
Lawrence,R.A. (1994). Biochemistry of human milk. In Breastfeeding: A guide for the medical profession, S. Bircher, ed. (St. Louis, Missouri: The C.V. Mosby Company), pp. 91-148.
Lester,B.M., Cucca,J., Andreozzi,L., Flanagan,P., and Oh,W. (1993). Possible association between fluoxetine hydrochloride and colic in an infant. J Am.Acad.Child Adolesc.Psychiatry 32, 1253- 1255.
Lopez-Alarcon,M., Villalpando,S., and Fajardo,A. (1997). Breast-feeding lowers the fiequency and duration of acute respiratory infection and diarrhea in infants under six months of age. J.Nutr 127,436-443.
Matheson,[. (1 985). Drugs taken by mothers in the puerperium. Br.Med.J 290, 1593-1 596.
Mayatepek,E., Nezu,J., Tamai,I., Oku,A., Katsura,M., Shimane,M., and Tsuj i,A. (2000). Two novel missense mutations of the OCTN2 gene (W283R and V446F) in a patient with primary systemic carnitine deficiency. Hum.Mutat. IS, 1 18.
Mayer,E.J., Harnman,R.F., Gay,E.C., Lezotte,D.C., Savitz,D.A., and Klingensmith,G.J. (1988). Reduced risk of IDDM among breast-fed children. The Colorado lDDM Registry. Diabetes 3 7, 1625- 1632.
McNarnara,P.J., Burgio,D., and Yoo,SD. (1992). Pharmacokinetics of cimetidine during lactation: species differences in cimetidine transport into rat and rabbit milk. J.Pharmacol.Exp.Ther. 261,918-923.
McVea,K.L., Turner,P.D., and Peppler,D.K. (2000). The role of breastfeeding in sudden infant death syndrome. J.Hum. Lact. 16, 1 3-20.
Montgomery,D.L. and Splett,P.L. (1 997). Economic benefit of breast-feeding infants enrolled in WIC. J Am.Diet.Assoc. 97? 379-385.
Morselli,P.L. (1989). Clinical pharmacology of the perinatal period and early infancy. Clinical Pharmacokinetics 17 (Szrppl. f), 13-28.
Morselli,P.L., Franco-Morselli,R,, and BossiL. (1980). Ciinical pharmacokinetics in newboms and infants. Age-related differences and therapeutic implications. Clin Pharrnacokinet 5,485-527.
Motulsky,H.J. and Ransnas,L.A. (1987). Fitting curves to data using nonlinear regression: a practical and nomathematical review. FASEB J. 1, 365-374.
Nakanishi ,T., Hatanaka,T., Huang, W ., Prasad,P. D., Lei bach,F.H., Ganapathy,M .E ., and Ganapathy,V. (200 1). Na+- and CI-coupled active transport of carnitine by the amino acid transporter ATBOY+ from mouse colon expressed in HRPE cells and Xenopus oocytes. J.Physiology 532,297-304.
Neville,M.C. (1983). Regulation of mammary development and lactation. In Lactation: Physiology, nutrition, and breast-feeding, M. C. Neville and M. R. Niefert, eds. (New York, NY: Plenum Press), pp. 103- MO.
Neville,M.C. (1991). Secretion and composition of human milk. In Neonatal Nutrition and Metabolism, W. W. Hay Ir., ed. (St. Louis, MO: Mosby-Year Book, Inc.), pp. 260-279.
Neville,M.C. (2001). Anatomy and physiology of lactation. Pediatric Clinics of North America 48, 13-3 1.
Neville,M.C., Allen,J.C., and Watters,C. (1983). The mechanisms of milk secretion. In Lactation: Physiology, nutrition, and breast-feeding, M. C. Neville and M. R. Niefert, eds. (New York: Plenum Press), pp. 49-1 02.
Neville,M.C., MortonJ., and Umemura,S. (2001). Lactogenesis: The transition from pregnancy to lactation. Pediatric Clinics of North America 48,35-52.
NezuJ,, TarnaiJ., Oku,A., Ohashi,R., Yabuuchi,H., Hashimoto,N., Nikaido,H., Sai,Y., Koizumi,A., Shoj i,Y., Takada,G., Matsuishi,T., Yoshino,M., Kato,H., Ohura,T., Tsujimoto,G., Hayakawa,J., Shimane,M., and Tsuji,A. ( 1999). Primary systemic carnitine deficiency is caused by mutations in a gene encoding sodium ion-dependent carnitine transporter. Nature genetics 2 l , 9 1 -94.
Nguyen,D.A. and Neville,M.C. (1998). Tight junction regulation in the mammary gland. J.Mammary Gland Biol.Neoplasia 3,233-246.
OtBrien,J.P. and Cordon-Cardo,C. (1996). P-glycoprotein expression in normal human tissues. In Multidrug resistance in cancer cells: molecular, biochemical, physiological and biological aspects, S. Gupta and T. Tsunio, eds. (West Sussex: John Wiley & Sons Ltd.), pp. 285-291.
Ohashi,R., Tamai,I., Nezu,J.J., Nikaido,H., Hashimoto,N., Oku,A., Sai,Y ., S himane,M., and Tsuji,A. (2001). Molecular and physiological evidence for multifunctionality of cmitine/organic cation transporter OCTNZ. Mol.Phmacol. 59,3 58-366.
OhashiJL, TamaiJ., Yabuuchi,H., NePJJ., Oku,A., Sai,Y, Shimane,M., and Tsuji,A. (1999). Na(+)-dependent carnitine transport by organic cation transporter (OCTN2): its pharmacological and toxicological relevance. J.Pharmacol.Exp.Ther. 291, 778-784.
Okuda,M., Urakami,Y., Saito,H., and Inui,K. (1999). Molecular mechanisms of organic cation transport in OCT2-expressing Xenopus oocytes. Biochim.Biophys.Acta 111 7, 224- 231.
Ollivier-Bousquet M (1998). Transferrin and prolactin transcytosis in the lactating mammary epithelial cell. J.Mammary Gland BioLNeoplasia 3,303-3 13.
Oo,C.Y., Kuhn,R.J., Desai,N., and McNamara,P.J. (1995). Active transport of cimetidine into human milk. Clin.Pharmacol.Ther 58,548-555.
Passmore,C.M., McElnay,J.C., and DIArcy,P.F. (1984). Dmgs taken by mothers in the puerperium: Inpatient survey in Northem Ireland. Br.Med.J 289, 1 593- 1 596.
Pauley,R. J., Paine,T. J., and Soule,H.D. Immortal human marnmary epithelial ceIl sublines. 7275 18[S,îO6,16S], 1 - 1 O. 1993. (Patent)
Pechoux,C., Gudjonsson,T., Romov-Jessen,L., Bi~sel1,M.J.~ and Petersen,O. W. (1 999). Hurnan marnmary luminal epithelial cells contain progenitors to myoepithelial cells. Dev.Bio1. 206, 88-99.
Penn,D., Schmidt-Sornrnerfeld,E., and Wolf,H. (1980). Carnitine deficiency in premature infants receiving total parenteral nutrition. Early Hum.Dev. 1,23034.
Picciano,M.F. (2001). Nutrient composition of human milk. Pediatric Clinics of North America 48, 5 3-67.
Pisacane,A., Graziano,L., Mazza.rella,G., Scarpe1 lino,B., and Zona,G. (1 992). Breast- feeding and urinary tract infection. J.Pediatr. 120, 87-89.
RarnsayJtR., Gandour,R.D., and van der Leij,F.R. (2001). Molecular enzymology of camitine transfer and transport. Biochim.Biophys.Acta 1546,2 1-43.
Risch,H.A., Weiss,N.S., Lyon,J.L., Daling,J.R., and Liff,J.M. (1 983). Events of reproductive life and the incidence of epithelial ovarian cancer. Am.J Epidemiol. 11 7, 128-1 39.
Robles-Valdes,C., McGarry,J.D., and Foster,D.W. (1976). Matemal-fetal carnitine relationship and neonatal ketosis in the rat. J.Biol.Chem. 251, 6007-60 12.
Rosenblatt,K.A. and Thomas,D.B. (1993). Lactation and the risk of epithelial ovarian cancer. The WHO Collaborative Study of Neoplasia and Steroid Contraceptives. 1nt.J Epidemiol. 22, 192-197.
SambrookJ., Fritsch,.E.F, and Manniati~~T. (1989). Molecular cloniag: a laboratory manual. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory).
Sarnuelsson,U., Johansson,C., and LudvigssonJ. (1 993). Breast-feeding seems to play a marginal role in the prevention of insulin-dependent diabetes rnellitus. Diabetes Res.Clin.Pract. 19,203-2 10.
Scaglia,F. and Longo,N. (1999). Primary and secondary alterations of neonatal carnitine metabolism. Semin.Perinatol.23, 152- 16 1.
Schimmel,M.S., Eidelman,A.I., Wilschanski,M.A., Shaw,D., Jr., Ogilvie,R.J., Koren,G., Schmimmel,M.S., and Eide1ma11,A.J. (1989). Toxic effects of atenolol consumed during breast feeding. J Pediatr. 114,476478.
Seeman,P. and Kalant,H. (1998). Drug solubility, absorption, and movement across body membranes. In General pnnciples of phmacology, H. Kalant and W. H. E. Roschlau, eds. (New York: Oxford University Press), pp. 1 1-27.
Sesaki,S. (2000). Molecular basis of organic anion and cation transport. Kidney Int. 57, 1772- 1773,
Seth,P., Wii,X., Huang,W., Leibach,F.H., and Ganapathy,V. (1999). Mutations in novel organic cation transporter (OCTN2), an organic catiodcarnitine transporter, with differential effects on the organic cation transport function and the carnitine transport fiinction. J.Biol.Chem. 274,33388-33392.
Shennan,D.B. (1998). Marnrnary gland membrane transport systems. J.Mammary Gland Biol.Neoplasia 3,247-258.
Shennan,D.B. and Peaker,M. (2000). Transport of milk constituents by the mammary gland. Physiological Reviews 80,925-95 1.
Sherwood,L. (1993a). Human physiology: from cells to systems. (St. Paul, MN: West Publishing Company).
Shenvood,L. (1 993 b). Reproductive system. In Hurnan physiology: from cells to systems, P. Lewis, ed. (St. Paul, MN: West Publishing Company), pp. 695-745.
Taddio,A. and Ito,S. (1994). Drug use during lactation. In Matemal-fetal toxicology, G. Koren, ed. (New York: Marcel Dekker, Inc.), pp. 133-2 19.
Tamai,[., China&., Sai,Y ., Kobayashi,D., Nezu,J., Kawahara,E., and Tsuji,A. (200 1). Na+- coupled m s p o n of L-carnitine via high-aflïnity carnitine transporter OCTNZ and its subcellular localization in kidney. Biochim.Biophys.Acta 1512,273-284.
Tamai.1.. Ohashi&., Nezu.J.. YabuuchiJi.. Oku,A., Shimane,M., Sai,Y ., and Tsuji,A. (1 998). Molecular and fùnctional identification of sodium ion-dependent, high affinity human carnitine transporter OCTN2. J.Biol.Chem. 273,20378-20382.
Tamai,I., Yabuuchi,H., Nem,J., Sai,Y., Oku,A., Shimane,M., and Tsuji,A. (1 997). Cloning and characterization of a novel human pH-dependent organic cation transporter, OCTNI. FEBS Lett. 419, 107- 1 1 1.
Thiebaut,F., Tsumo,T., Hamada,H., Gottesman,M.M., Pastan,I., and Willingham,M.C. (1 987). Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc.Natl. Acad.Sci .US, A 84, 7735-7738,
Tyson,R.M., Shrader,E.A., and Perlman,H.H. (1 938). Dmgs transmitted through breast milk. II Barbiturates. J-Pediatr. 14,90.
Ueda&., Taguchi,Y., and Morishima,M. (1997). How does P-glycoprotein recognize its substrates? Semin.Cancer Biol. 8, 1 5 1 - 1 59.
Urakami,Y., Okuda,M., Masuda,$., Saito,H., and Inui,K.I. (1998). Functional characteristics and membrane localization of rat multispecific organic cation transporters, OCTl and OCT2, mediating tubuiar secretion of cationic drugs. J Pharmacol.Exp.Ther. 287, 800-805.
Vaz,F.M., Scholte,H.R., Ruiter,J., Hussaarts-Odij k,L.M., Pereira,R.R., Schweitzer,S., de Klerk,J.B., Waterham,H.R., and Wanders,R. J. (1 999). Identification of two novel mutations in OCR12 of three patients with systemic camitine defciency. HumGenet. 1 O'i, 1 57- 16 1.
Vorherr,H. (1 974). Drug excretion in breast milk. Postgrad.Med. 56, 97- 104.
Wagner,C.A., Lukewille,U., Kaltenbach,S., MoschenJ., Broer,A., Risler,T., Broer,S., and Lang,F. (2000). Functional and pharmacological characterization of human Na(+)- carnitine cotransporter hOCTN2. Am.J.Physio1 Renal Physiol2 79, F584-F59 1.
Wendrinska A, Addey CV, Orange PR, Boddy LM, Hendry KA, and Wilde CJ (1993). Effect of a milk fat globule membrane fraction on cultured mouse rnammary cells. Biochem Soc Trans 21,220s.
Wiles,D.H., Orr,M.W., and KoIakowska,T. (1978). Chlorpromazine levels in plasma and milk of nursing mothers. J3r.J Clin Pharmacol. 5,272-273.
Wilson,J.T. (1981). Pharmacokinetics of drug excretion. In Dmgs in breast milk, J. T. Wilson, ed. (Balgowlah, Australia: ADIS Press Australasia Pty Ltd.), pp. 15-33.
Winikoff,B. (1982). Breast-feeding and prevention of necrotizing enterocolitis. Am.J.Obstet. Gynecol. 112,932.
Wu,X., George,R.L., Huang,W., Wang,H., Conway,S.J., Leibach,F.H., and Ganapathy,V. (2000a). Structural and functional characteristics and tissue distribution pattern of rat
OCTNI, an organic cation transporter, cloned fiom placenta. Biochim.Biophys.Acta 1466, 3 15-327,
Wu,X., Huang, W., Ganapathy,M.E., Wang,H., Kekuda,R., Conway,S. J., Leibach,F.H., and GanapathyJ. (2000b). Structure, function, and regional distribution of the organic cation transporter 0CT3 in the kidney. Am.J.Physiol Renal Physiol 279, F449œF458.
Wu,X., Huang,W., Prasad,P.D., Seth,P., Rajan,D.P., Leibach,F.H., Chen,J., Conway,S.J., and Ganapathy,V. (1999). Functional characteristics and tissue distribution pattern of organic cation transporter 2 (OCTNZ), an organic catiodcarnitine transporter. J.Pharmaco1.Exp.Ther. 290, 1 482- 1 W.
Wu,X., Kekuda,R., Huang,W., Fei,Y.J., Leibach,F.H., ChenJ., Conway,S.J., and Ganapathy,V. (1 998a). Identity of the organic cation transporter 0CT3 as the extraneuronal monoamine transporter (uptake2) and evidence for the expression of the transporter in the brain. J BioLChem. 273,32776932786,
Wu,X., Prasad,P.D.. Leibach,F.H., and Ganapathy,V. (1998b). cDNA sequence, transport function, and genomic organization of human OCTN2, a new member of the organic cation transporter family. Biochem.Biophys.Res.Commun. 246,589495.
Yabuuchi,H., Tamai,I., NezuJ., Sakarnoto,K., Oku,A., Shimane,M., Sai,Y ., and Tsuj i,A. ( 1 999). Novel membrane transporter OCTN 1 mediates mu1 tispeci fic, bidirectional, and pH- dependent transport of organic cations. J.Pharmacol.Exp.Ther. 289,768-773.
Yokogawa,K., Miya,K., Tamai,I., Higashi,Y., Nomura,M., Miyamoto,K., and Tsuji,A. (1999). Characteristics of L-camitine transport in cultured human hepatoina HLF cells. J.Phm.Pharmacol. 51 ,935-940.
Zhang,L., Dresser,M.J., Gray,A.T., Yost,S.C., Terashita,S., and Giacomini,K.M. (1 997). Cloning and fùnctional expression of a human liver organic cation transporter. Mol.Phannacol.51,913-921.
Zhang,L., Schaner,M.E., and Giacomini,K.M. (1998). Functional characterization of an organic cation transporter (hOCTI) in a tmsiently tmnsfected human ce11 line (HeLa). J.Pharmacol.Exp.Ther. 286,354-36 1.
A P P E N D I X A
Structures of compounds used in the functional characterization of MCF-12A cells. Selected organic cations used in the inhibition of [ 3 ~ ] ~ - c m i t i n e uptake are also shown.
TEA
Car ba rnaze pine
Choline
C h HO, H O 1, s I I CH3-N-CH, -C-CH, -C-O- I
Atenolol
Cimetidine
Verapami 1 Guanidine