Lactobacillus acidophilus NS1 attenuates diet-induced

https://doi.org/10.1530/JOE-17-0592http://joe.endocrinology-journals.org © 2018 Society for Endocrinology

Printed in Great BritainPublished by Bioscientifica Ltd.

Journal of Endocrinology

237:2 87–100S-S Park et al. LNS1 attenuates obesity and fatty liver

10.1530/JOE-17-0592

RESEARCH

Lactobacillus acidophilus NS1 attenuates diet-induced obesity and fatty liver

Sung-Soo Park1, Yeon-Joo Lee1, Sooyeon Song2, Boyong Kim3, Hyuno Kang3, Sejong Oh2 and Eungseok Kim1

1Department of Biological Sciences, College of Natural Sciences, Chonnam National University, Gwangju, South Korea2Division of Animal Science, College of Agriculture & Life Science, Chonnam National University, Gwangju, South Korea3Gwangju Center, Korea Basic Science Institute, Gwangju, South Korea

Correspondence should be addressed to S Oh or E Kim: [email protected] or [email protected]

Abstract

Obesity is a major threat to public health, and it is strongly associated with insulin

resistance and fatty liver disease. Here, we demonstrated that administration of

Lactobacillus acidophilus NS1 (LNS1) significantly reduced obesity and hepatic lipid

accumulation, with a concomitant improvement in insulin sensitivity, in high-fat diet

(HFD)-fed mice. Furthermore, administration of LNS1 inhibited the effect of HFD feeding

on the SREBP-1c and PPARα signaling pathways and reduced lipogenesis with an increase

in fatty acid oxidation in ex vivo livers from HFD-fed mice. These LNS1 effects were

confirmed in HepG2 cells and ex vivo livers by treatment with LNS1 culture supernatant

(LNS1-CS). Interestingly, AMPK phosphorylation and activity in the liver of HFD-fed

mice were increased by administration of LNS1. Consistently, chemical inhibition of

AMPK with compound C, a specific inhibitor of AMPK, dramatically reduced the effect

of LNS1-CS on lipid metabolism in HepG2 cells and ex vivo livers by modulating the

SREBP-1c and PPARα signaling pathways. Furthermore, administration of LNS1 to

HFD-fed mice significantly improved insulin resistance and increased Akt

phosphorylation in the liver, white adipose tissue and skeletal muscle. Together,

these data suggest that LNS1 may prevent diet-induced obesity and related

metabolic disorders by improving lipid metabolism and insulin sensitivity through an

AMPK→SREBP-1c/PPARα signaling pathway.

Introduction

Excessive fat accumulation in key metabolic tissues, including the liver and adipose tissue, is closely associated with metabolic disorders such as obesity, insulin resistance, diabetes, nonalcoholic hepatic steatosis, hyperlipidemia and cardiovascular disease (Youssef & McCullough 2002, Matsuzawa 2008).

Probiotics are live microorganisms that contribute to improvement of host health by modulating metabolism and immune response (Mengheri 2008, Caesar et al. 2010, Khan et al. 2012, Yoo et al. 2013, Heo et al. 2016).

Recent studies have reported that probiotic bacteria reduce high-fat diet (HFD)-induced adiposity (Naito et al. 2011, Heo et al. 2016). In other studies, probiotics have also improved insulin resistance and hepatic steatosis in mice fed a HFD (Li et al. 2003, Ma et al. 2008, Naito et al. 2011, Shen et al. 2013, Caricilli & Saad 2014). However, the mechanisms underlying these beneficial effects are largely unexplored.

The liver plays a key role in whole-body energy homeostasis by regulating lipogenesis and fatty acid oxidation (Reddy & Rao 2006). A large body of evidence

2

Key Words

f LNS1

f fatty liver

f diet-induced obesity

f SREBP-1c

f PPARα

f AMPK

Journal of Endocrinology (2018) 237, 87–100

237

Downloaded from Bioscientifica.com at 02/09/2022 01:09:39PMvia free access

https://doi.org/10.1530/JOE-17-0592

mailto:[email protected]

mailto:[email protected]


Published by Bioscientifica Ltd.Printed in Great Britain

88LNS1 attenuates obesity and fatty liver

S-S Park et al. 237:2Journal of Endocrinology

has shown that two transcription factors, sterol regulatory element-binding protein 1c (SREBP-1c) and peroxisome proliferator-activated receptor α (PPARα), are important for the transcriptional regulation of these hepatic functions (Kersten et al. 2000, Horton et al. 2002).

SREBP-1c is initially synthesized as an inactive precursor that binds to the endoplasmic reticulum membrane. Subsequently, SREBP-1c is transported to the Golgi apparatus and released after sequential proteolytic processing. The cleaved, mature SREBP-1c protein is translocated to the nucleus and is largely responsible for lipogenesis owing to its transcriptional regulation of genes involved in fatty acid synthesis in the liver. Pharmacological inhibition of SREBP-1c processing into its active nuclear form ameliorates diet-induced obesity (Horton et al. 2002).

In contrast, fatty acid oxidation is primarily regulated by PPARα, a ligand-dependent transcription factor, is highly expressed in the liver. PPARα promotes fatty acid oxidation in the liver by increasing the expression of the involved genes, such as those encoding acyl-coenzyme A oxidase (ACOX) and carnitine palmitoyltransferase 1 (CPT1) (Murakami et al. 1998). Moreover, fenofibrate, a PPARα ligand, reduces plasma triglycerides levels and adiposity by stimulating hepatic fatty acid oxidation (Minnich et al. 2001).

Recent studies have shown that the hepatic functions of SREBP-1c and PPARα could be modulated by AMPK, an energy sensor that is activated by a high AMP:ATP ratio and maintains cellular energy homeostasis in part by regulating these transcription factors (Janovska et al. 2008). Furthermore, many studies showed that diet-induced obesity reduces AMPK activity (O’Neill et al. 2013, Xu et al. 2014).

Recently, we reported that administration of Lactobacillus acidophilus NS1 (LNS1) lowers the cholesterol levels in mice fed a high-fat diet (HFD) and concomitantly inhibits HFD-induced body weight gain without affecting food intake (Song et al. 2015). This prompted us to further investigate the possible protective function of this strain against diet-induced obesity and hepatic steatosis. Herein, we found that LNS1 administration led to a decrease in lipogenesis and increase in fatty acid oxidation through SREBP-1c signaling inhibition and PPARα signaling activation, respectively, resulting in protection against HFD-induced obesity and fat accumulation in the liver, with improvement in insulin sensitivity. Furthermore, AMPK was shown to play a key role in LNS1-mediated regulation of PPARα and SREBP-1c signaling pathways in HFD-fed mice.

Materials and methods

Animals

All animal experiments were approved by the Institutional Animal Care and Use Committee of Chonnam National University. Male C57BL/6 mice (7 weeks old; weight, 19 ± 2 g) were fed a normal diet (ND; 16% of total calories from fat; Damul Science, Daejeon, Korea) or a high-fat diet (HFD; 45% of total calories from fat; Research Diets Inc., New Brunswick, NJ, USA). Lactobacillus acidophilus NS1 (LNS1) was provided by Nong Shim (Seoul, Korea). LNS1 cells were cultured to a turbidity of 0.6 at 600 nm in MRS broth and harvested by centrifugation at 5000 g for 15 min. LNS1 cells were resuspended in PBS at ~1.0 × 108 cfu/mL, and 300 μL of the LNS1 resuspension or vehicle (PBS) was orally administered to the mice daily for 12 weeks. The cell-free supernatant was used as the LNS1 culture supernatant (LNS1-CS). Before examining the role of LNS1 in lipid metabolism in mice, we previously analyzed the viable cells of intestinal bacteria in mice by analyzing 16S rDNA sequence using colon from mice after 8-week oral administration of LNS1 (ca 108 cfu/mL) or PBS. Briefly, homogenized colon samples were serially diluted in anaerobic diluent (4.5 g KH2PO4, 6.0 g Na2HPO4, 0.5 g l-cysteine and 0.5 g Tween 80/L H2O) and aliquots of the dilution were spread onto standard count agar and modified MRS selective agar (pH 5.0, 20 μg/mL vancomycin). Standard plate count agar plates were incubated under aerobic conditions and modified MRS selective agar plates were placed in an anaerobic chamber (Concept 400, Ruskinn Technology, Leeds, UK) at 37°C for 48 h. Viable LNS1 cells in the colon are shown in Table 1.

Cell culture and transfection

HepG2 cells were maintained in DMEM that contained 10% FBS. Metformin and CpC were purchased from Sigma-Aldrich and used at 2 mM and 10 μM, respectively, at which the drugs do not exhibit cytotoxic effects on HepG2 cells. pGL3-FAS-Luc and pGL3-mtFAS-Luc were

Table 1 Viable cell numbers of colonic bacteria in mice treated

with PBS or LNS1.

PBS (n = 6) LNS1 (n = 6)

Total aerobes (log cfu/mL) 8.134 ± 0.099 8.319 ± 0.151LNS1 (log cfu/mL) N.D. 5.207 ± 0.181

Data are shown as means ± s.e.N.D., not detected.





89

Research

S-S Park et al. LNS1 attenuates obesity and fatty liver

237:2Journal of Endocrinology

gifts from Dr Man-Wook Hur (Yonsei University, Korea). Transfection and reporter gene assays have been described previously (Park et al. 2016).

Immunohistochemistry and microscopic analysis

Tissues were fixed with 10% formalin in PBS (pH 7.4), dehydrated and embedded in paraffin. The sectioned tissues were stained with hematoxylin and eosin (H&E), and the size of adipocytes was quantified by measuring long and short axes. To quantify hepatic lipid accumulation, the images of the H&E-stained liver sections were transformed to grayscale and set threshold to occupy whitish lipid droplets. Then, the threshold area within the squares of an area of 400 m2 (20 × 20 μm) was measured. For immunohistochemical analysis, the formalin-fixed tissues were embedded in cryo-embedding medium and cryosectioned. An anti-SREBP1 antibody (Abcam) was used as the primary antibody (1:100), and an Alexa Fluor 488-conjugated goat anti-rabbit antibody was used as the secondary antibody (Life Technology). DAPI was used to stain the nuclei.

RT-qPCR, ChIP and immunoblot assays

The RT-qPCR analyses of SREBP-1c, FAS, ACC, PPARα, ACOX and CPT1 were performed as described previously (Park et al. 2016). The quantity of each target mRNA was quantified relative to 36B4 mRNA. The ChIP assays were performed using HepG2 cells as described previously using the anti-SREBP-1c (Santa Cruz) or anti-PPARα antibodies (Abcam). Sequences of primer pairs used for real-time PCR are listed in Table 2 (Park et al. 2016). The immunoblot analyses were performed as described previously using the anti-SREBP-1c (Santa Cruz), anti-phospho-PPARα and

anti-PPARα (Abcam), anti-phospho-AMPK and anti-AMPK (Cell Signaling), anti-phospho-ACC and anti-ACC (Cell Signaling), anti-phospho-Akt and anti-Akt (Cell Signaling) and anti-β-actin antibodies (Santa Cruz). The level of each protein was quantified using the ImageJ program and normalized to the level of β-actin.

Plasma and tissue analyses

The plasma levels of glucose, insulin, TNFα, leptin and adiponectin and hepatic AMPK activity, were measured using a glucose meter (OneTouch, LifeScan, Milpitas, CA, USA), Insulin ELISA kit (ALPCO, Salem, NH, USA), TNFα ELISA kit (Invitrogen), Leptin ELISA kit (Novex), Adiponectin ELISA kit (Thermo Fisher Scientific) and AMPK kinase assay kit (Cyclex, Nagano, Japan), respectively, according to the manufacturers’ recommended protocols. For the glucose tolerance test, the mice were subjected to fasting for 16 h, and then, injected intraperitoneally with glucose (1 g/kg body weight). For the insulin tolerance test, insulin was injected intraperitoneally at 0.75 U/kg body wt. The blood glucose level was measured via tail bleeding.

Fatty acid synthesis and oxidation

For fatty acid synthesis analysis, freshly prepared slices of mouse liver (0.8–1 mm) and HepG2 cells were incubated with 14C-glucose (0.5 μCi/mL medium) for 12 h, and then, fatty acids were extracted in water according to the method described by Madsen et al. (2003). For the analysis of fatty acid oxidation, mouse liver slices and HepG2 cells were incubated with 14C-oleate (0.5 μCi/mL medium). Perchloric acid (70%) was added to each well, and the plates were covered with paper that was soaked in 3 M NaOH. After incubation for 1 h at room temperature,

Table 2 Primers used for the RT-qPCR analysis.

5′-Sense primer-3′ 5′-Antisense primer-3′

Gene SREBP-1c SREBP-2 FAS ACC PPARα ACOX CPT1 ChREBP ZBTB20 36B4

GATCAAAGAGGAGCCAGTGCAGCAGCAGGTGCAGACGGTAAGATCCTGGAACGAGAACACGATCGGACCTTTGAAGATTTTGTTGTCACTGTCATCCAGTTCTTGTTAAGAAGAGTGCCACCAACTCCTGGAAGAAGAAGTTCCTGGGGACCTAAACAGGAGCACGCAATGAATCCGAGGAGTAGATGCAGCAGATCCGCAT

TAGATGGTGGCTGCTGAGTGCATCTGTCTTCAGCGTGGTCGAGACGTGTCACTCCTGGACTTGGCTTTATTCTGCTGGGTGAACTTCACGATGCTGTCCTCCTCCGGCATGAAGAAACGCTCCTAGGGTCCGATTGATCTTTGGAAGCCACCCTATAGCTCCCCCCAAACTGTTGCTCCACTGATATGAGGCAGCAGTTTCTCCAG

ChIP primer SRE (FAS promoter) PPRE (ACOX promoter)

CAGCCCCGACGCTCATTGGCGGAAACCAGAAGGGAATG

TAGCCAACGACAATGAACCGCCCGCCTATCCTTCCACTG







to collect CO2, the paper was dried and placed in a vial containing 5 mL of scintillation liquid (Harwood et al. 2003). The level of 14C radioactivity was quantified using a MicroBeta TriLux counter (PerkinElmer).

Statistical analysis

The statistical analysis of the data was performed by the Student’s t-test. The data are expressed as means ± s.d. or s.e. All the experiments were performed at least in triplicate.

Results

LNS1 administration ameliorated HFD-induced adiposity and fatty liver in mice

Previously, we reported that oral administration of LNS1 reduces HFD-induced body weight gain without

affecting food intake (Song et al. 2015). In the present study, we examined whether LNS1 can ameliorate HFD-induced metabolic disorders, such as obesity, fatty liver and insulin resistance. Consequently, 7-week-old male mice were fed a normal diet (ND) or a HFD with or without the LNS1 oral supplementation for 12 weeks. LNS1 administration to mice fed a HFD (HFD-LNS1 mice) inhibited body weight gain (~12% decrease), with a reduction in liver weight (19%) and epididymal (42%) and inguinal (22%) fat mass, compared to mice fed a HFD (HFD mice) (Fig. 1A). Mice given LNS1 with a ND (ND-LNS1 mice) also showed a similar tendency with HFD-LNS1 mice, but LNS1’s effects on tissue weight were mostly not statistically meaningful in mice fed a ND (ND mice) (Fig. 1A).

To determine the effect of LNS1 on lipid deposition in tissues, tissue sections were subjected to histological examination. While the diameter of adipocytes in the

Figure 1Administration of Lactobacillus acidophilus NS1 (LNS1) ameliorates diet-induced adiposity and fatty liver in HFD-fed mice. Seven-week-old male C57/BL6 mice were fed a ND or HFD with oral administration of LNS1 or PBS for 12 weeks. (A) The body and tissue weights of mice after the 12-week experiment. (n = 8 per group). (B) Representative images (upper), adipocyte histology (middle) and adipocyte size (in diameter; lower) from each group of mice. To determine adipocyte size, more than 370 adipocytes from four mice were measured in each group. (C) Representative images (upper) and histology (middle) of the liver, and lipid droplet area in liver sections within 20 × 20 μm2 (lower). For analysis of lipid droplet area, 24 places were analyzed in three mice per each group. Representative images from 4 to 8 different mice per group. *P < 0.001, **P < 0.01.





91

Research



epididymal and inguinal adipose tissues of HFD mice increased by 46.2 and 49.5%, respectively, compared with control ND mice, HFD-LNS1 mice showed a 24.1 and 7.8% reduction, respectively, in adipocyte diameter compared with HFD mice (Fig. 1B). Furthermore, HFD-LNS1 mice showed a markedly improved appearance of the liver and a 39% reduction in hepatic lipid accumulation compared with HFD-fed obese mice, when the lipid droplet area in liver sections was analyzed (Fig. 1C).

LNS1 administration inhibited HFD-induced alteration of metabolic gene expression and lipid metabolism

To identify the metabolic pathways that mediate the phenotype of HFD-LNS1 mice, we next analyzed the expression profiles of genes involved in lipid metabolism by RT-qPCR. HFD feeding resulted in increased expression of the genes involved in lipogenesis, including Srebp-1c, fatty acid synthase (Fasn) and acetyl-CoA carboxylase (Acc) and decreased expression of genes involved in β-oxidation, such as Pparα, Acox and Cpt1 in the liver (Fig. 2A). However, LNS1 administration during HFD feeding inhibited HFD-induced alteration in mRNA levels of these genes. Consistently, the mRNA levels of Srebp-1c, Fas and Acc increased, while those of Pparα, Acox and Cpt1 decreased in the epididymal adipose tissue of HFD mice (Fig. 2B). However, on LNS1 administration to HFD mice, the altered mRNA levels of genes involved in lipogenesis were partially restored, while those of genes involved in fatty acid oxidation were fully restored.

Next, we analyzed the effect of LNS1 on lipid metabolism in the liver tissue ex vivo. When 0.5 μCi 14C-labeled glucose was added to liver slices, the radioactive carbon of 14C-glucose incorporated into lipids in HFD mice increased by approximately 2.1-fold compared with ND mice (Fig. 2C). The incorporation of 14C-glucose in HFD-LNS1 mouse livers was 37% lower than that in HFD mouse livers. Additionally, a fatty acid oxidation assay was performed on ex vivo liver tissue by measuring 14CO2 released by 14C-oleate oxidation. Compared with ND mice, HFD reduced hepatic fatty acid oxidation by 12% (Fig. 2D). However, on LNS1 administration to HFD mice, the reduced hepatic fatty acid oxidation due to HFD feeding increased significantly. Contrastingly, LNS1 administration to ND-fed mice moderately reduced hepatic lipogenesis and increased fatty acid oxidation.

LNS1 suppressed maturation and nuclear localization of hepatic SREBP-1c

After proteolytic cleavage, mature SREBP-1c is transported to the nucleus where it functions as a transcription factor (Horton et al. 2002). To determine the effect of LNS1 on the maturation of SREBP-1c, we treated the LNS1 culture supernatant (LSN1-CS) with HepG2 hepatoma cells, which have been widely used to study the molecular pathways involved in energy metabolism (Bozic et al. 2016, Latorre et al. 2017, Yang et al. 2017). While insulin increased levels of the mature form of SREBP-1c by approximately 2.1-fold, LNS1-CS moderately reduced levels of mature SREBP-1c in HepG2 cells relative to control cells (Fig. 3A). When insulin was added to HepG2 cells in the presence of LNS1-CS, the insulin-induced increase in mature SREBP-1c levels was inhibited. Additionally, insulin also increased levels of mature SREBP-1c in HepG2 nuclear extracts by approximately 2.3-fold relative to control cells (Fig. 3B). However, co-addition of LNS1-CS and insulin inhibited the insulin-induced increase in nuclear SREBP-1c levels. Next, we determined whether LNS1 could reduce SREBP-1c levels in HFD mouse livers by the immunoblot assay. HFD feeding increased levels of the precursor and mature forms of SREBP-1c in the liver by 2.5- and 2.2-fold, respectively, compared with ND mice (Fig. 3C). However, LNS1 administration reduced hepatic levels of mature SREBP-1c to 65% of those in HFD mouse livers. Furthermore, confocal immunofluorescence microscopy showed that HFD feeding increased SREBP-1c staining in both the nucleus and cytosol of hepatocytes in mouse liver sections, compared to ND-fed mice (Fig. 3D, left and middle). However, the nuclear and cytosolic staining of SREBP-1c in the hepatocytes from HFD mouse livers was reduced when LNS1 was administered during HFD feeding (Fig. 3D, right).

LNS1-CS suppressed HFD-induced alteration of hepatic lipid metabolism by regulating SREBP-1c and PPARα

To determine whether SREBP-1c is a molecular target of LNS1 in lipid metabolism, we performed a luciferase assay in HepG2 cells using a reporter plasmid (pGL3-FAS-Luc) with luciferase fused to the mouse FAS promoter region containing a functional SRE. Basal FAS promoter activity was repressed by the addition of LNS1-CS in a dose-dependent manner (Fig. 4A). Contrastingly, this LNS1-CS effect was not observed using a luciferase reporter fused to a mutant FAS promoter lacking a SRE (pGL3-mtFAS-luc).







The RT-qPCR analysis showed that addition of LNS1-CS to HepG2 cells reduced the mRNA levels of SREBP-1c, FASN and ACC (Fig. 4B). Furthermore, the incorporation of radioactive 14C-glucose into lipids in HepG2 cells was reduced by 41% when HepG2 cells were pre-incubated with LNS1-CS (Fig. 4C). As expected, addition of LNS1-CS to SREBP-1c-overexpressing HepG2 cells suppressed SREBP-1c-mediated lipogenesis stimulation. We also obtained the same results for the effect of LNS1-CS on SREBP-1c-induced lipogenesis when liver slices were used (Fig. 4D).

We next determined the effect of LNS1-CS on PPARα transcriptional activity using a reporter gene containing three tandem repeats of a PPRE located in the mouse

ACOX promoter (pGL3-ACOX-PPRE-luc) (Kim et al. 1998). Fenofibrate, a PPARα-specific ligand and LNS1-CS enhanced reporter gene activity, respectively, in HepG2 cells (Fig. 4E). However, enhancing the effect of LNS1-CS on this reporter gene’s basal activity was suppressed by treatment with GW9662, a PPARα-specific antagonist. Similarly, RT-qPCR analysis revealed that LNS1-CS addition increased mRNA levels of PPARα and its target genes, such as ACOX and CPT1, in HepG2 cells (Fig. 4F). Next, we performed a fatty acid oxidation assay in HepG2 cells using 14C-oleic acid as the substrate. Next, we performed a fatty acid oxidation assay in HepG2 cells and liver slices using 14C-oleic acid as a substrate. When HepG2 cells and liver slices were treated with LNS1-CS,

Figure 2Administration of LNS1 regulates metabolic gene expression and lipid metabolism in HFD-fed obese mice. Total RNA was isolated from the liver and epididymal adipose tissue of ND- or HFD-fed mice with or without the administration of LNS1. (A and B) The expression of genes involved in lipogenesis or fatty acid oxidation in the liver and epididymal adipose was determined by RT-qPCR. (C and D) Ex vivo analyses of hepatic fatty acid synthesis and oxidation. (C) Freshly isolated liver was sliced and incubated for 12 h with 0.5 μCi 14C glucose. The incorporation of radioactive carbon into fatty acids was then measured according to the method described in ‘Materials and methods’ section. (D) After incubation of freshly isolated liver slices for 12 h with 0.5 μCi 14C-oleic acid, released CO2 was trapped on NaOH-soaked filter paper and then 14C radioactivity was measured. (A and B, n = 9 per group) **P < 0.01, ***P < 0.05.





93

Research



the rate of fatty acid oxidation increased by 1.5- and 1.6-fold, respectively, compared with the control (Fig. 4G and H). However, when GW9662 was added along with LNS1-CS, the promoting effect of LNS1-CS on fatty acid oxidation was nearly eliminated in both HepG2 cells liver slices.

LNS1-stimulated AMPK activity in the liver

AMPK has been implicated in lipid homeostasis as a regulator of lipogenesis and fatty acid oxidation in the liver (Yamauchi et al. 2002). To investigate the possible involvement of AMPK in regulation of hepatic lipid metabolism by LNS1, we assessed the effect of LNS1 on AMPK phosphorylation in HFD mouse livers. HFD feeding decreased hepatic AMPK phosphorylation at Thr 172 to approximately 40% of that in ND mice, whereas HFD-mediated reduction in AMPK phosphorylation was partially restored by LNS1 administration (Fig. 5A). However, LNS1 administration did not significantly affect the total AMPK levels. Parallelly, LNS1 promoted the inhibitory phosphorylation of ACC, an AMPK substrate,

in HFD mouse livers. Furthermore, hepatic AMPKα1 activity in HFD mice was reduced to 52% of that in ND mice, and LNS1 administration increased AMPK activity by approximately 1.7-fold compared with that in HFD mice (Fig. 5B). Consistently, LNS1-CS and metformin, an AMPK activator, increased AMPK phosphorylation in HepG2 cells by 2.4- and 3.3-fold, respectively, compared with the control cells (Fig. 5C). However, when HepG2 cells were pre-incubated with compound C (CpC), a specific inhibitor of AMPK, extent of LNS1-CS- and metformin-induced AMPK phosphorylation was reduced by 52 and 41%, respectively.

Previously, we reported that LNS1 administration increases hepatic Srebp-2 expression in HFD mice (Song et al. 2015). In this study, we showed that LNS1 administration suppressed the HFD-induced reduction of AMPK activity in the mouse liver and decreased HFD-induced Srebp-1c expression. A recent study showed that activation of AMPK reduces both Srebp-1c and Srebp-2 mRNA levels in the mouse liver (Li et al. 2011). In contrast, other studies have shown that Srebp-1c and Srebp-2 are differentially expressed in the mouse liver following

Figure 3Effect of LNS1 on the maturation and nuclear localization of SREBP1c in HepG2 cells and mice livers. (A) Effect of LNS1-CS on the levels of mature SREBP-1c in HepG2 cells. HepG2 cells were cultured for 24 h with either LNS1-CS or control medium (MRS broth, con) in the presence of 100 nM insulin (Ins) or vehicle, and SREBP-1c protein levels were compared by immunoblotting (precursor and mature SREBP-1c; pSREBP-1c, mSREBP-1c). (B) After treatment of HepG2 cells with insulin, LNS1-CS, or control medium for 24 h, as indicated, SREBP-1c levels in cytoplasmic (cSREBP-1c) and nuclear extracts (nSREBP-1c) were analyzed by immunoblotting. (C) Protein levels of precursor and mature SREBP-1c in the liver of ND and HFD mice treated with or without LNS1 were determined by immunoblotting (n = 6 per group). (D) Representative confocal immunofluorescence images of SREBP-1c (green)-stained liver sections of mice in each group (ND, HFD, HFD + LNS1). Nuclei of hepatocytes were stained with DAPI (red). Scale bar = 10 μm. *P < 0.001, **P < 0.01.







AMPK stimulation (Yang et al. 2008, Horie et al. 2013, Kim et al. 2016). Therefore, we performed RT-qPCR analysis to clearly determine the effect of LNS1 on the expression of these two Srebp genes in the liver. RT-qPCR analysis showed that the hepatic mRNA levels of Srebp-1c in HFD mice were

4.2-fold higher than those in ND mice in parallel with increased expression of carbohydrate-responsive element-binding protein (Chrebp), whose expression is known to be regulated by AMPK (Supplementary Fig. 1A, see section on supplementary data given at the end of this article).

Figure 4Effect of LNS1-CS on SREBP-1c and PPARα transcriptional activities and hepatic lipid metabolism. (A and E) HepG2 cells were transfected with luciferase reporter plasmids containing the wild-type FAS promoter (pGL3-FAS-Luc), a mutant FAS promoter lacking a SRE (pGL3-mtFAS-Luc) (A), or three tandem repeats of a PPRE located in the mouse ACOX promoter (pGL3-ACOX-PPRE-Luc) (E) as indicated. After 12 h of transfection, cells were incubated with control medium, LNS1-CS, fenofibrate, and/or GW9662 for 24 h, as indicated. (B and F) Effect of LNS1-CS on the expression of genes involved in fatty acid metabolism in HepG2 cells. HepG2 cells were incubated with or without LNS1-CS for 24 h. The mRNA levels of genes involved in fatty acid synthesis (SREBP-1c, FAS and ACC) (B) and fatty acid oxidation (PPARα, ACOX and CPT1) (F) were analyzed by RT-qPCR, and the results were expressed as fold changes compared to the control. (C and D) After transfection with pCDNA3-HA-SREBP-1c or pCDNA3, HepG2 cells (C) and freshly prepared liver slices (D) were incubated with 0.5 μCi 14C-glucose for 12 h in the absence or presence of LNS1-CS, as indicated, and the incorporation of radioactive carbon into fatty acids was then measured as described in ‘Materials and methods’ section. (G and H) HepG2 cells (G) and freshly prepared liver slices (H) were incubated with 14C-oleic acid for 12 h in the absence or presence of LNS1-CS and GW9662 as indicated. Then, released CO2 was trapped on NaOH-soaked filter paper, and radioactive carbon was measured as described in ‘Materials and methods’ section. **P < 0.01, ***P < 0.05.

Figure 5LNS1 stimulates AMPK activity in mice livers and HepG2 cells. Immunoblot analysis of phosphorylated AMPK at Thr 172 and ACC at Ser 79 (A) and AMPK activity (B) in the liver of mice in each group (ND, ND-LNS1, HFD and HFD-LNS1, n = 3 per group). AMPK activity was analyzed in four different mice per group. (C) HepG2 cells were treated with control medium (con), LNS1-CS in the absence or presence of 10 μM CpC for 24 h and cell extracts were immunoblotted to detect pAMPK, total AMPK, pACC and total ACC using appropriate antibodies. Shown are representative immunoblots of three or five separate experiments with independently prepared tissues (A) or cell lysates (C). Phosphorylation levels of AMPK were determined by the ratio of phosphorylated to total AMPK in liver (A) and HepG2 cells (C). ***P < 0.05.



http://joe.endocrinology-journals.org/cgi/content/full/JOE-17-0592/DC1



95

Research



In contrast, hepatic mRNA levels of Srebp-2 in HFD mice were reduced to 51% of those in ND mice. However, the altered mRNA levels of these genes following HFD feeding were restored by LNS1 administration to HFD mice. In contrast, although HFD feeding enhanced the mRNA levels of Zbtb20, which regulates hepatic lipogenesis in part by regulating Chrebp expression (Liu et al. 2017), LNS1 administration did not significantly affect hepatic expression of Zbtb20 in HFD mice. Next, we determined the effect of LNS1-CS on the expression of these SREBP genes in HepG2 cells in association with AMPK activity by using CpC. As expected, when LNS1-CS was used to treat HepG2 cells, expression of the SREBP-1c and ChREBP genes were reduced and SREBP-2 expression was increased (Supplementary Fig. 1B). However, when HepG2 cells were pre-incubated with CpC, the inhibitory effect of LNS1-CS on the expression of SREBP-1c and ChREBP were abolished. In contrast, pretreatment with CpC reduced LNS1-CS induction of SREBP-2 expression in HepG2 cells. This result suggests that LNS1 mice differentially regulate the expression of SREBP-1c and SREBP-2, although hepatic AMPK activity in HFD mice is enhanced by administration of LNS1.

AMPK is a key regulator of the effect of LNS1-CS on the functions of hepatic SREBP-1c and PPARα

LNS1 may prevent HFD-induced dysregulation of SREBP-1c and PPARα activities at least in part through stimulation of AMPK. To test this hypothesis, we first determined whether AMPK plays a role in LNS1-CS inhibition of SREBP-1c maturation in HepG2 cells. Insulin treatment increased mature SREBP-1c levels by approximately 2.3-fold, compared with control cells, and LNS1-CS addition suppressed the insulin-induced increase in mature SREBP-1c levels (Fig. 6A). SREBP-1c maturation recovered to 41% of that in the insulin- and LNS1-CS-treated HepG2 cells in the presence of CpC. Consistently, LNS1-CS and metformin reduced basal FAS promoter activity by ~43 and 59%, respectively. However, treatment with CpC and LNS1-CS increased basal FAS promoter activity by approximately 33% compared with LNS1-CS-treated cells (Fig. 6B). Furthermore, a ChIP assay using an anti-SREBP-1c antibody showed that both LNS1-CS and metformin reduced the binding of SREBP-1c to the FAS promoter containing a SRE to approximately 58 and 67%, respectively, of that in control HepG2 cells. Moreover, treatment with CpC and LNS1-CS increased the binding of SREBP-1c to the FAS promoter by 46% compared with HepG2 cells treated with LNS1-CS (Fig. 6C). Contrastingly,

both LNS1-CS and metformin increased the stimulatory phosphorylation of PPARα at Ser 12 in HepG2 cells by ~2.3-fold, compared with control cells (Fig. 6D). However, CpC addition reduced the LNS1-CS-induced phosphorylation of PPARα by 45%. Accordingly, in HepG2 cells, both LNS1-CS and metformin increased pGL3-ACOX-PPRE-luc activity by 1.6- and 2.2-fold, respectively (Fig. 6E). A ChIP assay using the anti-PPARα antibody indicated that the binding of PPARα to the ACOX promoter containing a PPRE increased by approximately 2.1- and 2.2-fold following the treatment with LNS1-CS and metformin, respectively (Fig. 6F). However, the addition of CpC together with LNS1-CS to HepG2 cells reduced both the reporter gene activity and PPARα binding to the ACOX promoter to 37 and 52%, respectively, of those in LNS1-CS-treated cells. Furthermore, both LNS1-CS and metformin decreased the mRNA levels of FAS and ACC and increased the levels of ACOX and CPT1 in HepG2 cells (Fig. 6G). However, the effects of LNS1-CS on the expression of these genes were dramatically reduced by CpC treatment. Accordingly, similar to the inhibitory effect of metformin on lipogenesis in HepG2 cells, LNS1-CS reduced the incorporation of 14C-glucose into lipids in HepG2 cells and liver slices by 34% and 36%, respectively, while this incorporation was not significantly affected by LNS1-CS treatment following CpC pretreatment (Fig. 6H). Additionally, LNS1-CS increased fatty acid oxidation in HepG2 cells and liver slices by approximately 1.6- and 1.5-fold, respectively, which was comparable to that of metformin in HepG2 cells. However, CpC pretreatment dramatically reduced this effect of LNS1-CS on fatty acid oxidation (Fig. 6I).

LNS1 prevented HFD-induced development of insulin resistance

Diet-induced obesity is closely associated with insulin resistance, diabetes and fatty liver diseases (Marchesini et al. 1999). To determine the effect of LNS1 on HFD-induced insulin resistance, we first measured plasma glucose and insulin levels. Upon HFD feeding, post-prandial and fasting plasma glucose levels and fasting insulin concentrations increased by 1.4-, 1.3- and 8.3-fold, respectively, compared with the corresponding concentrations in ND mice (Fig. 7A and B). However, on LNS1 administration with HFD, fed and fasting plasma glucose levels and fasting insulin levels were reduced to 15, 18 and 70%, respectively, of those in HFD mice.

Next, we investigated phosphorylation of Akt (at Ser 473), a key component of the insulin signaling



http://joe.endocrinology-journals.org/cgi/content/full/JOE-17-0592/DC1





pathway, in ND and HFD mice. HFD feeding reduced Akt phosphorylation in liver, adipose tissue and skeletal muscle by 75, 77 and 76%, respectively, compared with ND mice. However, on LNS1 administration to HFD-fed mice, Akt phosphorylation levels in all these tissues were similar to those in ND mice (Fig. 7C).

Alteration of adipocytokine levels in plasma is closely associated with insulin resistance (Fasshauer & Paschke 2003, Esteve et al. 2009). Plasma TNFα and leptin levels

increased; however, adiponectin levels decreased in diet-induced obesity and insulin resistance. Therefore, we determined the plasma levels of these adipocytokines to determine whether LNS1 administration to mice during HFD feeding affected plasma levels. TNFα and leptin plasma levels increased by approximately 2.5- and 3.8-fold, respectively, and adiponectin levels in HFD mice were reduced to 31% of those in ND mice (Fig. 7D). However, LNS1 administration caused an increase in

Figure 6AMPK involvement in LNS1-CS regulation of hepatic lipid metabolism. (A and D) HepG2 cells were treated with control medium (con), LNS1-CS, insulin (Ins), metformin and CpC for 24 h, as indicated. Cell lysates were immunoblotted with appropriate antibodies. Representative immunoblot images (left) and quantification (right) of mSREBP-1c or pPPARα in HepG2 cells. (B and E) HepG2 cells were transfected with a reporter gene fused to pGL3-FAS-Luc (B) or pGL3-ACOX-PPRE-Luc (E). After 12 h of transfection, cells were incubated with bacterial culture medium, LNS1-CS or metformin in the presence of vehicle or 10 μM CpC for 24 h. (C and F) HepG2 cells were treated with control medium, LNS1-CS or metformin in the presence of vehicle or 10 μM CpC for 24 h. Cross-linked protein/DNA complexes were immunoprecipitated with an anti-SREBP-1c (C) or anti-PPARα antibody (F). Using PCR, the FAS promoter region containing a SRE (−150 to +63 bp) (C) or ACOX promoter region containing a PPRE (−1965 to −1841 bp) (F) were amplified from DNA immunoprecipitated with an anti-SREBP-1c or anti-PPARα antibody, respectively. (G) RT-qPCR analysis of hepatic genes from HepG2 cells treated as in (B, H, I). Analyses of fatty acid synthesis (H) and oxidation (I). HepG2 cells (upper) and freshly prepared liver slices (lower) were incubated with either 0.5 μCi 14C-glucose (H) or 14C-oleic acid (I) for 12 h in the absence or presence of LNS1-CS, metformin and CpC as indicated, and then the incorporation of radioactive carbon into fatty acids and released 14CO2 were then measured, respectively, as described in ‘Materials and methods’ section. **P < 0.01, ***P < 0.05.





97

Research



adiponectin level and decrease in TNFα and leptin levels in HFD mice. Furthermore, after intraperitoneal glucose injection, HFD-LNS1 mice maintained reduced blood glucose levels at all time points compared with HFD mice, whereas LNS1 administration had no effect on plasma glucose levels in ND mice (Fig. 7E). In the insulin tolerance test (ITT), because HFD-LNS1 mice had a lower baseline of plasma glucose levels than HFD mice, the insulin-induced reduction in plasma glucose levels was not markedly different after normalization of glucose levels to the initial baseline value (set at 100%) (Fig. 7F). However, the area under the curve (AUC) for ITT showed that HFD-LNS1 mice exhibited a greater reduction in glucose levels than HFD mice. Furthermore, plasma glucose levels in HFD mice increased markedly 60 min after insulin injection,

while HFD mice administered LNS1 maintained reduced plasma glucose levels.

Discussion

In the present study, we demonstrated that LNS1 maintained lipid homeostasis in the HFD-fed mice by regulating the activities of SREBP-1c and PPARα, which induced resistance to diet-induced obesity, fatty liver and insulin resistance. We also revealed that AMPK is a key mediator of the LNS1-induced regulation of the SREBP-1c and PPARα signaling pathways.

Dysregulation of SREBP-1c activity is closely associated with metabolic diseases. Small molecules that inactivate

Figure 7LNS1 improves insulin sensitivity in HFD-induced obese mice. Plasma levels of glucose (A) and insulin (B) in mice fed a ND or HFD with or without LNS1 (n = 9–10 per group). (C) Immunoblot analysis of total Akt and phosphorylated Akt (pAkt) in the liver, epididymal adipose tissue and skeletal muscle of mice in each group (ND, ND-LNS1, HFD and HFD-LNS1) using appropriate antibodies. Representative immunoblots (upper) and quantification (lower) of phosphorylated Akt in liver, epididymal adipose and skeletal muscle (n = 6–9). Phosphorylation levels of Akt were determined by the ratio of phosphorylated to total Akt. (D) Plasma profiles of adipocytokines. (E and F) Glucose tolerance (GTT, E) and insulin tolerance tests (ITT, F) from mice in each group (ND, ND-LNS1, HFD and HFD-LNS1; n = 8–10). AUC for GTT and ITT is shown on the right. *P < 0.001, **P < 0.01, ***P < 0.05.







SREBP-1c maturation, such as betulin and fatostatin, also showed anti-obesity effects in obese mice (Horton et al. 2002). Indeed, we observed that the enhanced expression of Srebp-1c and its target genes Fas and Acc, owing to HFD feeding, was significantly downregulated in both liver and adipose tissue following LNS1 administration. Furthermore, LNS1 administration considerably reduced the levels of total and mature SREBP-1c in the liver and decreased the nuclear localization of mature SREBP-1c. Additionally, LNS1 significantly reduced the promoting effect of HFD feeding on hepatic lipogenesis. Additionally, LNS1 significantly reduced the promoting effect of HFD feeding on hepatic lipogenesis.

PPARα plays an important role in hepatic lipid metabolism in response to lipid influx by regulating the expression of genes involved in mitochondrial and peroxisomal beta-oxidation (Minnich et al. 2001). Enhanced hepatic fatty acid oxidation attenuates metabolic disorders in diet- or genetically induced obese animal models (Abu-Elheiga et al. 2001, Rector et al. 2008). Consistently, PPARα activation protects against diet-induced obesity, insulin resistance and hepatic steatosis (Harano et al. 2006). In our study, we showed that LNS1 and LNS1-CS enhanced the hepatic expression of PPARα and its target genes involved in fatty acid oxidation. Consistently, LNS1 and LNS1-CS enhanced hepatic fatty oxidation both ex vivo and in vitro.

Many studies suggest that AMPK plays a key role in energy homeostasis and its activation increases fatty acid oxidation and decreases de novo lipogenesis in part by regulating PPARα and SREBP-1c (Yamauchi et al. 2002). In this study, we observed that the phosphorylation and activity of AMPK in the liver was reduced by HFD feeding, and LNS1 administration restored the phosphorylation and activity of AMPK. We also showed that the regulatory effects of LNS1 on SREBP-1c, PPARα and lipid metabolism are closely related to AMPK activity, since CpC inhibited the regulation of these transcription factors and hepatic lipid metabolism by LNS1-CS. Therefore, our study demonstrated that LNS1 activated AMPK and promoted SREBP-1c inactivation and PPARα stimulation, which reduced the expression of genes involved in fatty acid synthesis and increased the expression of genes involved in fatty acid oxidation. This resulted in the protection against diet-induced obesity and fatty liver through the regulation of fatty acid metabolism.

A recent study reported that activation of AMPK reduces hepatic expression of both SREBP-1c and SREBP-2. However, our study showed that LNS1 administration

inhibited the expression of SREBP-1c and increased that of SREBP-2 in the liver of HFD mice in parallel with stimulation of AMPK activity. Other studies showed that SREBP-1c and SREBP-2 are differentially expressed in the mouse liver under AMPK activation (Yang et al. 2008, Horie et al. 2013, Kim et al. 2016). It remains unclear how LNS1 administration differently regulates the expression of these genes in mouse liver, although its administration resulted in enhanced AMPK activity. One possibility is that LNS1 administration may affect various signaling pathways in addition to AMPK in mice, and thus, LNS1 may lead to cross-talk between these signals including AMPK, resulting in differential expression of SREBP-1c and SREBP-2 even following the stimulation of AMPK. Future studies focusing on the different roles of LNS1 in the expression of these genes and the relationship with AMPK activity will provide insight into the systemic role of LNS1 in energy metabolism.

Insulin resistance is strongly associated with metabolic disorders, such as obesity and fatty liver, and inversely associated with AMPK activity (Ruderman et al. 2013). In addition, PPARα has an insulin-sensitizing effect in insulin-resistant obese mice, whereas overactivation of SREBP-1c promotes insulin resistance (Koo et al. 2004). In this study, we demonstrated that administration of LNS1 to HFD mice reduced plasma glucose and insulin levels, increased adiponectin levels and decreased TNFα and leptin levels in plasma. In addition, LNS1 administration also increased the phosphorylation of Akt at Ser 473 and improved insulin sensitivity in HFD-fed mice. As indicated by increased fatty acid oxidation and reduced lipogenesis in the liver of HFD-LNS1 mice, LNS1 lowers HFD-induced lipid accumulation in metabolic tissues, and thus, it may systematically improve insulin sensitivity.

Taken together, our findings demonstrated that LNS1 administration ameliorated metabolic disorders, including obesity, fatty liver and insulin resistance, in diet-induced obese mice, and these beneficial effects of LNS1 were achieved by the modulation of lipid metabolism through the AMPK-PPARα/SREBP-1c pathway.

Supplementary dataThis is linked to the online version of the paper at https://doi.org/10.1530/JOE-17-0592.

Declaration of interestThe authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.







99

Research



FundingThis research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT and future Planning (NRF-2015R1A2A2A01007467).

AcknowledgementsThe authors are grateful to Dr Man-Wook Hur for providing reagents for this study.

ReferencesAbu-Elheiga L, Matzuk MM, Abo-Hashema KA & Wakil SJ 2001

Continuous fatty acid oxidation and reduced fat storage in mice lacking acetyl-CoA carboxylase 2. Science 291 2613–2616. (https://doi.org/10.1126/science.1056843)

Bozic M, Guzman C, Benet M, Sanchez-Campos S, Garcia-Monzon C, Gari E, Gatius S, Valdivielso JM & Jover R 2016 Hepatocyte vitamin D receptor regulates lipid metabolism and mediates experimental diet-induced steatosis. Journal of Hepatology 65 748–757. (https://doi.org/10.1016/j.jhep.2016.05.031)

Caesar R, Fak F & Backhed F 2010 Effects of gut microbiota on obesity and atherosclerosis via modulation of inflammation and lipid metabolism. Journal of Internal Medicine 268 320–328. (https://doi.org/10.1111/j.1365-2796.2010.02270.x)

Caricilli AM & Saad MJ 2014 Gut microbiota composition and its effects on obesity and insulin resistance. Current Opinion in Clinical Nutrition and Metabolic Care 17 312–318. (https://doi.org/10.1097/MCO.0000000000000067)

Esteve E, Ricart W & Fernandez-Real JM 2009 Adipocytokines and insulin resistance: the possible role of lipocalin-2, retinol binding protein-4, and adiponectin. Diabetes Care 32 (Supplement 2) S362–S367. (https://doi.org/10.2337/dc09-S340)

Fasshauer M & Paschke R 2003 Regulation of adipocytokines and insulin resistance. Diabetologia 46 1594–1603. (https://doi.org/10.1007/s00125-003-1228-z)

Harano Y, Yasui K, Toyama T, Nakajima T, Mitsuyoshi H, Mimani M, Hirasawa T, Itoh Y & Okanoue T 2006 Fenofibrate, a peroxisome proliferator-activated receptor alpha agonist, reduces hepatic steatosis and lipid peroxidation in fatty liver Shionogi mice with hereditary fatty liver. Liver International 26 613–620. (https://doi.org/10.1111/j.1478-3231.2006.01265.x)

Harwood HJ Jr, Petras SF, Shelly LD, Zaccaro LM, Perry DA, Makowski MR, Hargrove DM, Martin KA, Tracey WR, Chapman JG, et al. 2003 Isozyme-nonselective N-substituted bipiperidylcarboxamide acetyl-CoA carboxylase inhibitors reduce tissue malonyl-CoA concentrations, inhibit fatty acid synthesis, and increase fatty acid oxidation in cultured cells and in experimental animals. Journal of Biological Chemistry 278 37099–37111. (https://doi.org/10.1074/jbc.M304481200)

Heo J, Seo M, Park H, Lee WK, Guan LL, Yoon J, Caetano-Anolles K, Ahn H, Kim SY, Kang YM, et al. 2016 Gut microbiota modulated by probiotics and garcinia cambogia extract correlate with weight gain and adipocyte sizes in high fat-fed mice. Scientific Reports 6 33566. (https://doi.org/10.1038/srep33566)

Horie T, Nishino T, Baba O, Kuwabara Y, Nakao T, Nishiga M, Usami S, Izuhara M, Sowa N, Yahagi N, et al. 2013 MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice. Nature Communications 4 2883. (https://doi.org/10.1038/ncomms3883)

Horton JD, Goldstein JL & Brown MS 2002 SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. Journal of Clinical Investigation 109 1125–1131. (https://doi.org/10.1172/JCI15593)

Janovska A, Hatzinikolas G, Staikopoulos V, McInerney J, Mano M & Wittert GA 2008 AMPK and ACC phosphorylation: effect of leptin, muscle fibre type and obesity. Molecular and Cellular Endocrinology 284 1–10. (https://doi.org/10.1016/j.mce.2007.12.013)

Kersten S, Desvergne B & Wahli W 2000 Roles of PPARs in health and disease. Nature 405 421–424. (https://doi.org/10.1038/35013000)

Khan MW, Kale AA, Bere P, Vajjala S, Gounaris E & Pakanati KC 2012 Microbes, intestinal inflammation and probiotics. Expert Review of Gastroenterology and Hepatology 6 81–94. (https://doi.org/10.1586/egh.11.94)

Kim JB, Wright HM, Wright M & Spiegelman BM 1998 ADD1/SREBP1 activates PPARgamma through the production of endogenous ligand. PNAS 95 4333–4337. (https://doi.org/10.1073/pnas.95.8.4333)

Kim KY, Jang HJ, Yang YR, Park KI, Seo J, Shin IW, Jeon TI, Ahn SC, Suh PG, Osborne TF, et al. 2016 SREBP-2/PNPLA8 axis improves non-alcoholic fatty liver disease through activation of autophagy. Scientific Reports 6 35732. (https://doi.org/10.1038/srep35732)

Koo SH, Satoh H, Herzig S, Lee CH, Hedrick S, Kulkarni R, Evans RM, Olefsky J & Montminy M 2004 PGC-1 promotes insulin resistance in liver through PPAR-alpha-dependent induction of TRB-3. Nature Medicine 10 530–534. (https://doi.org/10.1038/nm1044)

Latorre J, Moreno-Navarrete JM, Mercader JM, Sabater M, Rovira O, Girones J, Ricart W, Fernandez-Real JM & Ortega FJ 2017 Decreased lipid metabolism but increased FA biosynthesis are coupled with changes in liver microRNAs in obese subjects with NAFLD. International Journal of Obesity 41 620–630. (https://doi.org/10.1038/ijo.2017.21)

Li Z, Yang S, Lin H, Huang J, Watkins PA, Moser AB, Desimone C, Song XY & Diehl AM 2003 Probiotics and antibodies to TNF inhibit inflammatory activity and improve nonalcoholic fatty liver disease. Hepatology 37 343–350. (https://doi.org/10.1053/jhep.2003.50048)

Li Y, Xu S, Mihaylova MM, Zheng B, Hou X, Jiang B, Park O, Luo Z, Lefai E, Shyy JY, et al. 2011 AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metabolism 13 376–388. (https://doi.org/10.1016/j.cmet.2011.03.009)

Liu G, Zhou L, Zhang H, Chen R, Zhang Y, Li L, Lu JY, Jiang H, Liu D, Qi S, et al. 2017 Regulation of hepatic lipogenesis by the zinc finger protein Zbtb20. Nature Communications 8 14824. (https://doi.org/10.1038/ncomms14824)

Ma X, Hua J & Li Z 2008 Probiotics improve high fat diet-induced hepatic steatosis and insulin resistance by increasing hepatic NKT cells. Journal of Hepatology 49 821–830. (https://doi.org/10.1016/j.jhep.2008.05.025)

Madsen L, Petersen RK, Sorensen MB, Jorgensen C, Hallenborg P, Pridal L, Fleckner J, Amri EZ, Krieg P, Flirstenberger G, et al. 2003 Adipocyte differentiation of 3T3-L1 preadipocytes is dependent on lipoxygenase activity during the initial stages of the differentiation process. Biochemical Journal 375 539–549. (https://doi.org/10.1042/Bj20030503)

Marchesini G, Brizi M, Morselli-Labate AM, Bianchi G, Bugianesi E, McCullough AJ, Forlani G & Melchionda N 1999 Association of nonalcoholic fatty liver disease with insulin resistance. American Journal of Medicine 107 450–455. (https://doi.org/10.1016/S0002-9343(99)00271-5)

Matsuzawa Y 2008 The role of fat topology in the risk of disease. International Journal of Obesity 32 (Supplement 7) S83–S92. (https://doi.org/10.1038/ijo.2008.243)

Mengheri E 2008 Health, probiotics, and inflammation. Journal of Clinical Gastroenterology 42 (Supplement 3) S177–S178. (https://doi.org/10.1097/MCG.0b013e31817eedc4)

Minnich A, Tian N, Byan L & Bilder G 2001 A potent PPARalpha agonist stimulates mitochondrial fatty acid beta-oxidation in liver and skeletal muscle. American Journal of Physiology: Endocrinology and Metabolism 280 E270–E279. (https://doi.org/10.1152/ajpendo.2001.280.2.E270)



https://doi.org/10.1126/science.1056843

https://doi.org/10.1126/science.1056843

https://doi.org/10.1016/j.jhep.2016.05.031


https://doi.org/10.1111/j.1365-2796.2010.02270.x

https://doi.org/10.1111/j.1365-2796.2010.02270.x

https://doi.org/10.1097/MCO.0000000000000067

https://doi.org/10.1097/MCO.0000000000000067

https://doi.org/10.2337/dc09-S340

https://doi.org/10.1007/s00125-003-1228-z

https://doi.org/10.1007/s00125-003-1228-z

https://doi.org/10.1111/j.1478-3231.2006.01265.x

https://doi.org/10.1111/j.1478-3231.2006.01265.x

https://doi.org/10.1074/jbc.M304481200

https://doi.org/10.1038/srep33566

https://doi.org/10.1038/ncomms3883

https://doi.org/10.1172/JCI15593


https://doi.org/10.1016/j.mce.2007.12.013

https://doi.org/10.1038/35013000

https://doi.org/10.1586/egh.11.94

https://doi.org/10.1586/egh.11.94

https://doi.org/10.1073/pnas.95.8.4333


https://doi.org/10.1038/nm1044

https://doi.org/10.1038/ijo.2017.21

https://doi.org/10.1038/ijo.2017.21

https://doi.org/10.1053/jhep.2003.50048

https://doi.org/10.1016/j.cmet.2011.03.009

https://doi.org/10.1016/j.cmet.2011.03.009





https://doi.org/10.1042/Bj20030503

https://doi.org/10.1042/Bj20030503

https://doi.org/10.1016/S0002-9343(99)00271-5

https://doi.org/10.1016/S0002-9343(99)00271-5

https://doi.org/10.1038/ijo.2008.243

https://doi.org/10.1038/ijo.2008.243

https://doi.org/10.1097/MCG.0b013e31817eedc4

https://doi.org/10.1097/MCG.0b013e31817eedc4

https://doi.org/10.1152/ajpendo.2001.280.2.E270

https://doi.org/10.1152/ajpendo.2001.280.2.E270





Murakami K, Tobe K, Ide T, Mochizuki T, Ohashi M, Akanuma Y, Yazaki Y & Kadowaki T 1998 A novel insulin sensitizer acts as a coligand for peroxisome proliferator-activated receptor-alpha (PPAR-alpha) and PPAR-gamma: effect of PPAR-alpha activation on abnormal lipid metabolism in liver of Zucker fatty rats. Diabetes 47 1841–1847. (https://doi.org/10.2337/diabetes.47.12.1841)

Naito E, Yoshida Y, Makino K, Kounoshi Y, Kunihiro S, Takahashi R, Matsuzaki T, Miyazaki K & Ishikawa F 2011 Beneficial effect of oral administration of Lactobacillus casei strain Shirota on insulin resistance in diet-induced obesity mice. Journal of Applied Microbiology 110 650–657. (https://doi.org/10.1111/j.1365-2672.2010.04922.x)

O’Neill HM, Holloway GP & Steinberg GR 2013 AMPK regulation of fatty acid metabolism and mitochondrial biogenesis: implications for obesity. Molecular and Cellular Endocrinology 366 135–151. (https://doi.org/10.1016/j.mce.2012.06.019)

Park SS, Choi H, Kim SJ, Chang C & Kim E 2016 CREB/GSK-3beta signaling pathway regulates the expression of TR4 orphan nuclear receptor gene. Molecular and Cellular Endocrinology 423 22–29. (https://doi.org/10.1016/j.mce.2015.12.023)

Rector RS, Thyfault JP, Morris RT, Laye MJ, Borengasser SJ, Booth FW & Ibdah JA 2008 Daily exercise increases hepatic fatty acid oxidation and prevents steatosis in Otsuka Long-Evans Tokushima Fatty rats. American Journal of Physiology: Gastrointestinal and Liver Physiology 294 G619–G626. (https://doi.org/10.1152/ajpgi.00428.2007)

Reddy JK & Rao MS 2006 Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty acid oxidation. American Journal of Physiology: Gastrointestinal and Liver Physiology 290 G852–G858. (https://doi.org/10.1152/ajpgi.00521.2005)

Ruderman NB, Carling D, Prentki M & Cacicedo JM 2013 AMPK, insulin resistance, and the metabolic syndrome. Journal of Clinical Investigation 123 2764–2772. (https://doi.org/10.1172/JCI67227)

Shen J, Obin MS & Zhao L 2013 The gut microbiota, obesity and insulin resistance. Molecular Aspects of Medicine 34 39–58. (https://doi.org/10.1016/j.mam.2012.11.001)

Song M, Park S, Lee H, Min B, Jung S, Park S, Kim E & Oh S 2015 Effect of Lactobacillus acidophilus NS1 on plasma cholesterol levels in diet-induced obese mice. Journal of Dairy Science 98 1492–1501. (https://doi.org/10.3168/jds.2014-8586)

Xu XJ, Valentine RJ & Ruderman NB 2014 AMP-activated protein kinase (AMPK): does this master regulator of cellular energy state distinguish insulin sensitive from insulin resistant obesity? Current Obesity Reports 3 248–255. (https://doi.org/10.1007/s13679-014-0095-x)

Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, et al. 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Medicine 8 1288–1295. (https://doi.org/10.1038/nm788)

Yang J, Maika S, Craddock L, King JA & Liu ZM 2008 Chronic activation of AMP-activated protein kinase-alpha1 in liver leads to decreased adiposity in mice. Biochemical and Biophysical Research Communications 370 248–253. (https://doi.org/10.1016/j.bbrc.2008.03.094)

Yang J, Jin X, Yan Y, Shao Y, Pan Y, Roberts LR, Zhang J, Huang H & Jiang J 2017 Inhibiting histone deacetylases suppresses glucose metabolism and hepatocellular carcinoma growth by restoring FBP1 expression. Scientific Reports 7 43864. (https://doi.org/10.1038/srep43864)

Yoo SR, Kim YJ, Park DY, Jung UJ, Jeon SM, Ahn YT, Huh CS, McGregor R & Choi MS 2013 Probiotics L. plantarum and L. curvatus in combination alter hepatic lipid metabolism and suppress diet-induced obesity. Obesity 21 2571–2578. (https://doi.org/10.1002/oby.20428)

Youssef W & McCullough AJ 2002 Diabetes mellitus, obesity, and hepatic steatosis. Seminars in Gastrointestinal Disease 13 17–30.

Received in final form 13 February 2018Accepted 5 March 2018Accepted Preprint published online 5 March 2018



https://doi.org/10.2337/diabetes.47.12.1841

https://doi.org/10.1111/j.1365-2672.2010.04922.x




https://doi.org/10.1152/ajpgi.00428.2007

https://doi.org/10.1152/ajpgi.00521.2005


https://doi.org/10.1016/j.mam.2012.11.001

https://doi.org/10.1016/j.mam.2012.11.001

https://doi.org/10.3168/jds.2014-8586

https://doi.org/10.3168/jds.2014-8586

https://doi.org/10.1007/s13679-014-0095-x



https://doi.org/10.1016/j.bbrc.2008.03.094



https://doi.org/10.1002/oby.20428

Documents

Lactobacillus acidophilus NS1 attenuates diet-induced