1

L Ding et al. Nature 000, 1-5 (2012) doi:10.1038/nature10738 Graphical representation of clonal evolution from the primary tumour to relapse in UPN 933124, and patterns of tumour evolution observed in eight primary tumour and relapse pairs.

L Ding et al . Nature 000 , 1 - 5 (2012) doi:10.1038/nature10738

Download PPT Report

Upload
thomas-buckley
View
37
Download
7

Embed Size (px)

DESCRIPTION

Graphical representation of clonal evolution from the primary tumour to relapse in UPN 933124, and patterns of tumour evolution observed in eight primary tumour and relapse pairs. L Ding et al . Nature 000 , 1 - 5 (2012) doi:10.1038/nature10738. - PowerPoint PPT Presentation

Citation preview

Page 1: L Ding et al . Nature 000 , 1 - 5 (2012) doi:10.1038/nature10738

L Ding et al. Nature 000, 1-5 (2012) doi:10.1038/nature10738

Graphical representation of clonal evolution from the primary tumour to relapse in UPN 933124, and patterns of

tumour evolution observed in eight primary tumour and relapse pairs.

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Documents

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Documents

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Documents

GI Motility online (May 2006) | doi:10.1038/gimo12

GI Motility online (May 2006) | doi:10.1038/gimo12

Documents

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Documents

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Documents

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Documents

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Documents

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature06481 LETTERS

Documents

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Documents

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Documents

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Documents

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Documents

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Documents

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Documents

GI Motility online (May 2006) | doi:10.1038/gimo6

GI Motility online (May 2006) | doi:10.1038/gimo6

Documents

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Documents

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Documents

GI Motility online (May 2006) | doi:10.1038/gimo48

GI Motility online (May 2006) | doi:10.1038/gimo48

Documents

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Documents

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

Documents

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Documents

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Documents

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Documents

GI Motility online (May 2006) | doi:10.1038/gimo46

GI Motility online (May 2006) | doi:10.1038/gimo46

Documents

1 November 2007 doi:10.1038/nature06221 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

Documents

DOI: 10.1038/ncomms1280 molecular dynamics of single

DOI: 10.1038/ncomms1280 molecular dynamics of single

Documents

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Documents

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Documents

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Documents