Joanna KleinMarch 22, 2012

Sabbatical ActivitiesScience Research Institute - Administration

and Program DevelopmentCollaboration with Department of Energy Joint

Genome InstituteInvestigator in their interpret a genome for

education programPresented at the American Society for

Microbiology Conference for Undergraduate Education

Bonus VenturesBlended Learning Course DesignWriting project with Boyd SeeversService to communityService to department and college

A collaboration between Northwestern College

and Concordia University-St. Paul

The Science Research Institute (SRI) is a

year long program partnering college

science and math majors and high

school students with an interest in

Science, Engineering, Technology and

Math (STEM) areas with the purpose of

developing their knowledge and skills in

scientific study and research.

• 5 week Summer program (July 5- August 5, 2011)

• 32 high school students, 8 College students, 3 high school teachers, 4 college faculty – split between NWC and CSP•NWC Research projects

•Dale Gentry – field biology and ecology•Joanna Klein - microbiology

•CSP Research projects•Vivian Feng (Augsburg) - chemistry •Jonathan Zderad - statistics

• Academic Year Program• Research Symposium• Presentations at Mpls. and St. Paul high

schools• Service project – Elementary School Science

Night• Science Museum trip• 3M tour• College admissions information session• Banquet

2011-2012 Program

SRI - Sabbatical ActivitiesResearch

Attended ASM/NIGMS Learning Interventions Institute:  Understanding Research Techniques to Study Student Interventions

Washington D.C., January 2011Learned techniques to research best practices

in STEM student learning and persistence Research design and methodology Statistical analysis Logic Models

Goal: Use SRI as a subject to answer the question how do students who are traditionally underrepresented in the sciences advance in scientific fields?

SRI Logic Model

Situation

Objective of program is to increase high school students persistence in stem and to aid in diversifying stem.

Inputs Outputs Outcomes/Impact

Need for science and math in the community/work force. Need for education.

Need for diversity in Stem education. Political factors. Funding factors. Research

Needs.

External Factors

Professors will want to continue to work on modules. Need for the program will continue.

Need for diversity in Stem field. Need for growth of Stem field.

Assumptions

Long Term Goals:

Students choose to go to college.

Students choose a major in the Stem field.

Students pursue a career in the Stem field.

Integrate diversity in the field of science and math.

Hinder the under-representation of people of color in the field of science and math.

Help community improve to provide a more knowledgeable and skilled work force.

Staffing

Time

Money/funding

Research Base

Technology

Materials/Resources

College mentor help

High school teacher help

Number of modules completed

Knowledge gained on pre/post data

Time (hours) spent on projects

Number of presentations conducted as a result of module research

Number of Service learning projects completed

Amount of research obtained from the modules

Number of hours spent mentoring high school students.

Number of students in program cycle

Short Term Goals:

Improving knowledge from pre-post tests for each module.

Leadership development among college mentors.

Increase in Student Learning.

Increasing motivation to take science and math classes.

Increase interest in college.

Increase interest in stem careers.

Increase presentation skills among High school students.

SRI Co-DirectorsDr. Joanna Klein, NWC & Dr. Shellie Kieke, CSP

SRI - Sabbatical Activities, con’t.Program Development

Networking MN STEM network

Attended annual meeting at Boston Scientific and presented poster

Breakthrough St. Paul

Developed and supervised course for high school teacher participant – Research as Pedagogy

SRI - Sabbatical Activities, con’t.General administration

Developed SRI page for NWC websiteAttended helped coordinate academic year events

Medtronic tour Snail Lake Restoration volunteer Science fair service project Be the Match drive

Planned and carried out 2011-2012 program Recruited, hired and paid participants Taught in summer program

Incorporated new research project

Beyond the sabbaticalContinue to partner with the NWC grant

office to write to foundations for continued supportOver $400,000 in support over the past 6 years

Worked with Master of Applied Psychology student intern from UW-Stout to develop a Logic Model and evaluation plan for SRI.

Currently planning for 2012-2013 program

Undergraduate Research in Microbial Genome Analysishttp://www.jgi.doe.gov/education/

genomeannotation.htmlStudents and instructors across the country

partner with the JGI in analysis of microbial genomes to: provide a research-based approach to teach

fundamental concepts in the life-science curriculumadvance our understanding of diverse microbes

Genomics and BioinformaticsGenome sequencing has revolutionized our

understanding of microorganisms and the role they play in important processes pathogenesisenergy production bioremediation global nutrient cyclesorigins, evolution, and diversity of life.

Currently, there are more than 3000 complete or nearly complete genome sequences of microbes available.

Phylogenetic Phylogenetic tree of tree of BacteriaBacteria

Handelsman (2004)Microbiol. Mol. Biol. Rev. 68: 669-685.

The problem: genome sequences from members of those phyla in yellowand orange are under-represented relative to those in red

Genomic Encyclopedia of Bacteria and Archaea (GEBA)goal is to sequence genomes from under-

represented phyla GEBA organisms

https://docs.google.com/View?id=dggwdv6s_2d9zhwf9f

Genome Projects

CTCTAACGCGCAAGCGCATATCCTTCTAGGTAGCGGGCAGTAGCCGCTTCAGGGAGGGACGAAGAGACCC AGCAACCCACAGAGTTGAGAAATTTGACTGGCATTCAAGCTGTCCAATCAATAGCTGCCGCTGAAGGGTG GGGCTGGATGGCGTAAGCTACAGCTGAAGGAAGAACGTGAGCACGAGGCACTGAGGTGATTGGCTGAAGG CACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTA TTCGGCGGCTGGACGAGACAGTGGTGAACCGCATCGCGGCGGGGGAAGTTATCCAGCGGCCAGCTAATGC TATCAAAGAGATGATTGAGAACTGGTACGGAGGGAGTCGAGCCGGGCTCACTTAAGGGCTACGACTTAAC GGGCCGCGTCACTCAATGGCGCGGACACGCCTCTTTGCCCGGGCAGAGGCATGTACAGCGCATGCCCACA ACGGCGGAGGCCGCCGGGTTCCCTGACGTGCCAGTCAGGCCTTCTCCTTTTCCGCAGACCGTGTGTTTCT TTACCGCTCTCCCCCGAGACCTTTTAAGGGTTGTTTGGAGTGTAAGTGGAGGAATATACGTAGTGTTGTC TTAATGGTACCGTTAACTAAGTAAGGAAGCCACTTAATTTAAAATTATGTATGCAGAACATGCGAAGTTA AAAGATGTATAAAAGCTTAAGATGGGGAGAAAAACCTTTTTTCAGAGGGTACTGTGTTACTGTTTTCTTG CTTTTCATTCATTCCAGAAATCATCTGTTCACATCCAAAGGCACAATTCATTTTGAGTTTCTTTCAAAAC AAATCGTTTGTAGTTTTAGGACAGGCTGATGCACTTTGGGCTTGACTTCTGATTACCCTATTGTTAAATT AGTGACCCCTCTTAGTGTTTTCCTGTCCTTTATTTCGGAGGACGCACTTCGAAGATACCAGATTTTATGG GTCATCCTTGGATTTTGAAGCTTATAACTGTGACAAAAAATGTGAAGGGAAGAGATTTGAAACATGTGGA AGGAAAAGTGAGTGCAGACTATAAACTTCCAAAAAGACAAGCCCAAAATACACCTAAACGTTATGTCAGA TTATTTTGTTAAAATCAGTTGTTAGTGACGTCCGTACGTTAATAGAAAAAAGAATGCTTCAGTTTGGAGT GGTAGGTTTCTAGAGGGATTTATTGTGAAAGTATAAACTATTCAGGGCAATGGGACTGAGAGAACAGTGG GTAGAAAGGACCACTGAAGGAAAGGAAGAGAATTGGAAGGTAGATGAAAGAAGGAGCAAGAACCTGGGGA TGTTTTTTCCTTTTCACTTGTAATAGTAGTAACAGAAGCAATGGCAGACTGGCTTTTGTTTCTACTGTGT TAGAATGAATTGACAGGACAACTGGGCCTATTATTGTACTGTGCCAGAATACTGTAAAACAAAACTAAAC ATACTAGCTTGGTGGCTTGTAATTAATTACTTAAGTGGAGATTTTTATTTTTTTTTTATTTTTTTTTTAG ACGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCGCGATCTCAGCTGACTGCAACCTCCTCCTC ACAGGTTCAAGGGAGATTCTCCTGCCTCAGCCTCCCGAGTAGCTAGGACTATAGGCATGTGCCACCACAC CTGGCTAATTTTGTATTTTTAGTAGAGATGGGATTTCTCCATGTTGGTCAGGCTGGTGTCAAAACTCTCG ATCTCAGGTGAACCGCCTGCCTCAGCCTTCCAAAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCCTGC AGTTTTTTGTATTTTTAATAGAGACAGGGTTTCACCATGTTAGCCAGGATGGTCTCGATTTCCTGACCTC AGGTGATCTGCCCGCTTTGGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCGCGCCCGGCTCAAG

Bacterial Luciferase

Process of annotationDone automatically using computer softwareManual annotation is best

35% of computer generated annotations are wrong or are missing information.

Limitation of computer algorithmsDraw backs: Labor intensive and time

consuming

Manual Annotation

• IMG-ACT is a toolkit of online gene and genome analysis programs.

• Using IMG-ACT, students annotate genomes• provide human expertise necessary for

accurate, up-to-date, reliable annotation• Students contribute to the scientific community

and learn biological concepts through participating in original research

JGI Genome Annotation Workshop

Walnut Creek, CA, Jan. 2011

Genomic Encyclopedia of Bacteria and Archeae https://docs.google.com/View?

id=dggwdv6s_2d9zhwf9f Northwestern College has adopted the

genome of Cellulophaga lytica to study

Marine bacteriumIsolated from beach

mud near Limon, Costa Rica in 1969

Member of the Cytophaga-Flavobacterium-Bacteroides (CFB) groupPoorly characterized

branch of the tree of life

Has the ability to degrade cellulose Biofuel research http://www.infoplease.com/atlas/centralamerica.html

Cellulophaga lytica

http://travel.yahoo.com/p-travelguide-482616-limon_vacations-i

Cellulophaga lyticaGram negative FilamentousExhibits gliding motilityYellow pigmentation

H:\JGI IMG_ACT\C. lytica\Photos\C. lytica 63X video in water fast\C. lytica 63X video in water fast_t01.MOV

Beyond the SabbaticalIncorporated IMG-ACT into teaching and

researchSRI, Summer 2011Genetics, Fall 2011Microbiology, Spring 2012Principles of Biology 2, Spring 2012 Research Students: Stephen Erickson and Andy

JaegerNetworking

St. Thomas, St. John’s/St. Ben’s, Gustavus, U of MN, UN-Lincoln, St. Cloud, JGI

ASM Conference for Undergraduate Educators Johns Hopkins University, June 2011

Is it E. coli O157:H7? Using Bioinformatics to Develop and Test Hypothesesmanuscript submitted to Journal of

Microbiology and Biology EducationLeading an Elementary School Science Club:

A Service Learning Project for Microbiology Students

New Blended Learning Course Development

Writing ProjectGENETICS AND THE BIBLE: THE CURIOUS

CASE OF THE LEFT-HANDED BENJAMITESBoyd Seevers, Ph.D.; Joanna Klein, Ph.D.

Service to CommunityVolunteer with science program at Island

Lake ElementaryMember of organizing committeeOrganized help sessions for students working

on science fair projectsOrganized DNA activity for familiesInterviewed students

Recruited NWC college student volunteers for all of the above activities

Service to the Department and CollegeDepartment

Tri-Beta advisorContinued to advise, attend dept. meetings and

eventsTaught a session of Senior Seminar and

Microbiology Lab Assessment Committee

ePortfolio sub-committeeAdvising sub-committee

AcknowledgementsThank you to Northwestern College for

providing the opportunity and support. Funding received from Faculty Development

Grant and SRI grants