Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
1/37
Title 1
Molecular and microbiological characterization of Clostridium difficile isolates from single, 2
relapse, and re-infection cases. 3
4
Running Title 5
Characterization of C. difficile isolates. 6
7
Authors 8
Kentaro Oka 1, 2), Takako Osaki 1), Tomoko Hanawa 1), Satoshi Kurata 1), Mitsuhiro 9
Okazaki 3), Taki Manzoku 2), Motomichi Takahashi 2), Mamoru Tanaka 2), Haruhiko 10
Taguchi 4), Takashi Watanabe 5), Takashi Inamatsu 6) and Shigeru Kamiya* 1). 11
12
* Corresponding author. Mailing address: Department of Infectious Diseases, Kyorin 13
University School of Medicine, 6-20-2, Shinkawa, Mitaka, Tokyo, 181-8611, Japan. Phone: 14
+81-422-47-5511. Fax: +81-422-44-7325. E-mail: [email protected]. 15
16
Address of the institution at which the work was performed 17
Department of Infectious Diseases, Kyorin University School of Medicine, 6-20-2, 18
Shinkawa, Mitaka, Tokyo, 181-8611, Japan. 19
20
Author affiliations 21
1) Department of Infectious Diseases, Kyorin University School of Medicine, Tokyo, Japan 22
Copyright © 2011, American Society for Microbiology. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.05588-11 JCM Accepts, published online ahead of print on 28 December 2011
Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.05588-11 JCM Accepts, published online ahead of print on 11 January 2012
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
2/37
2) Miyarisan Pharmaceutical Co., Ltd., Tokyo, Japan 23
3) Department of Clinical Laboratories, Kyorin University Hospital, Tokyo, Japan 24
4) Department of Immunology, Kyorin University Faculty of Health Sciences, Tokyo, 25
Japan 26
5) Department of Laboratory Medicine, Kyorin University School of Medicine, Tokyo, 27
Japan 28
6) Department of Infectious Diseases, Tokyo Metropolitan Geriatric Hospital, Tokyo, Japan.29
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
3/37
Abstract 30
In this study, we investigated the correlation between the microbiological characteristics 31
of Clostridium difficile clinical isolates and the recurrence of C. difficile-associated disease 32
(CDAD). Twenty C. difficile isolates recovered from 20 single infection cases and 53 33
isolates from 20 recurrent cases were analyzed by pulsed-field gel electrophoresis (PFGE) 34
and PCR ribotyping, and cytotoxicity, antimicrobial susceptibility and 35
sporulation/germination rates of the isolates were examined. Recurrent cases were divided 36
into relapse or re-infection cases by the results of C. difficile DNA typing. Among the 20 37
recurrent cases, 16 cases (80%) were identified to be relapse cases caused by the initial 38
strain and the remaining 4 cases (20%) to be re-infection cases caused by different strains. 39
All 73 isolates were susceptible to both vancomycin and metronidazole, but resistance 40
against clindamycin, ceftriaxone, erythromycin and ciprofloxacin was found in 87.7%, 41
93.2%, 87.7% and 100% of the isolates, respectively. No correlations were observed 42
between DNA typing group, cytotoxicity and sporulation rate of isolates, and infection 43
status, i.e., single, relapse or re-infection. However, the isolates recovered from relapse 44
cases showed a significantly higher germination rate when incubated in medium lacking the 45
germination stimulant, sodium taurocholate. These results indicate that the germination 46
ability of C. difficile may be a potential risk factor for the recurrence of CDAD.47
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
4/37
Introduction 48
Clostridium difficile is a Gram-positive, obligately anaerobic, spore-forming bacillus, 49
which is the causative pathogen of pseudomembranous colitis (PMC) and is also associated 50
with a large proportion of inpatient cases of antibiotic-associated diarrhea (AAD) (5, 22, 51
35). The main virulence factors of C. difficile are the two large clostridial glucosylating 52
toxins, toxin A (TcdA) and toxin B (TcdB), which have enterotoxic and cytotoxic activity, 53
respectively. These genes are located within a pathogenicity locus (PaLoc) along with other 54
toxin production-related genes. Most pathogenic strains isolated in cases of C. 55
difficile-associated disease (CDAD) produce both toxins (A+/B+ strains). Regarding other 56
toxin variant strains, A−/B+ isolates have been reported worldwide but naturally occurring 57
A+/B− isolates have not previously been reported. Some isolates produce an additional 58
binary toxin (CDT), but its role in CDAD is not well understood (10, 26, 27, 35). Recently, 59
outbreaks due to an emerging hyper-virulent strain of C. difficile BI/NAP1/027, which 60
produces a binary toxin, have been reported in North America and Europe (28, 35). 61
Oral antibiotics, such as vancomycin or metronidazole are commonly used and effective 62
in the treatment of CDAD. However, recurrent cases of CDAD (rCDAD) are common and 63
result inhave become a difficult clinical problem, in terms of prolonged duration of 64
hospitalization and increasing treatment costs (36, 40). Recurrence rates are generally 10 to 65
35%, but patients with known recurrent CDAD may exhibit higher rates than this (4, 9, 29). 66
Concerning the rRisk factors of for recurrent CDAD, several epidemiological analysis 67
reports have suggested host risk factors such as are: continuous use of antibiotics, older age, 68
hypoalbuminemia, diabetes mellitus, antacids and stool colonization with 69
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
5/37
vancomycin-resistant enterococci (VRE) (8, 12, 24, 37). Abnormal flora and/or host 70
immune response are also possible reasons for recurrence (40). 71
Recurrences are caused by the persistence of the same strain of C. difficile as first 72
episode and/or the re-infection of the new strain from environment. It has been reported 73
that the relapse rates due to the same strain were 25 to 87.5% (2, 4, 9, 32, 41, 45). However, 74
it is important to note that these may include an external reinfection by the original strain. 75
Various studies have reported molecular and microbiological characterization of isolates 76
from CDAD and/or rCDAD patients. In most of these studies, the DNA and toxin type were 77
investigated, and in some, antimicrobial susceptibility and/or cytotoxicity of C. difficile 78
clinical isolates were also tested as phenotypic characteristics (9, 23, 30, 32, 33, 42). 79
However, reports for other phenotypic characteristics such as sporulation rate are very 80
limited. 81
Sporulation and germination are one of the most important factors in the pathogenicity of 82
C. difficile and the recurrence of CDAD. It is presumed that the toxin production of C. 83
difficile is related to sporulation and germination (3, 16), and that sporulation allows for 84
persistence of C. difficile in the intestinal tract and the environment (4, 32, 35). Spores are 85
resistant to antibiotics and it is reasonable to assume that sporulation contributes to the 86
spread and survival of C. difficile. A rapid germination rate may allow for rapid growth of C. 87
difficile when antibiotic levels are greatly reduced or absent.Due to its conference of 88
antibiotic resistance, it is sensible to presume that sporulation contributes to the spread of C. 89
difficile, while germination rate is important for its rapid growth prior to restoration of 90
normal gut microbiota in recurrent cases. 91
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
6/37
In this study, we performed DNA typing of clinical isolates of C. difficile and examined 92
cytotoxicity, antibiotic susceptibility and sporulation/germination rates to investigate the 93
correlation between microbiological characteristics and the recurrence of CDAD.94
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
7/37
Materials and methods 95
C. difficile strains 96
Seventy-three clinical isolates of C. difficile were used in this study to compare 97
genotypic and/or phenotypic characteristics between strains isolated from single infection 98
cases and those from recurrent cases. A single detection of C. difficile from one patient 99
during the observation period (more than 1.5 years) was regarded as a single infection case, 100
and multiple detections with an interval of two or more weeks from one patient was 101
regarded as a recurrent case. Twenty strains from 20 single infection cases and 53 strains 102
from 20 recurrent cases were isolated from inpatients in the following two facilities: Tokyo 103
Metropolitan Geriatric Hospital, Tokyo, Japan (TMG strain, 2002-2005, 3 strains from 3 104
single infection cases and 7 strains from 3 recurrent cases) and Kyorin University Hospital, 105
Tokyo, Japan (KY strain, 2004-2005, 17 strains from 17 single infection cases and 46 106
strains from 17 recurrent cases). 107
108
Identification 109
C. difficile isolates were identified by PCR assay using primer sets B 110
(CCGTCAATTCMTTTRAGTTT, M = A or C, R = A or G) and PG-48 111
(CTCTTGAAACTGGGAGACTTGA) derived from the C. difficile 16S rRNA gene 112
according to the procedure previously described with slight modifications (13, 20). Briefly, 113
a single colony of C. difficile grown on GAM (Gifu Anaerobic Medium) agar (Nissui 114
Medical Co., Tokyo, Japan) was suspended in 100μl of TE (10mM Tris-HCl, 1mM EDTA 115
[pH8.0]). The composition of GAM agar is as follows: peptone, 1%; soya-bean peptone, 116
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
8/37
0.3%; proteose peptone, 1%; digested blood powder, 1.35%; yeast extract, 0.5%; meat 117
extract, 0.22%; liver extract powder, 0.12%; glucose, 0.3%; potassium dihydrogen 118
phosphate, 0.25%; sodium chloride, 0.3%; soluble starch, 0.5%; L-cysteine 119
monohydrochloride, 0.03%;sodium thioglycolate, 0.03%; and agar 1.5%; the pH was 7.1, 120
and the agar was sterilized at 115°C for 15 min. The suspension was boiled for 10 min and 121
centrifuged at 10,000 x g for 5 min. The resultant supernatant was used as template DNA. 122
123
PCR ribotyping 124
PCR ribotyping was performed by the method previously described with slight 125
modification, and primers CTGGGGTGAAGTCGTAACAAGG (positions 1445 to 1466 of 126
the 16S rRNA gene) and GCGCCCTTTGTAGCTTGACC (positions 20 to 1 of the 23S 127
rRNA gene) (18, 39). Briefly, the volume of PCR reaction mixture was downscaled to 50 128
μL and the amplified PCR products were concentrated to a final volume of approximately 129
10 μL followed by heating at 75˚C for 90 to 120 min before electrophoresis in 3% 130
Metaphor agarose (Lonza Rockland Inc., Basel, Switzerland) at a constant voltage of 120V 131
for 4h. Isolates with patterns differing by one or more bands were assigned to different PCR 132
ribotypes and the difference in faint bands was ignored. 133
134
Pulsed-field gel electrophoresis (PFGE) 135
PFGE analysis was performed by the method previously described with slight 136
modifications (6, 18, 19). One milliliter of C. difficile overnight culture was inoculated into 137
4mL of TYG medium and incubated at 37˚C for 5h in an anaerobic chamber (10% CO2, 138
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
9/37
10% H2 and N2 to balance), and an arbitrary volume of the culture was centrifuged at 5,000 139
x g for 5 min to obtain an appropriate size of pellet. The pellet was washed with 1mL of 140
TES buffer (50 mM Tris [pH 8.0], 5 mM EDTA, 50 mM NaCl) twice, embedded in an 141
agarose plug and incubated at 37˚C for 1h with lysozyme-lysostaphin followed by 142
incubation with proteinase K at 50˚C for 18h using a GenePath Group 1 Reagent Kit 143
(Bio-Rad Laboratories, Inc., CA, USA) according to the manufacturer’s instructions. DNA 144
in the plug was digested with SmaI for 18h at 25˚C. 145
Electrophoresis was performed with the CHEF Mapper system (Bio-Rad Laboratories, 146
Inc., CA, USA) and GenePath Gel Kit (Bio-Rad Laboratories, Inc., CA, USA) with 147
program 16 (6 V/cm, 120˚ angle, 5.3 to 49.9 sec switch time, non-linear ramp, 14˚C, 19.7 h 148
run time). In case that a smear band was obtained, the sample was subjected again to 149
electrophoresis by adding with tThiourea was added to a 1.0% agarose gel and running 150
buffer at a final concentration of 200 μM in case DNA degradation was observed to prevent 151
DNA degradation during electrophoresis (25). 152
DNA fragments were stained with ethidium bromide and photographed using the GelDoc 153
system (Bio-Rad Laboratories, Inc., CA, USA). Major PFGE types were defined by more 154
than three fragment differences and these major types were subtyped by three or fewer than 155
three fragment differences (43). Dendrogram analysis was carried out using Fingerprinting 156
II Software (Bio-Rad Laboratories, Inc., CA, USA). 157
Using the results of PFGE analysis, recurrent cases were divided into relapse cases and 158
re-infection cases. If the strain isolated at the time of recurrence was an identical PFGE 159
type to the initial strain, it was deigned to be a relapse case, but if different, it was regarded 160
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
10/37
as re-infection. 161
162
Toxin detection 163
The toxin type of C. difficile strains was analyzed by PCR as previously described (18, 164
20, 21). The template DNA was prepared by the boiling method described above. Two 165
primer sets, NK3 (GGAAGAAAAGAACTTCTGGCTCACTCAGGT) and NK2 166
(CCCAATAGAAGATTCAATATTAAGCTT), and NK11 167
(TGATGCTAATAATGAATCTAAAATGGTAAC) and NK9 168
(CCACCAGCTGCAGCCATA) were used for the detection of the toxin A gene, and primer 169
set NK104 (GTGTAGCAATGAAAGTCCAAGTTTACGC) and NK105 170
(CACTTAGCTCTTTGATTGCTGCACCT) was used for the toxin B gene. 171
172
Cytotoxicity assay 173
Cytotoxicity was determined by the method described by Kamiya et al. (15). Briefly, 174
African green monkey kidney (Vero) cells were grown in Eagle’s Minimum Essential 175
Medium (Sigma-Aldrich, Inc., MO, USA) supplemented with 8% fetal calf serum 176
(Sigma-Aldrich, Inc., MO, USA) in 96 well microplates, and the cell culture medium was 177
removed and replaced with 100 μL of fresh maintenance medium (Eagle’s MEM containing 178
0.5% calf serum) before assay. The culture supernatant of C. difficile in BHI broth 179
(incubated at 37˚C for 24h) was subjected to 2-fold serial dilution with maintenance 180
medium. The cell-culture medium was then removed and replaced with 100 μL of each 181
diluted sample. The cytotoxicity of the sample was determined as the highest dilution 182
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
11/37
resulting in a 100% cell rounding after incubation for 24h. 183
184
Antimicrobial susceptibility testing 185
Minimum inhibitory concentrations (MICs) of vancomycin, metronidazole, clindamycin, 186
ceftriaxone, erythromycin and ciprofloxacin were measured by Etest (AB Biodisk, Solna, 187
Sweden). A cotton swab dipped into a 1.0 McFarland standard-matched suspension of the 188
test isolate was used to inoculate a pre-reduced GAM agar plate. Etest strips and MIC value 189
measurements were performed according to the manufacturer’s instructions. Antibiotic 190
resistance was defined as follows, in accordance with the interpretative criteria described in 191
the manufacturer’s package insert and previous reports (1, 48): vancomycin ≥ 32 mg/L, 192
metronidazole ≥ 32 mg/L, clindamycin ≥ 8 mg/L, ceftriaxone ≥ 64 mg/L, erythromycin ≥ 8 193
mg/L and ciprofloxacin ≥ 4 mg/L. 194
195
Spore formation rate 196
Spore formation rate of C. difficile was determined by microscopic observation. A few 197
colonies of C. difficile grown on a GAM agar plate at 37˚C for 5 days were suspended in an 198
appropriate volume of sterile saline and the numbers of spores and vegetative cells were 199
counted under phase contrast microscopy using a bacteria-counting chamber. Spore 200
formation rate was calculated by the following formula: Spore formation rate (%) = 201
(Number of spores per mL / Number of total cells (spores and vegetative cells) per mL) x 202
100. 203
204
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
12/37
Germination rate 205
Germination rate of C. difficile was evaluated by the methods described previously (17, 206
31). To count the number of spores, a suspension of C. difficile cells was heated at 70˚C for 207
10 min to kill all the vegetative cells. The heat-treated suspension was then subjected to 208
10-fold serial dilution with sterile saline and inoculated onto GAM agar or Brain heart 209
infusion (BHI) agar (BD, NJ, USA) with or without supplementation of sodium 210
taurocholate (Wako Pure Chemical Industries, Ltd., Osaka, Japan). After incubation of the 211
plates at 37˚C for 48h in an anaerobic chamber, the colonies were counted and the 212
germination rate was calculated by the following formula: Germination rate (%) = (Colony 213
forming units (CFU) per mL / Microscopic counts of spores per mL) x 100. 214
215
Statistics 216
For the statistical comparison of spore formation rate and germination rate, 217
Tukey-Kramer’s test and Steel-Dwass’s test were used for parametric and non-parametric 218
data, respectively. Normality of a distribution and homogeneity of variances were evaluated 219
by chi-square goodness of fit test and Bartlett’s test.220
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
13/37
Results 221
Genotyping 222
We carried out PCR ribotyping and PFGE analysis to determine the infection status of 223
recurrent cases and to investigate the correlation between genotype, phenotype and 224
infection status. 225
All 73 strains were typable and resolved into 11 ribotypes (Fig. 1 and Table 1) and 12 226
major PFGE types (Fig. 2 and Table 1). Major ribotypes of C. difficile isolates were R2 (31 227
strains, 42.5%), R1 (14 strains, 19.2%) and R4 (13 strains, 17.8%). DNA degradation 228
during PFGE assay observed in some isolates completely resolved by addition of thiourea 229
at a final concentration of 200μM. Forty-nine strains were assigned to PFGE major type P1 230
(67.1%) and 11 strains were assigned to type P3 (15.1%), and these 2 types accounted for 231
more than 80% of the total (Table 1). Type P1 strains were recovered from 28 out of 40 232
patients (70.0%), and type P3 strains were recovered from 8 out of 40 (20.0%). 233
Among the 20 recurrent cases, 16 patients were regarded to be relapse cases caused by 234
the same strain (80.0%) and the remaining 4 patients to be re-infection cases caused by 235
different strains (20.0%) (Table 2). In the relapse cases, the major PFGE type and DNA 236
ribotype was P1 (12 strains, 75.0%, Table 2) and R2 (8 strains, 50.0%, data not shown). 237
There was no significant association between DNA typing group (PFGE type or PCR 238
ribotype) and incidence of recurrence. 239
240
Toxin type and Cytotoxicity 241
Among 73 strains used in the study, 67 strains were toxin A+, B+ (91.8%), 2 were toxin 242
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
14/37
A−, B+ (2.7%) and 4 were toxin A−, B− (5.4%) (Table 3). Toxin A+, B+ strains were 243
mainly categorized to types P1/R2, P3/R4 and P1/R1. In contrast, toxin A−, B+ and A−, B− 244
strains were categorized to type P8/R8 or P10/R8, and P5/R5 or P11/R10, respectively. 245
There was no correlation between toxin type and infection status (Table 3). Cytotoxicity 246
assay showed 13 strains (17.8%) were highly toxigenic (> 28 toxin titer) and 5 strains 247
(6.8%) had a low toxicity of 22 titer (data not shown). There was no significant relationship 248
between cytotoxicity of C. difficile isolates and DNA typing group (PFGE type and PCR 249
ribotype) except toxin A−, B− strains (type P5/R5 and P11/R10) showed no cytotoxic 250
activities. Similarly, no correlation between the cytotoxicity and the incidence of recurrence 251
was seen (data not shown). 252
253
Antibiotic susceptibility 254
MIC50, MIC90 and the range of MIC of vancomycin, metronidazole, clindamycin, 255
ceftriaxone, erythromycin and ciprofloxacin against the 73 C. difficile isolates are all shown 256
in Table 4. All isolates were susceptible to vancomycin and metronidazole. Resistance 257
against clindamycin, ceftriaxone, erythromycin and ciprofloxacin were found in 87.7%, 258
93.2%, 87.7% and 100% of the isolates tested, respectively. 259
C. difficile isolates with PFGE types P1, P3, P4, P8 and P10 showed high-level resistance 260
against clindamycin (MIC50 > 256 mg/L), ceftriaxone (MIC50 ≥ 128 mg/L), erythromycin 261
(MIC50 > 256 mg/L) and ciprofloxacin (MIC50 > 32 mg/L) (Table 5), as well as ribotypes 262
R1, R2, R3, R4 and R8 (data not shown). On the other hand, the susceptibility of C. difficile 263
isolates to vancomycin and/or metronidazole was neither related to the PFGE type (Table 264
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
15/37
5) nor PCR ribotype (data not shown). 265
There was no correlation observed between the antibiotic susceptibility of the C. difficile 266
isolates to the above antimicrobial drugs and recurrence (data not shown). 267
268
Germination and sporulation 269
Due to the high resistance of spores against antimicrobial agents, a high sporulation rate 270
would contribute to persistence of C. difficile in the intestinal tract after treatment with 271
CDAD antibiotics. It is also likely that a high germination rate would give C. difficile a 272
growth advantage after the withdrawal of antibiotics and before restoration of normal gut 273
microbiota. For these reasons, we proposed that germination and/or sporulation rates of C. 274
difficile may be related to recurrence ability. 275
From preliminary experiments testing a variety of media and agar types, we chose the 276
GAM agar plate as testing medium for spore formation rate, as it yielded the highest 277
number of spores (data not shown). To determine the germination rate, GAM agar plates 278
with or without the C. difficile germination stimulant sodium taurocholate were used. 279
Mean spore formation rate of the 73 C. difficile isolates after 5 days was 32% (range, 280
<1.0 to 89%) and sporulation ability was not related to PFGE type (Fig. 3A). Similarly, 281
there was no significant correlation between sporulation ability and PCR ribotype (data not 282
shown) or recurrence (Fig. 4A). 283
Mean germination rate of the 73 isolates on GAM agar was 0.24% (range, 0.00094 to 284
3.1%) and the germination rate was elevated about 10 to 50,000 fold when supplemented 285
with sodium taurocholate (mean, 42.7% range, 5.7 to 103.7%) (Fig. 3B, C). The 286
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
16/37
germination rate of the isolates either in the presence or absence of sodium taurocholate 287
was not related to PFGE type (Fig. 3B, C) or PCR ribotype (data not shown). However, the 288
germination rate of strains isolated from relapse cases was significantly higher than those of 289
single and re-infection cases when sodium taurocholate was not added (Fig.4B), though this 290
was not observed with sodium taurocholate (Fig. 4C). This observation on germination rate 291
was reproducible and a similar result was obtained when GAM agar was replaced by BHI 292
agar (Fig. S1).293
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
17/37
Discussion 294
In this study, 73 clinical isolates of C. difficile were analyzed by PFGE and PCR 295
ribotyping to determine infection status and to relate this to microbiological characteristics. 296
PFGE and PCR ribotyping are popular methods of genetic characterization worldwide, and 297
have been found to correlate well (7, 14, 35). We categorized the 73 strains into 12 major 298
PFGE types (type P1 was further categorized into 7 subtypes) and 11 PCR ribotypes. A 299
good correlation between PFGE and PCR ribotyping was observed, and as previously 300
reported, PFGE was able to discriminate strains more accurately than PCR ribotyping (7). 301
PFGE and PCR ribotyping showed that 16 out of 20 recurrent CDAD patients (80.0%) 302
were relapse cases caused by the same strains. This relapse rate was high compared with 303
previous reports observing rates of 25 to 87.5% (the remaining suffering re-infection or a 304
combination of relapse plus re-infection) (2, 4, 9, 32, 41, 45). Although some relapse cases 305
may include re-infection from the original strain in the patient’s environment, some may 306
occur through persistence of the original C. difficile isolate in the intestinal tract despite 307
antibiotic treatment (2, 9, 41). In such cases, recurrence may occur more frequently with 308
strains that have advantageous phenotypic characteristics for intestinal survival. 309
Most pathogenic C. difficile strains produce the two large clostridial glucosylating toxins 310
A and B, and these toxins are the main virulence factors in CDAD (26, 35). Previously, it 311
was thought that toxin A was the only toxin essential for the pathogenesis of CDAD, and 312
early experiments in animal models showed that sole administration of toxin A caused 313
symptoms of CDAD, but administration of toxin B without toxin A had no effect (10, 27, 314
35). However, recent studies report outbreaks caused by A−/B+ strains and therefore 315
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
18/37
conclude that toxin B also plays an important role in the virulence of C. difficile (10, 26, 316
27). Toxin A−/B+ strains have been isolated in many countries with a prevalence of 0 to 317
97.9% and recently seem to be on the increase (10, 23). In this study, only 2 out of 73 318
isolates (2.7%) were A−/B+ strains and their DNA genotypes were P8/R8 and P10/R8. 319
Although it is not clear why the prevalence of A−/B+ strains was relatively low, it may be 320
associated with the fact that C. difficile strains isolated from recurrent CDAD cases made 321
up the majority of the isolates used in this study. 322
It is known that certain DNA typing groups are hyper-virulent, such as the C. difficile 323
BI/NAP1/027 strain (28, 35). However, no correlation between the cytotoxicity and PFGE 324
or PCR ribotype were observed in this study. Therefore, virulence determinants may be 325
independent of DNA typing group. 326
It is important to determine the current resistance status of C. difficile and to find out the 327
correlation between the DNA type and antimicrobial susceptibilities. We found that all of 328
the isolates were susceptible to vancomycin and metronidazole, and high resistance rates 329
were also observed against other antibiotics, such as clindamycin (87.7%), ceftriaxone 330
(93.2%), erythromycin (87.7%) and ciprofloxacin (100%). The resistance rates of C. 331
difficile isolates against these antibiotics in Europe and Korea have been shown to be 332
similar to the results in this study (23, 30, 33) and high susceptibility of C. difficile isolates 333
to vancomycin and metronidazole has been reported by many researchers (1, 23, 30, 33). 334
Isolates with PFGE types P1, P3, P4, P8 and P10 and PCR ribotypes R1, R2, R3, R4 and 335
R8 showed high-level resistance against clindamycin, ceftriaxone, erythromycin and 336
ciprofloxacin. Although our DNA typing data cannot be compared with other reports, these 337
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
19/37
results indicate that antibiotic selection pressure may cause the selection of certain 338
dominant DNA typing groups as reported by Taori et al. (42). 339
From the results of epidemiological studies on the antimicrobial susceptibilities of C. 340
difficile isolates, it is well known that oral antibiotics such as the commonly used 341
vancomycin or metronidazole are the most efficacious for the treatment of CDAD. 342
However, approximately 20% of patients suffer a recurrence of CDAD following cessation 343
of antibiotic treatment. Recurrences usually occur within 5 to 8 days after withdrawal of 344
antibiotics, but their onset can be delayed for several weeks. Recurrence of CDAD is a 345
serious and difficult clinical problem in terms of prolongation of the duration of 346
hospitalization and increasing treatment costs (4, 36, 40). 347
PFGE type P1 and PCR ribotype R2 strains were most frequently found in single and 348
relapse cases. However, there was no correlation between DNA typing groups and infection 349
status, indicating that the incidence of recurrence does not depend on the DNA type of 350
isolates in cases treated with vancomycin or metronidazole. No correlation between the 351
susceptibility of isolates against these antibiotics and DNA typing group was observed. 352
We postulated that the sporulation and germination abilities of C. difficile are likely to be 353
related to the incidence of relapse after treatment with antibiotics due to increased 354
persistence in the intestinal tract and rapid growth prior to restoration of the normal 355
intestinal flora. Indeed, it has been reported that epidemic strains of C. difficile produced 356
more spores than the non-prevalent strains, and sporulation rate was increased by exposure 357
to cleaning agent or germicide (11, 44). 358
We found no correlation between either sporulation or germination rate with PFGE type, 359
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
20/37
PCR ribotype or infection status. However, the isolates recovered from relapse cases 360
showed a significantly higher germination rate when incubated on GAM agar plates 361
without sodium taurocholate, though this difference was not observed when taurocholate 362
was present. Sodium taurocholate is known to stimulate germination of C. difficile spores 363
(38, 46, 47), and the presence of a putative receptor for taurocholate has been recently 364
reported (34). Compared to the isolates recovered from single or re-infection cases, relapse 365
strains may be more sensitive to co-germinants other than taurocholate in the test medium, 366
or may have an atypical spore coat structure which facilitates germination. 367
According to Ramirez et al. (34), it is thought that the concentration of active 368
taurocholate in the lower intestine is negligible due to deconjugation by the intestinal flora 369
into taurin and cholate, and that depletion of flora by strong antibiotic therapy may increase 370
the concentration of active taurocholate. Therefore, a high germination ability in the 371
absence of co-germinants such as taurocholate may contribute to the increased re-infection 372
rates observed in these CDAD cases. Further work may be required to investigate the 373
effects of other co-germinants and intestinal concentrations of these chemicals during the 374
first infective episode and recurrence, but our results suggest that the germination ability of 375
C. difficile strains may be a potential risk factor for the recurrence of CDAD. 376
377
Acknowledgements 378
We thank Ms MW Njoroge and Dr CC Bii, Kenya Medical Research Institute, Nairobi, 379
Kenya, for technical assistance.380
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
21/37
References 381
1. Ackermann, G., A. Degner, H. Cohen, J. Silva, Jr., and A. C. Rodloff. 2003. 382
Prevalence and association of macrolide-lincosamide-streptogramin B (MLSB) 383
resistance with resistance to moxifloxacin in Clostridium difficile. J. Antimicrob. 384
Chemother. 51:599-603. 385
2. Alonso, R., S. Gros, T. Peláez, D. García-de-Viedma, M. Rodríguez-Créixems, and 386
E. Bouza. 2001. Molecular analysis of relapse vs re-infection in HIV-positive patients 387
suffering from recurrent Clostridium difficile associated diarrhoea. J. Hosp. Infect. 2001. 388
48:86-92. 389
3. Baines, S. D., R. O'Connor, K. Saxton, J. Freeman, and M. H. Wilcox. 2008. 390
Activity of vancomycin against epidemic Clostridium difficile strains in a human gut 391
model. J. Antimicrob. Chemother. 63:520-525. 392
4. Barbut, F., A. Richard, K. Hamadi, V. Chomette, B. Burghoffer, and J. C. Petit. 393
2000. Epidemiology of recurrences or reinfections of Clostridium difficile-associated 394
diarrhea. J. Clin. Microbiol. 38:2386-2388. 395
5. Bartlett, J. G., T. W. Chang, M. Gurwith, S. L. Gorbach, and A. B. Onderdonk. 396
Antibiotic-associated pseudomembranous colitis due to toxin-producing clostridia. N. 397
Engl. J. Med. 298:531-534. 398
6. Bidet, P., V. Lalande, B. Salauze, B. Burghoffer, V. Avesani, M. Delmee, A. Rossier, 399
F. Barbut, and J. C. Petit. 2000. Comparison of PCR-ribotyping, arbitrarily primed 400
PCR, and pulsed-field gel electrophoresis for typing Clostridium difficile. J. Clin. 401
Microbiol. 38:2484-2487. 402
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
22/37
7. Brazier, JS. 2001. Typing of Clostridium difficile. Clin. Microbiol. Infect. 7:428-431. 403
8. Choi, H. K., K. H. Kim, S. H. Lee, and S. J. Lee. 2011. Risk Factors for Recurrence 404
of Clostridium difficile Infection: Effect of Vancomycin-resistant Enterococci 405
Colonization. J. Korean Med. Sci. 26:859-864. 406
9. Do, A. N., S. K. Fridkin, A. Yechouron, S. N. Banerjee, G. E. Killgore, A. M. 407
Bourgault, M. Jolivet, and W. R. Jarvis. 1998. Risk factors for early recurrent 408
Clostridium difficile-associated diarrhea. Clin. Infect. Dis. 26:954-959. 409
10. Drudy, D, S. Fanning, and L. Kyne. 2007. Toxin A-negative, toxin B-positive 410
Clostridium difficile. Int. J. Infect. Dis. 11:5-10. 411
11. Fawley, W. N., S. Underwood, J. Freeman, S. D. Baines, K. Saxton, K. Stephenson, 412
R. C. Owens, Jr, and M. H. Wilcox. 2007. Efficacy of hospital cleaning agents and 413
germicides against epidemic Clostridium difficile strains. Infect. Control Hosp. 414
Epidemiol. 28:920-925. 415
12. Garey, K. W., S. Sethi, Y. Yadav, and H. L. DuPont. 2008. Meta-analysis to assess 416
risk factors for recurrent Clostridium difficile infection. J. Hosp. Infect. 70:298-304 417
13. Gumerlock, P. H., Y. J. Tang, F. J. Meyers, and J. Silva, Jr. 1991. Use of the 418
polymerase chain reaction for the specific and direct detection of Clostridium difficile in 419
human feces. Rev. Infect. Dis. 13:1053-1060. 420
14. Janezic, S, and M. Rupnik. 2010. Molecular typing methods for Clostridium difficile: 421
pulsed-field gel electrophoresis and PCR ribotyping. Methods. Mol. Biol. 646:55-65. 422
15. Kamiya, S., and S. P. Borriello. 1992. A non-haemagglutinating form of Clostridium 423
difficile toxin A. J. Med. Microbiol. 36:190-197. 424
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
23/37
16. Kamiya, S, H. Ogura, X. Q. Meng, and S. Nakamura. 1992. Correlation between 425
cytotoxin production and sporulation in Clostridium difficile. J. Med. Microbiol. 426
37:206-210. 427
17. Kamiya S, K. Yamakawa, H. Ogura, and S. Nakamura. 1987. Effect of various 428
sodium taurocholate preparations on the recovery of Clostridium difficile spores. 429
Microbiol. Immunol. 31:1117-1120. 430
18. Kato, H., H. Kita, T. Karasawa, T. Maegawa, Y. Koino, H. Takakuwa, T. Saikai, K. 431
Kobayashi, T. Yamagishi, and S. Nakamura. 2001. Colonisation and transmission of 432
Clostridium difficile in healthy individuals examined by PCR ribotyping and 433
pulsed-field gel electrophoresis. J. Med. Microbiol. 50:720-727. 434
19. Kato, H., N. Kato, K. Watanabe, K. Ueno, H. Ushijima, S. Hashira, and T. Abe. 435
1994. Application of typing by pulsed-field gel electrophoresis to the study of 436
Clostridium difficile in a neonatal intensive care unit. J. Clin. Microbiol. 32:2067-2070. 437
20. Kato, H., N. Kato, K. Watanabe, N. Iwai, H. Nakamura, T. Yamamoto, K. Suzuki, 438
S. M. Kim, Y. Chong, and E. B. Wasito. 1998. Identification of toxin A-negative, 439
toxin B-positive Clostridium difficile by PCR. J. Clin. Microbiol. 36:2178-2182. 440
21. Kato, N., C.-Y. Ou, H. Kato, S. L. Bartley, V. K. Brown, V. R. Dowell, and L. Ueno. 441
1991. Identification of toxigenic Clostridium difficile by the polymerase chain reaction. 442
J. Clin. Microbiol. 29:33-37. 443
22. Kelly, C. P., C. Pothoulakis, and J. T. LaMont. 1994. Clostridium difficile colitis. N. 444
Engl. J. Med. 330:257-262. 445
23. Kim, H, S. H. Jeong, K. H. Roh, S. G. Hong, J. W. Kim, M. G. Shin, M. N. Kim, H. 446
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
24/37
B. Shin, Y. Uh, H. Lee, and K. Lee. 2010. Investigation of toxin gene diversity, 447
molecular epidemiology, and antimicrobial resistance of Clostridium difficile isolated 448
from 12 hospitals in South Korea. Korean J. Lab. Med. 30:491-497. 449
24. Kim, J. W., K. L. Lee, J. B. Jeong, B. G. Kim, S. Shin, J. S. Kim, H. C. Jung, and I. 450
S. Song. 2010. Proton pump inhibitors as a risk factor for recurrence of 451
Clostridium-difficile-associated diarrhea. World J. Gastroenterol. 16:3573-3577. 452
25. Klaassen, C. H., H. A. van Haren, and A. M. Horrevorts. 2002. Molecular 453
fingerprinting of Clostridium difficile isolates: pulsed-field gel electrophoresis versus 454
amplified fragment length polymorphism. J. Clin. Microbiol. 40:101-104. 455
26. Kuehne, S. A., S. T. Cartman, J. T. Heap, M. L. Kelly, A. Cockayne, and N. P. 456
Minton. 2010. The role of toxin A and toxin B in Clostridium difficile infection. Nature. 457
467:711-713. 458
27. Lyras, D, J. R. O'Connor, P. M. Howarth, S. P. Sambol, G. P. Carter, T. 459
Phumoonna, R. Poon, V. Adams, G. Vedantam, S. Johnson, D. N. Gerding, and J. I. 460
Rood. 2009. Toxin B is essential for virulence of Clostridium difficile. Nature. 461
458:1176-1179. 462
28. McDonald, L. C., G. E. Killgore, A. Thompson, R. C. Owens, Jr, S. V. Kazakova, S. 463
P. Sambol, S. Johnson, and D. N. Gerding. 2005. An epidemic, toxin gene-variant 464
strain of Clostridium difficile. N. Engl. J. Med. 353:2433-2441. 465
29. McFarland, L. V., G. W. Elmer, and C. M. Surawicz. 2002. Breaking the cycle: 466
treatment strategies for 163 cases of recurrent Clostridium difficile disease. Am. J. 467
Gastroenterol. 97:1769-1775. 468
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
25/37
30. Mutlu, E, A. J. Wroe, K. Sanchez-Hurtado, J. S. Brazier, and I. R. Poxton. 2007. 469
Molecular characterization and antimicrobial susceptibility patterns of Clostridium 470
difficile strains isolated from hospitals in south-east Scotland. J. Med. Microbiol. 471
56:921-929. 472
31. Nakamura, S, K. Yamakawa, J. Izumi, S. Nakashio, and S. Nishida. 1985. 473
Germinability and heat resistance of spores of Clostridium difficile strains. Microbiol. 474
Immunol. 29:113-118. 475
32. O'Neill, G. L., M. H. Beaman, and T. V. Riley. 1991. Relapse versus reinfection with 476
Clostridium difficile. Epidemiol. Infect. 107:627-635. 477
33. Pituch, H, P. Obuch-Woszczatynski, D, Wultanska, G. Nurzynska, C. Harmanus, A. 478
Banaszkiewicz, A. Radzikowski, M. Luczak, A. van Belkum, and E. Kuijper. 2011. 479
Characterization and antimicrobial susceptibility of Clostridium difficile strains isolated 480
from adult patients with diarrhoea hospitalized in two university hospitals in Poland, 481
2004-2006. J. Med. Microbiol. 60:1200-1205. 482
34. Ramirez, N, M. Liggins, and E. Abel-Santos. 2010. Kinetic evidence for the presence 483
of putative germination receptors in Clostridium difficile spores. J. Bacteriol. 484
192:4215-4222. 485
35. Rupnik, M, M. H. Wilcox, and D. N. Gerding. 2009. Clostridium difficile infection: 486
new developments in epidemiology and pathogenesis. Nat. Rev. Microbiol. 7:526-536. 487
36. Shah, D, M. D. Dang, R. Hasbun, H. L. Koo, Z. D. Jiang, H. L. DuPont, and K. W. 488
Garey. 2010. Clostridium difficile infection: update on emerging antibiotic treatment 489
options and antibiotic resistance. Expert. Rev. Anti. Infect. Ther. 8:555-564. 490
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
26/37
37. Shakov, R, R. S. Salazar, S. K. Kagunye, W. J. Baddoura, and V. A. DeBari. 2011. 491
Diabetes mellitus as a risk factor for recurrence of Clostridium difficile infection in the 492
acute care hospital setting. Am. J. Infect. Control. 39:194-198. 493
38. Sorg, J. A., and A. L. Sonenshein. 2008. Bile salts and glycine as cogerminants for 494
Clostridium difficile spores. J. Bacteriol. 190:2505-2512. 495
39. Stubbs, S. L., J. S. Brazier, G. L. O'Neill, and B. I. Duerden. 1999. PCR targeted to 496
the 16S-23S rRNA gene intergenic spacer region of Clostridium difficile and 497
construction of a library consisting of 116 different PCR ribotypes. J. Clin. Microbiol. 498
37:461-463. 499
40. Surawicz, C. M. 2004. Treatment of recurrent Clostridium difficile-associated disease. 500
Nat. Clin. Pract. Gastroenterol. Hepatol. 1:32-38. 501
41. Tang-Feldman, Y., S. Mayo, J. Silva, Jr., and S. H. Cohen. 2003. Molecular analysis 502
of Clostridium difficile strains isolated from 18 cases of recurrent Clostridium 503
difficile-associated diarrhea. J. Clin. Microbiol. 41:3413-3414. 504
42. Taori, S. K., V. Hall, and I. R. Poxton. 2010. Changes in antibiotic susceptibility and 505
ribotypes in Clostridium difficile isolates from southern Scotland, 1979-2004. J. Med. 506
Microbiol. 59:338-344. 507
43. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. 508
Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction 509
patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. 510
J. Clin. Microbiol. 33:2233-2239. 511
44. Wilcox, M. H., and W. N. Fawley. 2000. Hospital disinfectants and spore formation by 512
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
27/37
Clostridium difficile. Lancet. 14:1324. 513
45. Wilcox, M. H. , W. N. Fawley, C. D. Settle, and A. Davidson. 1998. Recurrence of 514
symptoms in Clostridium difficile infection--relapse or reinfection? J. Hosp. Infect. 515
38:93-100. 516
46. Wilson, K. H. 1983. Efficiency of various bile salt preparations for stimulation of 517
Clostridium difficile spore germination. J. Clin. Microbiol. 18:1017-1019. 518
47. Wilson, K. H., M. J. Kennedy, and F. R. Fekety. 1982. Use of sodium taurocholate to 519
enhance spore recovery on a medium selective for Clostridium difficile. J. Clin. 520
Microbiol. 15:443-446. 521
48. Wultańska, D, A. Banaszkiewicz, A. Radzikowski, P. Obuch-Woszczatyński, G. 522
Młynarczyk, J. S. Brazier, H. Pituch, and A. van Belkum. 2010. Clostridium difficile 523
infection in Polish pediatric outpatients with inflammatory bowel disease. Eur. J. Clin. 524
Microbiol. Infect. Dis. 29:1265-1270. 525
526
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
28/37
Legends to the Figures 527
Fig. 1. PCR ribotype patterns of C. difficile isolates. Lanes R1 to R11 show the 528
representative pattern of each ribotype. Lane M and n. c. show 50bp size markers and 529
negative control, respectively. 530
531
Fig. 2. Dendrogram and PFGE patterns of C. difficile isolates. Lanes P1a to P12 show the 532
representative pattern of each PFGE type. M shows the Lambda ladder size marker. The 533
dendrogram was constructed with Fingerprinting II Software (Bio-Rad laboratories, Inc). 534
535
Fig. 3. Spore formation rate (A), germination rate on GAM agar without sodium 536
taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 537
taurocholate (C) of C.difficile isolates compared to PFGE subtype. 538
539
Fig. 4. Spore formation rate (A), germination rate on GAM agar without sodium 540
taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 541
taurocholate (C) of C.difficile isolates compared to infection status. S (n=20), Rl (n=43) and 542
Ri (n=10) indicate the isolates from single, relapse and re-infection cases, respectively. Bars 543
represent mean ± S.D. Asterisk denotes statistical significance (p < 0.05).544
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
29/37
Table 1. Typing of C. difficile isolates. 545
546
PFGE PCR
ribotype
Toxin
producing
type
No. of C. difficile isolates (No. of
patients)
Major
type Subtype TMGa KYb
P1 a R1 A+, B+
7 (5)
5 (3)
42 (23)
b R2 A+, B+ 1 (1) 20 (8)
R3 A+, B+ 3 (1)
c R1 A+, B+ 9e, f (7)
R2 A+, B+ 1c (1) 2 (2)
d R2 A+, B+ 2 (1)
e R2 A+, B+ 2 (1)
f R2 A+, B+ 3d (2)
g R3 A+, B+ 1 (1)
P2 R4 A+, B+ 1 (1)
P3 R4 A+, B+ 11d, f (8)
P4 R4 A+, B+ 1c (1)
P5 R5 A−, B− 3 (1)
P6 R6 A+, B+ 1 (1)
P7 R7 A+, B+ 1 (1)
P8 R8 A−, B+ 1 (1)
P9 R9 A+, B+ 1c (1)
P10 R8 A−, B+ 1e (1)
P11 R10 A−, B− 1 (1)
P12 R11 A+, B+ 2 (1) a Tokyo Metropolitan Geriatric Hospital. 547 b Kyorin University Hospital. 548 c, d, e, f Different strains were isolated from one patient.549
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
30/37
Table 2. Major PFGE type and the number of patients with single infection, relapse and 550 re-infection. 551 552
Major PFGE
type
Single
infection Relapse Re-infection* Total
P1 11 12 4 27
P2 1 0 0 1
P3 4 2 2 8
P4 0 0 1 1
P5 0 1 0 1
P6 1 0 0 1
P7 1 0 0 1
P8 1 0 0 1
P9 0 0 1 1
P10 0 0 1 1
P11 1 0 0 1
P12 0 1 0 1
Total 20 (20) 16 (16) 9 (4) 45 (40)
* : Cumulative number of patients. 553 ( ): Actual number of patients.554
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
31/37
Table 3. Toxin type of C. difficile clinical isolates compared to infection status. 555 556
Toxin type
Number of C. difficile isolates (%)
Single
infection Relapse Re-infection Total
A +, B + 18 (90.0) 40 (93.0) 9 (90.0) 67 (91.8)
A −, B + 1 (5.0) 0 (0.0) 1 (10.0) 2 (2.7)
A −, B − 1 (5.0) 3 (7.0) 0 (0.0) 4 (5.5)
Total 20 (100) 43 (100) 10 (100) 73 (100)
557
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
32/37
Table 4. Antibiotic susceptibility of C. difficile clinical isolates. 558 559
Antibiotic
MICs (mg/L) No. of
resistant
isolates
(n=73) MIC50 MIC90 Range Breakpoint
Vancomycin 2 4 1 – 8 ≥ 32 0 (0%)
Metronidazole 0.19 0.25 0.094 – 0.25 ≥ 32 0 (0%)
Clindamycin >256 >256 1 – >256 ≥ 8 64 (87.7%)
Ceftriaxone >256 >256 32 – >256 ≥ 64 68 (93.2%)
Erythromycin >256 >256 0.38 – >256 ≥ 8 64 (87.7%)
Ciprofloxacin >32 >32 6 – >32 ≥ 4 73 (100%)
560
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
33/37
Table 5. Comparison of antibiotic susceptibility with PFGE subtype. 561 562
PFGE
type
MIC50 (mg/L)
Vancomycin Metronidazole Clindamycin Ceftriaxone Erythromycin Ciprofloxacin
P1a 1.5 0.19 >256 >256 >256 >32
P1b 3 0.19 >256 >256 >256 >32
P1c 3 0.125 >256 >256 >256 >32
P1d 2 0.125 >256 >256 >256 >32
P1e 2 0.19 >256 >256 >256 >32
P1f 1.5 0.19 >256 >256 >256 >32
P1g 2 0.19 >256 >256 >256 >32
P2 1.5 0.19 2 48 0.5 6
P3 1.5 0.19 >256 >256 >256 >32
P4 2 0.19 >256 128 >256 >32
P5 2 0.25 1.5 96 0.5 12
P6 3 0.125 4 64 0.5 8
P7 1.5 0.19 2 32 0.38 6
P8 1.5 0.25 >256 192 >256 >32
P9 1.5 0.19 3 32 0.38 8
P10 1.5 0.25 >256 >256 >256 >32
P11 3 0.19 >256 64 >256 8
P12 1.5 0.125 1 32 0.38 6
563
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
34/37
Fig. 1. PCR ribotype patterns of C. difficile isolates. Lanes R1 to R11 show the 564
representative pattern of each ribotype. Lane M and n. c. show 50bp size markers and 565
negative control, respectively. 566
567
568 569
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
35/37
Fig. 2. Dendrogram and PFGE patterns of C. difficile isolates. Lanes P1a to P12 show the 570
representative pattern of each PFGE type. M shows the Lambda ladder size marker. The 571
dendrogram was constructed with Fingerprinting II Software (Bio-Rad laboratories, Inc). 572
573
574
575
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
36/37
Fig. 3. Spore formation rate (A), germination rate on GAM agar without sodium 576 taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 577 taurocholate (C) of C. difficile isolates compared to PFGE subtype. 578 579
580 581
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
37/37
Fig. 4. Spore formation rate (A), germination rate on GAM agar without sodium 582 taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 583 taurocholate (C) of C. difficile isolates compared to infection status. S (n=20), Rl (n=43) 584 and Ri (n=10) indicate the isolates from single, relapse and re-infection cases, respectively. 585 Bars represent mean ± S.D. Asterisk denotes statistical significance (p < 0.05). 586 587
588
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
700bp
600
500450400350
300
250
M R1 R2 R3 R4 R5 R6 M R7 R8 R9 R10 R11 n.c. M
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
776.0kb
727.5679.0630.5582.0533.5485.0436.5388.0339.5291.0242.5
194.0
145.5
97.0
48.5
M P1a P1b P1c P1d P1e P1f P1g P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 M
60
80
100
Sim
ilarity (%)
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
0
20
40
60
80
100
%
0
20
40
60
80
100
120
%
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
%
P1a 1c 1e 1g 3 5 7 9 111b 1d 1f 2 4 6 8 10 12
P1a 1c 1e 1g 3 5 7 9 111b 1d 1f 2 4 6 8 10 12
P1a 1c 1e 1g 3 5 7 9 111b 1d 1f 2 4 6 8 10 12
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
0
20
40
60
80
100
%
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
%
0
20
40
60
80
100
120
%
on February 16, 2020 by guest
http://jcm.asm
.org/D
ownloaded from