ORF36 Protein Kinase of Kaposi’s Sarcoma Herpesvirus (KSHV) Activates the c-Jun N-

terminal Kinase (JNK) Signaling Pathway

M. Sabry Hamza1, Richard A. Reyes1, Yoshihiro Izumiya2, Ronald Wisdom3, Hsing-Jien

Kung2 and Paul A. Luciw1,4

1Center for Comparative Medicine, 2Department of Biological Chemistry and Cancer Center,

3Division of Hematology and Oncology, and 4Department of Pathology, University of California,

Davis, CA 95616

Running title: KSHV ORF36 binds and activates JNK

Correspondence footnote:

Paul A. Luciw

Center for Comparative Medicine, University of California

Davis, CA 95616

Telephone: 530-752-3430

1

JBC Papers in Press. Published on July 5, 2004 as Manuscript M400964200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

E-mail: paluciw@ucdavis.edu

Fax: 530-752-7914

2

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

ABSTRACT

Alpha-, beta- and gamma-herpesviruses encode putative viral protein kinases. The HSV

UL13, VZV ORF 47, and EBV BGLF4 genes all show protein kinase domains in their protein

sequences. Mutational analysis of these herpesviruses demonstrated that the viral kinase is

important for optimal virus growth. Previous studies showed that ORF36 of Kaposi’s sarcoma

herpesvirus (KSHV) has protein kinase activity and is autophosphorylated on serine. The gene

for ORF36 is expressed during lytic growth of the virus and has been classified a late gene.

Inspection of the ORF36 sequence indicated potential motifs that could be involved in activation

of cellular transcription factors. To analyze the function of ORF36, the cDNA for this viral gene

was tagged with the FLAG epitope and inserted into an expression vector for mammalian cells.

Transfection experiments, in 293T and SLK cells demonstrated that expression of ORF36

resulted in phosphorylation of the c-Jun N-terminal kinase. Autophosphorylation of ORF36 is

important for JNK activation because a mutation in the predicted catalytic domain of ORF36

blocked its ability to phosphorylate JNK. Western blot analysis, using phospho-specific

antibodies, revealed that mitogen activated kinases, MKK4 and MKK7, were phosphorylated by

ORF36, but not by the kinase-negative mutant. Binding experiments in transfected cells also

demonstrated that both the wild type and kinase-negative mutant of ORF36 form a complex with

JNK, MKK4 and MKK7. In addition, using a tetracycline inducible Rta BCBL-1 cell line

(TREx BCBL1-Rta), JNK was phosphorylated during lytic replication, and inhibition of JNK

3

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

activation blocked late viral gene expression but not early viral gene expression. In summary,

these studies demonstrate that KSHV ORF36 activates the JNK pathway; thus this cell signaling

pathway may function in the KSHV life cycle by regulating viral and/or cellular transcription.

4

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

INTRODUCTION

Based on molecular and biological properties, the herpesviridae family has been

subdivided into the alpha-herpesvirus (herpes simplex virus, varicella-zoster virus), beta-

herpesvirus (human cytomegalovirus), and gamma-herpesvirus (Epstein-Barr virus, EBV;

Kaposi’s sarcoma associated herpesvirus, KSHV) subfamilies (1). These double-stranded DNA

viruses can remain latent and persist as an episome, expressing a limited number of viral genes,

and thereby establish a lifelong infection in the natural host. Immunosupression or stress can lead

to reactivation of latent virus to produce pathogenic manifestations; examples include, Burkitt’s

lymphoma, nasopharyngeal carcinoma and Hodgkin’s disease associated with EBV (reviewed in

(2)), and Kaposi’s sarcoma, primary effusion lymphomas and multicentric Castleman’s disease

associated with KSHV (reviewed in (3,4)). Reactivation of these latent herpesviruses leads to

sequentially regulated expression of viral genes that play an essential role in the replication and

assembly of infectious virions (2-4) .

During the lytic cycle of infection, herpesviruses express genes which are predicted to

encode protein kinases (reviewed in (5)). These protein kinases are conserved among the

herpesviridae family, and analysis of the amino acid sequence reveals motifs that are shared by

mammalian serine/threonine protein kinases. Located within the catalytic region of these viral

proteins are eleven conserved subdomains that are common to cellular protein kinases. Recent

studies revealed that mutation of a conserved lysine residue within subdomain II abolishes

phosphorylation; this finding shows that this region is necessary for the catalytic activity of these

5

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

protein kinases (6,7). The protein kinases of herpesviruses appear to mimic the function of

cellular protein kinases, including cdc2 and cellular translational factor, EF-1delta, by

phosphorylating the same amino acid residues on their cognate protein targets (5,8).

Furthermore, the viral protein kinases are associated with the virion and may promote

dissociation and entry of the virus particle by phosphorylating the viral tegument proteins (9-

12).

The importance of herpesvirus protein kinases for viral replication and disease has been

investigated. Kinase-null mutants generated in alpha-, beta- and gamma- herpesviruses

demonstrate decreased replication in tissue culture (13-15). Decreased virulence of HSV and

VZV kinase-null mutants has been shown in the mouse model (16-18). However, the protein

kinase of VZV appears to be dispensable for the establishment of latency in rodent models

(14,18).

Studies on cells productively infected with alpha-, beta-, and gamma-herpesviruses

have demonstrated that various members of the stress kinase pathway are activated. HSV

activates JNK, p38, and Ap1 (19-21); CMV activates p38 and JNK(22); and VZV activates

AP1, Jun, Fos, and ATF2 (23). For EBV, the latent membrane protein, LMP2A, regulates c-Jun

through an extracellular signal-regulated kinase (24), and the immediate-early proteins of EBV,

BZLF1 and BRLF1, activate ATF2, p38 and JNK (25). Recent studies have demonstrated the

K15 membrane protein of KSHV activates the mitogen-activated protein kinase and NF-kappaB

pathways (26). However, the role of the viral protein kinase in activating the stress kinase

6

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

pathway for these herpesviruses remains to be determined.

In KSHV, ORF36 encodes a serine protein kinase, which is localized in the nucleus of

infected cells. In vitro kinase assays indicated that this viral protein was autophosphorylated, and

the lysine residue in the kinase subdomain II was essential for protein kinase activity (27).

Conservation of the viral protein kinases amongst the herpesviridae family implies that these

enzymes are indispensable for herpesvirus survival. Based on transcriptional kinetics and

sensitivity to DNA replication inhibitors, ORF36 was classified as a late gene (27,28).

Reactivation of KSHV in BCBL-1 cells (B-lymphocytes latently infected with KSHV) induced

transcription of the viral protein kinase (27). Understanding the cellular events that are regulated

by the KSHV protein kinase may provide a basis for defining molecular mechanisms that control

viral gene expression. Our studies demonstrate the ability of KSHV ORF36 to activate the JNK

pathway and the cellular transcription factor, c-Jun, and inhibtion of JNK activation resulted in

the inhibition of late KSHV viral gene expression.

7

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

EXPERIMENTAL PROCEDURES

Antibodies- Phospho-specific antibodies for SEK1/MKK4 (Thr 261), MKK7 (Ser 271/Thr 275),

SAPK/JNK (Thr 183/Tyr 185), ATF-2 (Thr 71), c-Jun (Ser 63), CREB (Ser 133), Elk-1 (Ser

383), and p38 MAP Kinase (Thr 180/Tyr 182) were obtained from Cell Signaling Technology

(Beverly, MA). Rabbit anti-phosphothreonine and phosphoserine were obtained from Zymed

Laboratories (South San Francisco, CA). MEK-4 (C-20), MEK-7 (H-160), JNK1 (FL), C-Jun

(N), c-Myc, and tubulin (H-300) were obtained from Santa Cruz Biotechnology (Santa Cruz,

CA). Anti-FLAG M2 was obtained from Stratagene (La Jolla, CA). Antibodies to KSHV K8.1

A/B were obtained from Advanced Biotechnologies Incorporated (Columbia, Maryland).

Cloning and Plasmids- The pND vector for expression in mammalian cells (generous gift from

Dr. G. Rhodes, University of California, Davis, CA) was used in the cloning of KSHV ORF 36.

cDNA was synthesized using RNA extracted from BCBL-1 (B-lymphocytes latently infected

with KSHV) cells after 48 hrs of TPA treatment. KSHV ORF36 was amplified by PCR using

appropriate oligonucleotide primers,

5’AAAAGATCTGCCACCATGGATTACAAGGATGACGACGATAAGCGCTGGAAGA

GAATGGAGAGGAG-3’ and 5’-AAAGCGGCCGCTCAGAAAACAAGTCCGCGGGT-3’,

and cloned into pND. The resulting construct was designated pND-nFLAG-KSHV-ORF36.

The forward primer generated a FLAG sequence at the N-terminus. QuickChange XL Site-

8

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

Directed Mutagenesis Kit (Stratagene, La Jolla, CA) was used in the construction of pND-

nFLAG-KSHV-ORF36(K108Q). Briefly, pND-nFLAG-KSHV-ORF36 was amplified by

PCR using oligonucleotide primers,

5’-TCCGAGGATCTGTGTGTTGCAGCAGTTTGATAGCCGCCGG-3’ and

5’-CCGGCGGCTATCAAACTTGCTGCACACACAGATCCTCGGA-3’; to generate a

kinase-negative mutant of KSHV ORF36 (lysine at position 108 mutated to glutamine).

Cells and transfections- 293 T and SLK cells (human endothelial cell origin, generous gift from

Drs. Sophie Leventon-Kriss, Tel-Aviv, Israel and Jay A. Levy, UCSF,CA) were cultured in

Dulbecco’s modified essential medium (DMEM) supplemented with 10% fetal calf serum, and

cultures were maintained at 5% CO2 at 370C. Transient expression of KSHV-ORF36 and

KSHV-ORF36 (K108Q) was performed by transfecting pND-nFLAG-KSHV-ORF36 or

pND-nFLAG-KSHV-ORF36 (K108Q) using Fugene-6 transfection reagent according to the

manufactures protocol (Boehringer Mannheim). Cells were used 24hrs after transfection.

Anisomycin treated cells served as positive controls for JNK activation. TREx BCBL1-Rta cell

line (generous gift from Dr. Jae U Jung) were cultured in RPMI supplemented with 20% fetal

calf serum, 250ug/ml blasticidin S HCL (Invitrogen) and 200ug/ml hygromycin B (invitrogen).

KSHV lytic replication was induced in this cell line with1ug/ml of doxycycline (Dox; BD

Clonetech, Palo Alto, CA). Cells were harvested 24hrs post induction.

9

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

JNK inhibition assays- TREx BCBL1-Rta cells were treated with 50nM of JNK inhibitor II

(SP600125) or 20uM of JNK inhibitor negative control (EMD Biosciences, San Diego, CA) in

the presence of 1ug of Dox/ml for 24 hours. Cells were harvested for western blot.

Preparation of cell extracts- For detection of phosphorylated cellular proteins or viral proteins,

cells were treated with SDS-sample buffer (62.5 mM Tris-HCl, 2% SDS, 10% glycerol, 50mM

DTT, 0.01%w/v bromophenol blue), sonicated for 15 seconds, heated for 5 minutes at 950C, and

cooled on ice. For immunoprecipation, cells were treated with cell lysis buffer (20mM Tris-

HCL, 150mM NaCl, 1mM EDTA, 1mM EGTA,1% Triton X-100, 2.5 mM sodium

pyrophosphate, 1mM glycerolphospshate, 1mM Na3VO4, 1ug/ml leupeptin) for 30 minutes at

40C and then centrifuged to remove cell debris.

Western blot analysis- For detection of phospho proteins, cells extracts were electrophoresed on

a 12% SDS-PAGE gel and transferred onto PVDF membrane. Blocking buffer (1X TBS, 0.1%

Tween 20, and 5%w/v nonfat dry milk) was added to the membrane for 30 minutes at room

temperature. Phospho-specific antibodies were diluted in primary antibody dilution buffer

(1XTBS, 0.1% Tween 20, 5% w/v BSA) and membranes were incubated overnight at 40C.

Membranes were washed 3 times with wash buffer (1X TBS, 0.1% Tween 20) and incubated

with rabbit IgG-HRP in blocking buffer for 30 minutes at room temperature. Phospho-proteins

10

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

were detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL).

For detection of total JNK, MKK4 and MKK7, K8.1, K-bZIP, c-Myc (Rta), respective primary

antibodies were diluted in blocking buffer for 30 minutes at room temperature, and then detected

with rabbit or mouse IgG-HRP and SuperSignal Substrate.

11

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

RESULTS

ORF36 viral protein kinase is phosphorylated on serine

The conserved lysine residue in the kinase subdomain II was shown to be essential for

kinase activity and autophosphorylation of ORF36 (27,29). To demonstrate that ORF36 was

phosphorylated on serine and that the lysine at position 108 was important for its

phosphorylation, we transfected 293T cells with plasmids expressing KSHV ORF36 or the

mutant K108Q. Western blot analysis with antibodies that recognized phosphoserine,

phosphothreonine or phosphotyrosine, was used to analyze immunoprecipated FLAG-tagged

ORF36 and the mutant K108Q proteins in transfected cells. A band that had the same molecular

weight as FLAG-tagged ORF36 was detected with phosphoserine antibody (Fig.1), but not with

phosphothreonine or phosphotyrosine antibody (data not shown). The K108Q mutant protein of

ORF36 was not detected with any of these three phospho-specific antibodies (Fig. 1 and data not

shown). This finding demonstrates that the lysine at position 108 is important for the

autophosphorylation of ORF36.

ORF36 activates c-Jun N-terminal kinase

To evaluate the ability of KSHV ORF36 to phosphorylate the MAP kinase pathway, SLK

cells were transfected with plasmids expressing ORF36 or the kinase negative mutant, K108Q.

Twenty four hours post-transfection, cells were lysed to prepare extracts for western blot

analysis. Cells transfected with the empty pND vector served as negative controls, and cells

12

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

treated with anisomycin were positive controls for cell activation. As shown in Fig. 2, ORF 36

activated the p54 isoform of JNK, which was phosphorylated on threonine 183 and tyrosine 185;

the phospho-specific antibody for JNK recognizes JNK only when phosphorylated on threonine

183 and tyrosine 185. The p46 isoform of JNK was not phosphorylated by ORF36. The K108Q

mutant was unable to phosphorylate either the p46 or p54 isoform of JNK. To determine if

ORF36 exclusively activated the SAPK/JNK pathway, the p38 pathway and its downstream

targets, ATF2, CREB and ELK-1, p44/42, MKK3/MKK6 were analyzed. Western blot analysis

demonstrated that these target proteins were not phosphorylated by either the wild type ORF36

or kinase-negative mutant K108Q (Fig. 2).

ORF36 activates JNK via MKK4 and MKK7

MKK4 and MKK7 function as non-redundant activators of JNK in vivo. Synergistic

activation of MKK4 and MKK7 is required for optimal JNK activation. Maximal enzyme

activity of JNK is achieved through phosphorylation of threonine 183 and tyrosine 185, with

MKK4 having a preference for phosphorylating the tyrosine residue, and MKK7 for the

threonine residue (30-33). To determine if the viral kinase utilizes MKK4 and MKK7 in the

activation of JNK, lysates from transfected cells expressing ORF36 or the mutant K108Q were

analyzed by western blot with appropriate antibodies. Fig. 3. demonstrates that both MKK4 and

MKK7 were activated by ORF36, but not by the kinase-negative mutant K108Q. These

observations reveal that the phosphorylation of JNK by ORF36 was dependent on the activation

13

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

of both MKK4 and MKK7, and autophosphorylation of ORF36 at serine was important for this

activity.

Phosphorylation of c-Jun by ORF36 via JNK

Activated JNK regulates transcription by phosphorylating c-Jun, ATF-2 and other

transcription factors. JNK phosphorylates the serine residues 63 and 73 of the transcription factor

c-Jun, which in turn binds to TPA response elements and thereby increases c-Jun expression

(34-37). To demonstrate whether KSHV ORF36 activation of JNK results in c-Jun

phosphorylation, total cell lysates were analyzed by western blot analysis for phosphorylation of

c-Jun. Fig. 4 demonstrates that activation of JNK by KSHV ORF36 results in c-Jun

phosphorylation; the kinase-negative mutant K108Q does not lead to phosphorylation of c-Jun.

ORF36 interacts with MKK4, MKK7 and JNK

Immunoprecipation studies demonstrated that scaffolding proteins, such as JIP-1/2 (JNK

interacting protein 1/2), JSAP-1 (JNK/stress-activated protein kinase associated protein-1) and

beta-arrestin-2, interact physically with their downstream targets. JIP-1 and 2 form complexes

with JNK, MLK (mixed lineage kinase) and MKK7 (38,39), whereas JSAP-1 forms complexes

with MEKK1, MKK4 and JNK(40). These enzyme complexes produce “MAP-kinase modules”,

which facilitate activation and enhance specificity of their respective target proteins (39). To

assess the in vivo association of ORF36 with proteins in the JNK pathway, 293T cells were

14

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

transfected with ORF36 or the mutant K108Q. Immunoprecipation of total cell lysates with the

FLAG, MKK4, MKK7 or JNK antibody demonstrated physical interaction of ORF36 with these

cellular enzymes (Fig. 5). The kinase-negative mutant K108Q was also able to associate with

MKK4, 7 and JNK. Thus, autophosphorylation of ORF36 was not important for association with

MAP-kinase modules, and proceeded in a phosphorylation-independent manner.

Activation of JNK during KSHV reactivation- The KSHV viral protein, Rta, encoded by ORF50

is a transcriptional activator and acts as a molecular switch for KSHV reactivation. Expression of

Rta efficiently induces lytic replication in latently infected KSHV cell lines. The TREx BCBL1-

Rta cell line is a derivative of the BCBL-1 cell line (B-cell lymphoma cell line latently infected

with KSHV), where Rta is under the control of a tetracycline inducible promoter. This cell line

was demonstrated to fully induce lytic replication and produce infectious viral progeny in the

presence of tetracycline. In addition, TREx BCBL1-Rta cell line was demonstrated to induce

KSHV gene expression in a more powerful and efficient manner than TPA stimulation of

BCBL-1 cells (41). Stimulation of TREx BCBL-1-Rta cells with doxycycline for 24 hours

stimulated the expression of Rta, and expression levels did not change with the addition of JNK

inhibitor II (JNKi) or the JNKi negative inhibitor (Figure 6). Anisomycin or untreated cells did

not express Rta. The same cell lysates were used to determine the activation of JNK and c-Jun.

Induction of lytic replication activated JNK and c-Jun, and this activation was abrogated in the

presence of JNKi II. Inhibition of JNK also prevented expression of K8.1 (a KSHV glycoprotein

15

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

that serves as a marker for viral late gene expression) but not K-bZIP (a early lytic gene

identified as a basic-leucine zipper protein) (Figure 6).

16

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

DISCUSSION

KSHV, a gamma-2 herpesvirus, encodes a serine protein kinase (27). Our results support

previously published data, using phosphoamino acid analysis, that this kinase is phosphorylated

on serine (Fig.1) (27). Autophosphorylation was abrogated by mutating the lysine residue in the

catalytic subdomain II of ORF36 (Fig. 1). In this study, we established a mechanism by which

the viral protein kinase activates the mitogen activated stress kinase pathway. Using transient

transfection experiments, JNK was activated by KSHV ORF36, but not by the kinase-negative

mutant, K108Q (Fig 2). This finding indicates that autophosphorylation of ORF36 was important

for JNK activation. The p44/42, MKK3/6 and p38 pathways were not activated by ORF36,

showing specificity for JNK activation (Fig.2). Both MKK4 and MKK7 act synergistically to

activate JNK (30-32). Figure 3 demonstrates that ORF36 activates MKK4 and MKK7. These

findings imply that JNK activation by ORF36 is via phosphorylation of MKK4 and MKK7.

Recent data show that scaffolding proteins, such as JIP-1/2 and JSAP-1, associate with

MEKK1, MLK, MKK4, MKK7 and JNK, forming enzyme complexes and facilitating the

activation of the mitogen/stress activated protein kinase pathway (38-40). To demonstrate

whether ORF36 associates with these complexes, immunoprecipation experiments were

performed with antibodies specific for MKK4, MKK7 or JNK. These studies showed that KSHV

ORF36 was associated with MKK4, MKK7 and JNK, and that this association was independent

of the phosphorylation state of ORF36. The significance of ORF36 activation of JNK is

attributed to the phosphorylation and activation of the transcription factor, c-Jun. In addition, we

17

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

have demonstrated that inhibiting the activation of JNK during KSHV reactivation severely

represses expression of the late lytic viral gene, K8.1, but had no effect on the expression level of

the early lytic gene, K-bZIP (Figure 6). This demonstrates that initiation of lytic infection and

the transcription of early lytic genes may not require the activation of the JNK pathway.

Conversely, expression of K8.1, a structural glycoprotein component of KSHV particles, is

dramatically reduced in expression levels in the presence of SP600125.

The physiological role of ORF36 for KSHV replication is not defined, but possible clues

to its function have emerged from studies performed on homologous protein kinases found in

other herpesviruses. Previous work demonstrated that alpha-, beta- and gamma-herpesviruses

encode viral protein kinases, which are represented by HSV-1 ULl3, VZV ORF47, HCMV

UL97, HHV-6 U69, EBV EGLF4, KSHV ORF36 and RRV ORF36 (5,42,43). Similar to

cellular serine/threonine protein kinases, these viral kinases contain eleven subdomains; a

conserved lysine residue in subdomain II was important for kinase activity (44,45). Conservation

of these viral protein kinases amongst the herpesviridae family, and their homology to cellular

serine kinases, indicate indispensability for herpesvirus survival. A number of studies using

kinase-null viral mutants demonstrated the importance of the kinase for regulating viral gene

expression, replication, or tissue tropism. HSV UL13 kinase mediates post-translational

processing and influences expression of several viral genes (46). HCMV UL97 kinase-null

mutants show replication deficiency in tissue culture, and the UL97 protein kinase is important

for phosphorylation of multiple cellular targets (13,47,48). VZV ORF47 null mutants show

18

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

replication deficiency and the inability to phosphorylate several viral proteins (15,49,50). In

addition to phosphorylating viral targets, cellular targets including CKII beta, EF-1delta, p60,

and RNA pol II, serve as substrates for herpesvirus protein kinases (5,42,51-53). To demonstrate

conserved function between herpesvirus protein kinases, chimeric viruses expressing substituted

protein kinases from other herpesviruses were partially able to compensate for lost function (54).

In addition, these viral protein kinases were found in purified virus particles, suggesting a role in

the assembly of virions or in virion entry into cells (10,12).

Activation of the mitogen activated stress kinase pathway is important for enhancing

herpesvirus replication. Infection with HSV-1 resulted in the activation of JNK, c-Jun, p38,

AP-1 and enhancement of viral replication (19,20), and the phosphorylation of the transcription

factor, Sp1 (21). During VZV infection, activation of c-Jun, Fos, ATF-2 and AP-1 was

important for regulating viral genes (23), whereas activation of stress-activated MAP kinases

upregulated transgenes in CMV infection(22). These observations on other herpesviruses have

implications for our findings on the KSHV ORF36 kinase. Accordingly, ORF36 might enhance

viral replication by activating c-Jun N-terminal kinase, and hence modulating cellular

transcription by activation of transcription regulated by c-Jun. KSHV and EBV also encode

proteins that are capable of activating the mitogen-activated stress kinase pathway (24-26).

Functional studies to demonstrate the significance of these findings will provide clues to the

relevance of the mitogen-activated stress kinase pathway in herpesvirus survival and

transcription. Such studies could be based on the analysis of kinase-null mutants of the virus,

19

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

dominant negative JNK pathway mutants, and specific inhibitors for the JNK pathway.

Another possible role for ORF36 phosphorylation of JNK may be the activation of

transcription factors encoded by KSHV. Merek’s disease virus, also a gamma-herpesvirus,

encodes MEQ, which mimics c-Jun. The MEQ protein shares extensive homology with the

Jun/Fos family of transcription factors, within the basic region-leucine zipper (bZIP) domain. In

addition, MEQ dimerizes with itself and other cellular transcription factors, and can functionally

substitute for c-Jun (55). KSHV also encodes a gene with a basic region-leucine zipper domain;

this protein has been designated K-bZIP and shows homology with BZLF1, an EBV protein

essential for viral reactivation and replication (56,57). These observations suggest that ORF36

plays a role in the activation of KSHV transcription by activating viral homologs of cellular c-

Jun. Consequently, KSHV ORF36 (a viral late protein) might target an immediate-early viral

protein, such as, K-bZIP. This proposed model is supported by the finding that herpesvirus

protein kinases are found in purified virions (10,12). In fact, using in vitro kinase assays, ORF36

was shown to phosphorylate K-bZIP (these authors, unpublished results). Future studies to

define the role of ORF36 in KSHV replication and transcription will provide clues into the

mechanism by which herpesviruses modulate host cell signaling pathways and maintain their

survival within the infected host.

20

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

FOOTNOTES

We thank Dr. Albert Van Geelen for helpful discussions. The research in this paper was

supported by grants from the NCI (CA91574) to H.J.K., the California Universitywide AIDS

Research Program (R00-D-034) to H.J.K., and NCRR (RR00169) to P.A.L.

21

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

ABBREVIATIONS

The abbreviations used in this paper are: HSV, herpes simplex virus; VZV, Varicella-Zoster

virus; EBV, Epstein-Barr virus; KSHV, Kaposi’s sarcoma herpesvirus; HCMV, human

cytomegalovirus; RRV, rhesus rhadinovirus; JNK, c-Jun N terminal kinase; SAPK, stress

activated protein kinase, MAPK, mitogen activated protein kinase; MEKK4, SAPK/Erk kinase 1;

MKK7, MAP kinase kinase 7.

22

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

FIGURE LEGENDS

FIG. 1. Autophosphorylation and the conserved lysine residue in the catalytic subdomain of

KSHV ORF36 protein kinase. 293T cells transfected with pND (empty vector), or with plasmids

expressing wild type ORF36 or mutant K108Q, were lysed, and cell extracts were

immunoprecipated with anti-FLAG antibody and protein A sepharose beads. Immunoprecipated

proteins were detected by western blot analysis using anti-FLAG or anti-phosphoserine

antibody(see Materials and Methods). The control is lysate from pND transfected cells (lane 1).

Wild type ORF36 protein kinase was detected using anti-phospho-serine antibody (lane 2), but

this same antibody did not detect the K108Q mutant (lane 3). Equal amounts of ORF36 and

K108Q proteins were detected using anti-FLAG antibody. Phospho-serine proteins were

detected using chemiluminescence and FLAG tagged proteins were detected using colorimetry.

FIG. 2. Autophosphorylation of KSHV ORF36 and JNK activation. Total protein extracts from

SLK cells transfected with wild type ORF36 or mutant K108Q were analyzed by western blot

using antibodies that recognized the activated forms of proteins within the p44/42, MKK3/6,

p38, JNK and ERK pathway (see Materials and Methods). For controls, lysates were prepared

from mock transfected cells (empty pND vector, lane 1) or cells treated with anisomycin (JNK

activator, lane 2). JNK was specifically phosphorylated by wild type ORF36 (lane 3).

Phosphorylation of JNK was not detected in cells transfected with mutant K108Q (lane 4). Equal

loading of lysates was confirmed with antibodies that recognized total cellular JNK. Expression

23

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

of ORF36 and K108Q was detected by anti-FLAG antibody. KSHV ORF36 and K108Q did not

phosphorylate other members of the MAP kinase pathway as demonstrated by western blot

analysis using phospho-specific antibodies for ATF-2, p38, MKK3/6 and p44/42.

FIG. 3. Synergistic activation of MKK4 and MKK7 by KSHV ORF36. Lysates of transfected

SLK cells were analyzed by western blot using antibodies that recognized the phosphorylated

forms of MKK4 and MKK7 (see Materials and Methods). ORF36 activated both MKK4 and

MKK7 (lane 3), whereas the mutant K108Q was unable to activate either MKK4 or MKK7 (lane

4). These results demonstrate that synergistic activation of MKK4 and MKK7 was important for

the activation of JNK, and this activation was dependent on the phosphorylation state of ORF36

(lane 4). Equal loading of lysates was confirmed using antibodies that recognized total cellular

MKK4 and MKK7 protein.

FIG. 4. Phosphorylation of c-Jun transcription factor by KSHV ORF36. Activation of JNK

results in the phosphorylation and activation of its substrate, c-Jun. To demonstrate whether

JNK was catalytically active, phosphorylation of c-Jun was demonstrated in cells transfected

with ORF36 (lane 3), but not in cells transfected with the mutant K108Q (lane 4) by western blot

analysis using anti-phospho-c-Jun antibody. Lane 1 (negative control) and lane2 (positive

control-anisomycin) served as controls for c-Jun phosphorylation. Equal loading of protein

lysates was demonstrated by western blot analysis using anti-c-Jun antibody.

24

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

FIG. 5. Phosphorylation state and association of KSHV ORF36 with MKK4, MKK7 and JNK.

(A) Transfected 293T cells were lysed and immunoprecipated with FLAG antibody. Western

blot analysis of the immunoprecipated FLAG-tagged ORF36 protein revealed association with

MKK4, MKK7 and JNK (lanes 2 and 3). (B). Transfected 293T cells were immunoprecipated

with either MKK4, MKK7 or JNK antibodies. Western blot analysis using FLAG antibody

detected FLAG-tagged ORF36 (lanes 2,3,5,6,8 and 9). The phosphorylation state of KSHV

ORF36 was not essential for this association (lanes 3,6, and 9).

FIG. 6. Phosphorylation of JNK and c-Jun during KSHV reactivation and their significance in

lytic viral gene expression. KSHV reactivation and viral lytic gene expression was induced in the

TREx-BCBL-1 Rta cell line using doxycycline (1ug/ml) for 24 hours (lanes 3, 4 and 5). In

addition to doxycycline treatment, cells were treated with 50nM of JNK inhibitor II (JNKi II,

SP600125) (lane 4) or 20uM JNK inhibitor II negative control (lane5). Cells were not induced

(lane 1) or treated with anisomycin (lane 2). Doxycycline-induced expression of Rta was

detected in lanes 3, 4 and 5. Expression of Rta and lytic replication phosphorylated JNK and c-

Jun (lane 3) in these cells. Expression of Rta, in the presence or absence of JNKi II resulted in

the expression of K-bZIP (lanes 3, 4 and 5). Inhibition of K8.1 expression in the presence of Rta

and K-bZIP expression was observed in the presence of JNKi II (lane 4). Equal loading of cell

lysates was confirmed using anti-tubulin antibody.

25

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

REFERENCES

1. Roizman, B., and Pellet, P. E. (2001) in Fields Virology (Knipe, D. M., and Howley, P. M., eds) Vol. 2, pp. 2381-2397, 2 vols., Lippincott Williams and Wilkins

2. Kieff, E., and Rickinson, A. (2001) in Fields Virology (Knipe, d., and Howley, p., eds) Vol. 2 fourth edition, pp. 2576-2673, 2 vols., Lippincott Williams and Wilkins

3. Bubman, D., and Cesarman, E. (2003) Hematol Oncol Clin North Am 17, 717-7454. Cotter, M. A., 2nd, and Robertson, E. S. (2002) Front Biosci 7, d358-3755. Kawaguchi, Y., and Kato, K. (2003) Rev Med Virol 13, 331-3406. Johnson, L. N., Lowe, E. D., Noble, M. E., and Owen, D. J. (1998) FEBS Lett 430, 1-117. Smith, R. F., and Smith, T. F. (1989) J Virol 63, 450-4558. Kawaguchi, Y., Matsumura, T., Roizman, B., and Hirai, K. (1999) J Virol 73, 4456-44609. Morrison, E. E., Wang, Y. F., and Meredith, D. M. (1998) J Virol 72, 7108-711410. Overton, H. A., McMillan, D. J., Klavinskis, L. S., Hope, L., Ritchie, A. J., and Wong-

kai-in, P. (1992) Virology 190, 184-19211. Wolf, D. G., Honigman, A., Lazarovits, J., Tavor, E., and Panet, A. (1998) Arch Virol

143, 1223-123212. van Zeijl, M., Fairhurst, J., Baum, E. Z., Sun, L., and Jones, T. R. (1997) Virology 231,

72-8013. Prichard, M. N., Gao, N., Jairath, S., Mulamba, G., Krosky, P., Coen, D. M., Parker, B.

O., and Pari, G. S. (1999) J Virol 73, 5663-567014. Sato, H., Pesnicak, L., and Cohen, J. I. (2003) J Virol 77, 11180-1118515. Besser, J., Sommer, M. H., Zerboni, L., Bagowski, C. P., Ito, H., Moffat, J., Ku, C. C.,

and Arvin, A. M. (2003) J Virol 77, 5964-597416. Coulter, L. J., Moss, H. W., Lang, J., and McGeoch, D. J. (1993) J Gen Virol 74 ( Pt 3),

387-39517. Heineman, T. C., and Cohen, J. I. (1995) J Virol 69, 7367-737018. Moffat, J. F., Zerboni, L., Sommer, M. H., Heineman, T. C., Cohen, J. I., Kaneshima, H.,

and Arvin, A. M. (1998) Proc Natl Acad Sci U S A 95, 11969-1197419. McLean, T. I., and Bachenheimer, S. L. (1999) J Virol 73, 8415-842620. Zachos, G., Clements, B., and Conner, J. (1999) J Biol Chem 274, 5097-510321. Kim, D. B., and DeLuca, N. A. (2002) J Virol 76, 6473-647922. Bruening, W., Giasson, B., Mushynski, W., and Durham, H. D. (1998) Nucleic Acids Res

26, 486-48923. Rahaus, M., and Wolff, M. H. (2003) Virus Res 92, 9-2124. Chen, S. Y., Lu, J., Shih, Y. C., and Tsai, C. H. (2002) J Virol 76, 9556-956125. Adamson, A. L., Darr, D., Holley-Guthrie, E., Johnson, R. A., Mauser, A., Swenson, J.,

and Kenney, S. (2000) J Virol 74, 1224-1233

26

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

26. Brinkmann, M. M., Glenn, M., Rainbow, L., Kieser, A., Henke-Gendo, C., and Schulz, T. F. (2003) J Virol 77, 9346-9358

27. Park, J., Lee, D., Seo, T., Chung, J., and Choe, J. (2000) J Gen Virol 81, 1067-107128. Sun, R., Lin, S. F., Staskus, K., Gradoville, L., Grogan, E., Haase, A., and Miller, G.

(1999) J Virol 73, 2232-224229. Smith, G. A., Young, P. L., and Mattick, J. S. (1991) Arch Virol 119, 199-21030. Lisnock, J., Griffin, P., Calaycay, J., Frantz, B., Parsons, J., O’Keefe, S. J., and LoGrasso,

P. (2000) Biochemistry 39, 3141-314831. Lawler, S., Fleming, Y., Goedert, M., and Cohen, P. (1998) Curr Biol 8, 1387-139032. Fleming, Y., Armstrong, C. G., Morrice, N., Paterson, A., Goedert, M., and Cohen, P.

(2000) Biochem J 352 Pt 1, 145-15433. Kishimoto, H., Nakagawa, K., Watanabe, T., Kitagawa, D., Momose, H., Seo, J.,

Nishitai, G., Shimizu, N., Ohata, S., Tanemura, S., Asaka, S., Goto, T., Fukushi, H., Yoshida, H., Suzuki, A., Sasaki, T., Wada, T., Penninger, J. M., Nishina, H., and Katada, T. (2003) J Biol Chem 278, 16595-16601

34. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Genes Dev 7, 2135-214835. Galcheva-Gargova, Z., Derijard, B., Wu, I. H., and Davis, R. J. (1994) Science 265,

806-80836. Diehl, A. M., Yin, M., Fleckenstein, J., Yang, S. Q., Lin, H. Z., Brenner, D. A.,

Westwick, J., Bagby, G., and Nelson, S. (1994) Am J Physiol 267, G552-56137. Westwick, J. K., Weitzel, C., Minden, A., Karin, M., and Brenner, D. A. (1994) J Biol

Chem 269, 26396-2640138. Ikeda, A., Hasegawa, K., Masaki, M., Moriguchi, T., Nishida, E., Kozutsumi, Y., Oka, S.,

and Kawasaki, T. (2001) J Biochem (Tokyo) 130, 773-78139. Whitmarsh, A. J., Cavanagh, J., Tournier, C., Yasuda, J., and Davis, R. J. (1998) Science

281, 1671-167440. Ito, M., Yoshioka, K., Akechi, M., Yamashita, S., Takamatsu, N., Sugiyama, K., Hibi,

M., Nakabeppu, Y., Shiba, T., and Yamamoto, K. I. (1999) Mol Cell Biol 19, 7539-754841. Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S. L., and Jung, J. U. (2003) J

Virol 77, 4205-422042. Kawaguchi, Y., Kato, K., Tanaka, M., Kanamori, M., Nishiyama, Y., and Yamanashi, Y.

(2003) J Virol 77, 2359-236843. Kato, K., Kawaguchi, Y., Tanaka, M., Igarashi, M., Yokoyama, A., Matsuda, G.,

Kanamori, M., Nakajima, K., Nishimura, Y., Shimojima, M., Phung, H. T., Takahashi, E., and Hirai, K. (2001) J Gen Virol 82, 1457-1463

44. Chee, M. S., Lawrence, G. L., and Barrell, B. G. (1989) J Gen Virol 70 ( Pt 5), 1151-1160

45. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988) Science 241, 42-5246. Purves, F. C., Ogle, W. O., and Roizman, B. (1993) Proc Natl Acad Sci U S A 90, 6701-

6705

27

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

47. Talarico, C. L., Burnette, T. C., Miller, W. H., Smith, S. L., Davis, M. G., Stanat, S. C., Ng, T. I., He, Z., Coen, D. M., Roizman, B., and Biron, K. K. (1999) Antimicrob Agents Chemother 43, 1941-1946

48. Littler, E., Stuart, A. D., and Chee, M. S. (1992) Nature 358, 160-16249. Ng, T. I., and Grose, C. (1992) Virology 191, 9-1850. Stevenson, D., Colman, K. L., and Davison, A. J. (1994) J Gen Virol 75 ( Pt 2), 317-32651. Kawaguchi, Y., Van Sant, C., and Roizman, B. (1998) J Virol 72, 1731-173652. Bruni, R., Fineschi, B., Ogle, W. O., and Roizman, B. (1999) J Virol 73, 3810-381753. Biggar, R. J., Engels, E. A., Whitby, D., Kedes, D. H., and Goedert, J. J. (2003) J Infect

Dis 187, 12-1854. Ng, T. I., Talarico, C., Burnette, T. C., Biron, K., and Roizman, B. (1996) Virology 225,

347-35855. Liu, J. L., and Kung, H. J. (2000) Virus Genes 21, 51-6456. Lin, S. F., Robinson, D. R., Miller, G., and Kung, H. J. (1999) J Virol 73, 1909-191757. Izumiya, Y., Lin, S. F., Ellison, T., Chen, L. Y., Izumiya, C., Luciw, P., and Kung, H. J.

(2003) J Virol 77, 1441-1451

28

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from

Kung and Paul A. LuciwMuhammad S. Hamza, Richard A. Reyes, Yoshihiro Izumiya, Ronald Wisdom, Hsing-Jien

N-terminal kinase (JNK) signaling pathwayORF36 protein kinase of kaposi's sarcoma herpesvirus (KSHV) activates the c-Jun

published online July 5, 2004J. Biol. Chem. 

  10.1074/jbc.M400964200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on August 18, 2019

http://ww

w.jbc.org/

Dow

nloaded from