12
ISSN 1313 - 8820 Volume 5, Number 4 December 2013 2013

ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

  • Upload
    others

  • View
    2

  • Download
    0

Embed Size (px)

Citation preview

Page 1: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

ISSN 1313 - 8820Volume 5, Number 4

December 2013

2013

Page 2: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

Scope and policy of the journalAgricultural Science and Technology /AST/ – an International Scientific Journal of Agricultural and Technology Sciences is published in English in one volume of 4 issues per year, as a printed journal and in electronic form. The policy of the journal is to publish original papers, reviews and short communications covering the aspects of agriculture related with life sciences and modern technologies. It will offer opportunities to address the global needs relating to food and environment, health, exploit the technology to provide innovative products and sustainable development. Papers will be considered in aspects of both fundamental and applied science in the areas of Genetics and Breeding, Nutrition and Physiology, Production Systems, Agriculture and Environment and Product Quality and Safety. Other categories closely related to the above topics could be considered by the editors. The detailed information of the journal is available at the website. Proceedings of scientific meetings and conference reports will be considered for special issues.

Submission of Manuscripts

All manuscripts written in English should be submitted as MS-Word file attachments via e-mail to [email protected]. Manuscripts must be prepared strictly in accordance with the detailed instructions for authors at the website http://www.uni-sz.bg/ascitech/index.html and the instructions on the last page of the journal. For each manuscript the signatures of all authors are needed confirming their consent to publish it and to nominate on author for correspondence.They have to be presented by a submission letter signed by all authors. The form of the submission letter is available upon from request from the Technical Assistance or could be downloaded from the website of the journal. Manuscripts submitted to this journal are considered if they have submitted only to it, they have not been published already, nor are they under consideration for publication in press elsewhere. All manuscripts are subject to editorial review and the editors reserve the right to improve style and return the paper

for rewriting to the authors, if necessary. The editorial board reserves rights to reject manuscripts based on priorities and space availability in the journal.

The articles appearing in this journal are indexed and abstracted in: EBSCO Publishing, Inc. and AGRIS (FAO).The journal is accepted to be indexed with the support of a project № BG051PO001-3.3.05-0001 “Science and business” financed by Operational Programme “Human Resources Development” of EU. The title has been suggested to be included in SCOPUS (Elsevier) and Electronic Journals Submission Form (Thomson Reuters).

Internet AccessThis journal is included in the Trakia University Journals online Service which can be found at www.uni-sz.bg.

Address of Editorial office:Agricultural Science and Technology Faculty of Agriculture, Trakia University Student's campus, 6000 Stara Zagora BulgariaTelephone.: +359 42 699330 +359 42 699446http://www.uni-sz.bg/ascitech/

Technical Assistance:Nely TsvetanovaTelephone.: +359 42 699446E-mail: [email protected]

Editor-in-Chief

Tsanko YablanskiFaculty of AgricultureTrakia University, Stara ZagoraBulgaria

Co-Editor-in-Chief

Radoslav SlavovFaculty of AgricultureTrakia University, Stara ZagoraBulgaria

Editors and Sections

Genetics and Breeding

Atanas Atanasov (Bulgaria)Ihsan Soysal (Turkey)Max Rothschild (USA)Stoicho Metodiev (Bulgaria)

Nutrition and Physiology

Nikolai Todorov (Bulgaria)Peter Surai (UK)Zervas Georgios (Greece)Ivan Varlyakov (Bulgaria)

Production Systems

Dimitar Pavlov (Bulgaria)Dimitar Panaiotov (Bulgaria)Banko Banev (Bulgaria)Georgy Zhelyazkov (Bulgaria)

Agriculture and Environment

Georgi Petkov (Bulgaria)Ramesh Kanwar (USA)

Product Quality and Safety

Marin Kabakchiev (Bulgaria)Stefan Denev (Bulgaria)Vasil Atanasov (Bulgaria)

English Editor

Yanka Ivanova (Bulgaria)

Page 3: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

2013

ISSN 1313 - 8820 Volume 5, Number 4December 2013

Page 4: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available
Page 5: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

Genetic diversity and distance between two Bulgarian local sheep breeds assessed by microsatellite markers

1 2 1 3 4 1S. Georgieva , E. Todorovska , D. Hristova , I. Dimitrova , N. Stancheva , Ts. Yablanski

1Department of Genetics, Breeding and Reproduction, Faculty of Agriculture, Trakia University, 6000 Stara Zagora, Bulgaria2AgroBioInstitute, 8 Dragan Tsankov, 1164 Sofia, Bulgaria3University of Forestry, 10 Kliment Ohridski, 1756 Sofia, Bulgaria4Agricultural Institute, 3 Simeon Veliki, 9700 Shumen, Bulgaria

Abstract. In the present study 37 blood samples from Copper-Red Shumen and 38 blood samples from Karakachan sheep breeds were used to extract DNA followed by polymerase chain reaction (PCR). Based on the set of six microsatellite markers the genetic diversity was investigated in the examined breeds. Allele diversity, observed heterozygosity, expected heterozygosity, average gene diversity over loci, coefficient of inbreeding and chi-square test for Hardy-Weinberg equilibrium were calculated. Within breeds, the mean number of alleles varied from 9.5 in Karakachan to 10.5 in Copper-Red Shumen. The mean observed heterozygosity (Ho) ranged from 0.543 in Karakachan to 0.621 in Copper-Red Shumen, while the mean expected heterozygosity (He) from 0.774 in Karakachan to 0.812 in Copper-Red Shumen.The coefficient of inbreeding (Fis) was positive, ranging from 0.298 in Karakachan to 0.235 in Copper-Red shumen, indicating a risk of inbreeding. The low distance value (0.083) was found between the populations Karakachan and Copper-Red Shumen. The data obtained in the present study can contribute towards development of an effective conservation strategies for these traditional sheep breeds in Bulgaria.

Keywords: local sheep breeds, microsatellite markers, diversity, genetic structure, distances

Abbreviation: CRSH – Copper-Red Shumen; KKCH – Karakachan sheep

AGRICULTURAL SCIENCE AND TECHNOLOGY, VOL. 5, No 4, pp , 2013367 - 370

Introduction level of polymorphism, co-dominant inheritance and easy to analyze (Cañon et al., 2006). Microsatellites have been wide by used for assessment of genetic diversity in sheep. (Diez-Tascon et al., 2000; Sheep play an important role in maintenance of rural Hassan et al., 2003; Arora and Bhatia, 2004; Gutiérrez-Gil et al. populations and also have a particular cultural importance due to its 2006; El-Nahas et al., 2008).traditional use in rites and celebrations. They are also used for meat,

In the present study, a set of six microsatellite markers were milk and wool production. Copper-Red Shumen (CRSH) and used to evaluate the genetic diversity within and between two Karakachan (KKCH) sheep breeds are important local sheep breeds Bulgarian local sheep breeds and to measure the distance among in Bulgaria and they are the object of this study. the breeds.CRSH is distributed mainly in the North-Eastern part of

Bulgariain regions. Representatives of this breed are medium-to-large with average body weight of 47kg with compact body. Fleece

Material and methods colour is rusty-red, while one can find individuals with black fleeces. Ewes are hornless, but rams have twisted well-developed horns. They usually have well covered body and legs free of wool A total of 75 individuals representing two local Bulgarian sheep (EASRAB, 2011). The average body weight varyed from 49.12 to breeds (KKCH and CRSH) were analyzed. For each breed unrelated 55.46kg (Staykova, 2005). The results of polymorphic analyses of individuals were selected (37 blood samples for CRSH and 38 for blood serum proteins showed the presence of some rare alleles KKCH). Blood samples of 5–10 ml were collected in EDTA tubes. such as Tf G, Alb F, Alb S, Alb W in this breed (Makaveev and Nakev, DNA was extracted from the whole blood with Illustra Blood 1987; Baulov and Alexieva, 1991). GenomicPrep DNA Purification Kit (GE Healthcare, UK) according

KKCH is spread throughout mountain areas in Bulgaria.In the to the manufacturer's instructions and stored at -20ºC until the past the breed was one of the most widespread on the Balkans. analysis was performed.Animals are small, vigorous, strong-boned with short legs, resistant A set of six microsatellite markers (Table 1) was chosen based to unfavourable climatic and feeding conditions, and diseases. The of their level of polymorphism location on different chromosomes, animals have a vivid temperament, they are energetic and mobile preferably unlinked following the recommendation of the Food and and can endure long-distance marches. Their face, ears, legs and Agriculture Organization (FAO) and the International Society for nose are black. Most of the population has pigmented grey to black Animal Genetics (ISAG). wool, sometimes brown, predominantly coarse. The average body PCR amplifications were carried out in total 10µl volumes, weight is 44.04–54.10kg (Staykova, 2005). containing 50ng DNA template, 20pM primers and 1x AmpliTaq Gold

Microsatellites have often been used for genetic diversity PCR Master mix (Applied Biosystems, USA). Forward primers were studies, because of their distribution throughout the genome, high Cy5 fluorescently labelled. PCR amplification was performed in a

367

* e-mail: [email protected]

Page 6: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

368

thermocycler GeneAmp 9700 (Applied Biosystems) using the Yong, 1999; Labate, 2000). This program was used also to establish following conditions: for loci OarFCB20, OarJMP58 and MAF65 an the genetic distances (D ) between populations according to the A

initial denaturation step at 95ºC for 5 min, followed by 35 cycles of method of Nei (1978). The ARLEQUIN software, version 3.5.1.3 was 95ºC for 30s, annealing at 55ºC for 35s, extension at 72ºC for 1 min used for population data analysis (Excoffier and Lischer, 2010). The and final extension at 72ºC for 10 min; for marker MAF70 the number of alleles of each locus, heterozygosities values were annealing temperature was increased to 60 ºC. For loci ILSTS11 and calculated for two investigated breed. The same software was used OarCP20 a two-step cycling procedure was used: denaturation at to evaluate the coefficient of inbreeding (Fis) and to check deviation 95ºC for 5 min, followed by 9 cycles of 95ºC for 30s, annealing at from Hardy-Weinberg equilibrium (HWE). 58ºC or 62ºC for 35s, 72ºC for 1 min, then 25 cycles at 95ºC for 30s, annealing at 55ºC or 60ºC for 35s, 72ºC for 1 min and final extension at 72ºC for 10 min. PCR amplified products were separated on 6% Results denaturing polyacrylamide gel (ReproGel High Resolution) using automated laser sequencer (ALF Express II Amersham All markers were highly polymorphic. In Table 2 are displayed Biosciences). The electrophoresis was performed in 1x TBE buffer the variability parameters the investigated loci. The number of (0.09M Tris-borate, pH 8.3; 2mM EDTA) under the following running alleles per locus observed in two breeds ranged from 5 to 21. Based parameters: 1500V, 60mA, 30W, 55ºC, sample interval 2s, run time on the mean number of alleles per population, more diverse 450 min. Fragment sizes were determined using the computer population was CRSH (10.5) in comparison to KKCH (9.5).program Allele Locator, version 1.03 (Amersham Pharmacia In the examined populations the Ho levels were lower than the Biotech, 1998) with internal size standarts and data were imported expected heterozygosities (He). The mean Ho and He per studied and converted to pseudogel images. populations were 0.621–0.812 for CRSH and 0.543–0.774 for KKCH

The allele diversity, number of alleles per locus and their (Table 3). The coefficient of inbreeding (Fis) was positive, ranging richness, observed and expected heterozygosity values (H and H ) o e from 0.235 (CRSH) to 0.298 (KKCH), indicating a risk of inbreeding. were calculated using POPGENE software, version 1.31, (Yeh and The values of chi-square test (11.80 and 9.02) point that both studied

Table 1. SSR locus information

Marker name Origin Chromosome location Primer sequences F / R

2

4

9

15

21

26

Ovine

Ovine

Bovine

Ovine

Ovine

Ovine

OarFCB20

MAF70

ILSTS11

MAF65

OarCP20

OarJMP58

F:AAATGTGTTTAAGATTCCATACAGTG

R:GGAAAACCCCCATATATACCTATAC

F:GCAGGACTCTACGGGCCTTTGC

R:CACGGAGTCACAAAGAGTCAGACC

F:GCTTGCTACATGGAAAGTGC

R:CTAAAATGCAGAGCCCTACC

F:AAAGGCCAGAGTATGCAATTAGGAG

R:CCACTCCTCCTGAGAATATAACATG

F:GATCCCCTGGAGGAGGAAACGG

R:GGCATTTCATGGCTTTAGCAGG

F:GAAGTCATTGAGGGGTCGCTAACC

R:CTTCATGTTCACAGGACTTTCTCTG

sheep breeds are in accordance with HWE, even though a deficiency of heterozygocity was indicated (Table 3).

Five population-specific alleles were detected in the two breeds CRSH and KKCH in three microsatellite loci (Table 4).The relationships among the examined populations were determined using minimum genetic distance formula (D ). The distance value A

between CRSH and KKCH was low (0.083).

Table 2. Number of alleles per locus

Number of alleles

SSR locusPopulation

OarFCB20 MAF70 ILSTS11 MAF65 OarCP20 OarJMP58

Mean

CRSH

KKCH

8

9

18

21

7

7

8

6

10

5

12

9

10.500

9.500

Table 3. Mean observed (Ho) and expected (He)heterozygosities, average gene diversity over loci (Gdv),coefficient of inbreeding (Fis) and chi-square test for HWE in the examined populations

Population chi-squareFisGdvHeHo

CRSH

KKCH

0.621

0.543

0.812

0.774

0.812

0.774

0.235

0.298

11.80

9.02

Page 7: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

369

current status of the genetic diversity and relationships among two Discussionlocal sheep breeds in Bulgaria. Using a panel of 6 polymorphic SSR markers high level of genetic diversity was established in the studied The genetic characterization of a breed is very important for the sheep populations. Based on their cultural, historical and evaluation of genetic variability, which is an substantial element in environmental importance the data obtained here could be considered as an initial guide for the development of rational breeding strategies for preservation and utilization of the autochthonous sheep breeds in Bulgaria.

Acknowledgment

This research was a part of the project 501/22, 05.12.2012. (2012-2014) "Development of DNA markers (CAST, MSTN) for fattening ability and meat quality in Synthetic population Bulgarian Milk, Karakachanian and Copper Red Shumen sheep breeds" financed by the Ministry of Education, Youth and Science, Republic of Bulgaria.conservation of genetic resources and for breeding strategies. In

present study the allele diversity and genetic relationship of 2 indigenous sheep breeds in Bulgaria were examined using a set of 6 polymorphic microsatellites. The relatively high mean number of Referencesalleles per locus (10.5 and 9.5 respectively) indicates the usefulness of the selected markers for studying the genetic diversity in

Alvarez I, Royo L, Fernandez I, Gutierrez J, Gomez E and Bulgarian sheep populations. This observation is in accordance with

Goyache F, 2004. Genetic relationships and admixture among other studies (Alvarez et al. 2004; Arranz et al., 2001) and confirms

sheep breeds from Northern Spain assessed using microsatellites. the suitability of this marker in sheep genetic diversity.

Journal of Animal Science, 82, 2246-2252.The lack of clear differentiation between Bulgarian sheep

Arora R and Bhatia S, 2004. Genetic structure of Muzzafarnagri breeds could be due to geographic proximity, similarity in

sheep based on microsatellite analysis. Small Ruminant Research, environment and breeding practices but most likely to the past and

54, 3, 227-230.present gene flow among them. As the breeds considered in this

Arranz J, Bayoan Y and San Primitivo F, 2001. Genetic variation at study have never been genetically characterized before it was not

microsatellite loci in Spanish sheep. Small Ruminant Research, 39, always possible to compare our data with that reported in the

3-10.literature. Previous studies (Kusza et al., 2010) on the genetic

Baulov M, Alexieva S, 1991. Genetic Polymorphism in Blood of relationship among five Bulgarian sheep breeds using 16 SSR markers also showed positive Fis values for the three indigenous Native Sheep Breeds. 1. Erythrocitic Enzymes and Proteins. Journal Bulgarian sheep breeds – Patch-Faced Maritza (0.246), White of Genetics and Breeding, 24, l, 62-66.Maritza (0.275) and Pleven Blackhead (0.376). Cañon J, Garćıa D, Garćıa-Atance M A, Obexer-Ruff G, Lenstra

In this study the two examined populations displayed J A, Ajmone-Marsan P, Dunner S and the Econogene heterozigosity deficiencies. Regardless of significant heterozygote Consortium, 2006. Geographical partitioning of goat diversity in deficit the mean levels of Ho were relatively high in the investigated Europe and the Middle East. Animal Genetics, 37, 4, 327-334.here sheep breeds (0.543–0.621), compared to these reported by Diez-Tascon C, Littlejohn RP, Almeida PA and Crawford AM, Kusza et al. (2010) (0.458–0.577). Generally, both populations 2000. Genetic variation within the Merino sheep breed: Analiysis of showed high level of genetic diversity with an average 0.793 which is closely related populations using microsatellites. Animal Genetics, close to that published by Oliveira et al. (2005) for Bordaleira de 31, 4, 243-251. Entre Douro e Minho sheep (0.740), Alvarez et al. (2004) for Latxa EASRAB, 2011. Livestock breeds in rhe republic of Bulgaria.

rdsheep (0.770) and Kusza et al. (2010) for five Bulgarian sheep Catalogue, 3 edition.Vassil Nicolov (Ed.). Sofia, Bulgaria.breeds (0.736). El-Nahas Soheir M, Hassan Amal A, Abou Mossallam Ahlam A,

In this study the genetic distances among the examined Mahfouz Eman R, Bibars Mona A, Oraby Hanaa AS and de Hondt populations were relatively low, but higher than 0.05, which may HA, 2008. Analysis of genetic variation in different sheep breeds indicate certain differences in their genetic structure. The closed using microsatellites, African Journal of Biotechnology, 7, 8, 1060-genetic relatedness (0.083) found between CRSH and KKCH is in 1068.accordance with their similar phenotypic traits. Both breeds are short Excoffier L and Lischer H, 2010. Arlequin suite ver 3.5 (09.2011). thin-tailed type with black-brown colour of the wool, predominantly A new series of programs to perform population genetics analyses coarse. Panaiotov et al. (2003) recorded similar average live weight under Linux and Windows. Molecular Ecology Resources 10, 564-of animals at 18 months for CRSH and KKCH (35.8 and 32.6 kg, 567. http://cmpg.unibe.ch/software/arlequin3. respectively). The ratio body height/length is also similar (59/65sm Gutiérrez-Gil B, Uzun M, Arranz J, Primitivo F S, Yildiz S, for CRSH and 57/65.5sm for KKCH (EASRAB, 2011). Cenesiz M and Bayon Y, 2006. Genetic diversity in Turkish sheep,

Acta. Agriculturae Scandinavica, Section A. Animal Science, 56, 1, Conclusions 1-7.

Hassan A A, Abou Mosallam HA, Oraby HA, de Hondt and El-The present study provides an important information about the Nahas SM, 2003. Genetic Diversity of Three Sheep Breeds in Egypt

Table 4. Population-specific alleles

Locus Frequency of specificalleles (%)

Breed

KKCHMAF70

ILSTS11

OarJMP58 CRSH

Allele size(bp)

149

171

286

133

173

15.789

15.789

5.263

2.703

8.108

Page 8: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

370

Based on Microsatellites Analysis. Journal of genetic Engineering Portuguesa de Ciencias Veteterinarias, 100, 175-180.and Biotechnology, (NRC), 1, 1, 141-150. Panaiotov D, Pamukova D and Iliev M, 2003. Phenotypic Kusza S, Dimov D, Nagy I, Bosze Z, Jávor A and Kukovics S, characteristic of Local aboriginal sheep breeds- Mednochervena 2010. Microsatellite analysis to estimate genetic relationships Shumenska, Mestna Karnobatska, Karakachanska. Journal of among five bulgarian sheep breeds. Genetics and Molecular Animal Science, 5, 21-24 (Bg).Biology, 33, 1, 51-56. Staykova G, 2005. Study on the value of the productive traits in Makaveev Ts and Nakev S, 1987. Genetic Polymorphism of Blood sheep from the Karakachan breed and Copper-Red Shumen strain, Serum Proteins in Native Copper-Red Shoumen Sheep Breed. 152 (Bg).Animal Science, 24, 10, 83-87. Yeh F and Yong R, 1999. POPGENE version 1.31 (02.04.2011). Oliveira C, Gutierrez-Gil B, Pedrosa S, Barbosa E, Dantas R, Microsoft-based Freeware for Population Genetic Analysis. Leite J, Brito N, Arranz J and Bayon Y, 2005. Genetic University of Alberta, Edmonton, Canada. http://www.ualberta.ca/~ characterization of Bordaleira de Entre Duoro e Minho and Serra da fyeh/fyeh.Estrela sheep breeds: Nuclear and mitochondrial DNA. Revista

Page 9: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

Genetics and Breeding

Nutrition and Physiology

Investigation on the possibility to efficiently use Ukrainian cultivars for developing of early winter wheat linesI. Grain productivityN. Tsenov, T. Petrova, E. Tsenova

Combinig ability for grain yield of late maize linesN. Petrovska

Use of recurrent selection in middle late synthetic maize populationI. Results of the first cycle in synthetic “1/2005”N. Petrovska, V. Valkova

Genetic diversity and distance between two Bulgarian local sheep breeds assessed by microsatellite markersS. Georgieva, E. Todorovska, D. Hristova, I. Dimitrova, N. Stancheva, Ts. Yablanski

Testing of new Bulgarian sunflower hybrids under the conditions of North-East BulgariaI. Productivity and traits related to productivityG. Georgiev, P. Peevska, E. Penchev

Comparative morphological study of new Burley tobacco linesT. Radoukova, Y.Dyulgerski

Effect of genotypic and environmental factors on the inheritance of the main characters in chickpea and relationships between themR. Sturzu, T. Nistot, Cr. Melucă, Fl. Bodescu, A. Stoilova

Evaluation of double haploid lines of winter malting barley using selection indicesB. Dyulgerova, D. Valcheva

Evaluation of the combining ability of grain yield of mutant maize lines M. Ilchovska

Comparative study of some biochemical indicators in Karakachan and Copper-Red Shumen sheep breedsG. Angelov, I.Dimitrova, T. Mehmedov, P. Stamberov, N. Stancheva, S. Georgieva, Zh. Nakev

Impaired pancreatic function in mulard ducks with experimental aflatoxicosis I. Valchev, N. Grozeva, D. Kanakov, Ts. Hristov, L. Lazarov, R. Binev, Y. Nikolov

Comparative investigations on feeding efficiency in growing and fattening DanBred and Topigs hybrid pigsG. Ganchev, A. Ilchev

Blood parameters in yearling sheep fed Paulownia (Paulownia spp.) leavesI. Varlyakov, V. Radev, T. Slavov, G. Ganchev

CONTENTS 1 / 2

AGRICULTURAL SCIENCE AND TECHNOLOGY, VOL. 5, No 4, 2013

351

358

362

367

371

376

380

388

400

405

391

394

384

Page 10: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

Changes in some blood parameters in yearling rams fed diets with different protein and lipid levelsV. Radev, T. Slavov, I. Varlyakov

Effect of the sowing norm and nitrogen fertilization on the yield from dry bean (Phaseolus vulgaris L.) cultivar Beslet G. Milev

Evapotranspiration of corn crop for silageR. Bazitov, A. Stoyanova

Productivity and economic traits of winter oilseed rape (Brassica napus var. biennis) under the conditions of DobrudzhaG. Georgiev, G. Georgiev, P. Chamurliyski

Feasibility of the use of heat energy from alternative sources for air conditioning in sows facilityK. Peichev, R. Georgiev

Productivity of green beans, irrigated at different pre-irrigation soil moistureR. Petrova, A. Matev, K. Koumanov, B. Harizanova-Petrova

Comparative assessment of plant resources as substrates for bioshlam productionZ. Shindarska, V. Kirov, G. Kostadinova, B. Baykov

The influence of organic carbon on bioremediation process of wastewater originate from aquaculture with use of microalgae from genera Botryococcus and Scenedesmus I. Sirakov, K. Velichkova, G. Beev, Y. Staykov

Sanitary hygienic assessment of drinking water from underground source at a pig farmG. Kostadinova

Study of bee honey by spectral analysis in the near infrared spectrumI. Zhelyazkova, S. Atanasova , K. Elencheva – Karaneycheva

Comparative GC/MS analysis of lavender (Lavandula angustifolia Mill.) inflorescence and essential oil volatilesT. Zagorcheva, S. Stanev, K. Rusanov, I. Atanassov

Influence of key factors on the time of initial coagulation of cow's milk using milk-clotting enzyme of camel originP. Panayotov, K. Yoanidu, P. Boyanova, B. Milenkov

Production Systems

Agriculture and Environment

Product Quality and Safety

CONTENTS 2 / 2

AGRICULTURAL SCIENCE AND TECHNOLOGY, VOL. 5, No 4, 2013

410

415

420

424

428

432

438

443

448

455

459

463

Page 11: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

Instruction for authors

Preparation of papersPapers shall be submitted at the editorial office typed on standard typing pages (A4, 30 lines per page, 62 characters per line). The editors recommend up to 15 pages for full research paper ( including abstract references, tables, figures and other appendices)The manuscript should be structured as follows: Title, Names of authors and affiliation address, Abstract, List of keywords, Introduction, Material and methods,Results, Discussion, Conclusion, Acknowledgements (if any), References, Tables, Figures.The title needs to be as concise and informative about the nature of research. It should be written with small letter /bold, 14/ without any abbreviations. Names and affiliation of authorsThe names of the authors should be presented from the initials of first names followed by the family names. The complete address and name of the institution should be stated next. The affiliation of authors are designated by different signs. For the author who is going to be corresponding by the editorial board and readers, an E-mail address and telephone number should be presented as footnote on the first page. Corresponding author is indicated with *.Abstract should be not more than 350 words. It should be clearly stated what new findings have been made in the course of research. Abbreviations and references to authors are inadmissible in the summary. It should be understandable without having read the paper and should be in one paragraph. Keywords: Up to maximum of 5 keywords should be selected not repeating the title but giving the essence of study. The introduction must answer the following questions: What is known and what is new on the studied issue? What necessitated the research problem, described in the paper? What is your hypothesis and goal ?Material and methods: The objects of research, organization of experiments, chemical analyses, statistical and other methods and conditions applied for the experiments should be described in detail. A criterion of sufficient information is to be possible for others to repeat the experi-ment in order to verify results.Results are presented in understandable

tables and figures, accompanied by the statistical parameters needed for the evaluation. Data from tables and figures should not be repeated in the text.Tables should be as simple and as few as possible. Each table should have its own explanatory title and to be typed on a separate page. They should be outside the main body of the text and an indication should be given where it should be inserted.Figures should be sharp with good contrast and rendition. Graphic materials should be preferred. Photographs to be appropriate for printing. Illustrations are supplied in colour as an exception after special agreement with the editorial board and possible payment of extra costs. The figures are to be each in a single file and their location should be given within the text. Discussion: The objective of this section is to indicate the scientific significance of the study. By comparing the results and conclusions of other scientists the contribution of the study for expanding or modifying existing knowledge is pointed out clearly and convincingly to the reader.Conclusion: The most important conse- quences for the science and practice resulting from the conducted research should be summarized in a few sentences. The conclusions shouldn't be numbered and no new paragraphs be used. Contributions are the core of conclusions. References:In the text, references should be cited as follows: single author: Sandberg (2002); two authors: Andersson and Georges (2004); more than two authors: Andersson et al.(2003). When several references are cited simultaneously, they should be ranked by chronological order e.g.: (Sandberg, 2002; Andersson et al., 2003; Andersson and Georges, 2004).References are arranged alphabetically by the name of the first author. If an author is cited more than once, first his individual publications are given ranked by year, then come publications with one co-author, two co-authors, etc. The names of authors, article and journal titles in the Cyrillic or alphabet different from Latin, should be transliterated into Latin and article titles should be translated into English. The original language of articles and books translated into English is indicated in parenthesis after the bibliographic reference (Bulgarian = Bg, Russian = Ru, Serbian = Sr, if in the Cyrillic, Mongolian =

Мо, Greek = Gr, Georgian = Geor., Japanese = Jа, Chinese = Ch, Arabic = Аr, etc.)The following order in the reference list is recommended:Journal articles: Author(s) surname and initials, year. Title. Full title of the journal, volume, pages. Example:Simm G, Lewis RM, Grundy B and Dingwall WS, 2002. Responses to selection for lean growth in sheep. Animal Science, 74, 39-50Books: Author(s) surname and initials, year. Title. Edition, name of publisher, place of publication. Example: Oldenbroek JK, 1999. Genebanks and the conservation of farm animal genetic resources, Second edition. DLO Institute for Animal Science and Heal th, Netherlands.Book chapter or conference proceedings: Author(s) surname and initials, year. Title. In: Title of the book or of the proceedings followed by the editor(s), volume, pages. Name of publisher, place of publication. Example: Mauff G, Pulverer G, Operkuch W, Hummel K and Hidden C, 1995. C3-variants and diverse phenotypes of unconverted and converted C3. In: Provides of the Biological Fluids (ed. H. Peters), vol. 22, 143-165, Pergamon Press. Oxford, UK.Todorov N and Mitev J, 1995. Effect of level of feeding during dry period, and body condition score on reproductive perfor-

thmance in dairy cows,IX International Conference on Production Diseases in Farm Animals, Sept.11 – 14, Berlin, Germany, p. 302 (Abstr.).Thesis:Penkov D, 2008. Estimation of metabolic energy and true digestibility of amino acids of some feeds in experiments with muscus duck (Carina moshata, L). Thesis for DSc. Agrarian University, Plovdiv, 314 pp.

The Editorial Board of the Journal is not responsible for incorrect quotes of reference sources and the relevant violations of copyrights.EthicsStudies performed on experimental animals should be carried out according to internationally recognized guidelines for animal welfare. That should be clearly described in the respective section “Material and methods”.

Page 12: ISSN 1313 - 8820 olume December - Trakia Universitytru.uni-sz.bg/ascitech/4_2013/004.pdf · submission letter signed by all authors. The form of the submission letter is available

Volume 5, Number 4December 2013