12
International Journal of Advanced Biotechnology Research. ISSN 2249-3166 Volume 7, Number 1 (2017), pp. 13-23 © Research India Publications http://www.ripublication.com Isolation,characterization and optimization of catechol degrading Pseudomonas aeruginosa from Cashew Industrial soil Parvathy.G, and Prabhakumari .C Department of Biotechnology, CEPC Laboratory and Research Institute , Mundakkal, Kollam, India., Abstract Catechol is a reaction intermediate in the bacterial metabolism of phenol, benzoic acid, anthranilic acid and other compounds. Among the most abundant environmental pollutants; catechol and related products are of major concern because of their long term persistence and the toxicity.Industrial emissions and disposal, treatment or recycling must comply with applicable regulations to preserve environment.Therefore, the removal of catechol is vital before letting it into the environment.The present study made an attempt to find out the biodegradation of catechol by using microorganisms isolated from cashew industrial soil. Eleven morphologically different strains were isolates. Amoung these microbes one bacteria shows promising degradation of catechol up to 100 mg/l. Morphological and Molecular studies was done and identified as Pseudomonas aeruginosa. Batch studies are done by using the pure culture of Pseudomonas aeruginosa, catechol degradation was setup at various pH (5, 6, 7, 8, 9) and temperature (10, 20, 30, 40, 50) 0 C. Maximum catechol degradation was at pH 7 and temperature 30 0 C. From this study we can concluded that the Pseudomonas aeruginosa. is one of the efficient catechol degraders and has wide application in the field of bioremediation. INTRODUCTION One of the worldwide problem faced by envirornment is pollution and its potential to influence the health of human populations is great (Fereidoun et al, 2007; Progressive Insurance, 2005). The significance of environmental factors to the health and well- being of human populations’ is increasingly apparent (Rosenstock 2003; World Health Organization [WHO], 2010b) in the densely settled urban-industrial Pollution

Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

Embed Size (px)

Citation preview

Page 1: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

International Journal of Advanced Biotechnology Research.

ISSN 2249-3166 Volume 7, Number 1 (2017), pp. 13-23

© Research India Publications

http://www.ripublication.com

Isolation,characterization and optimization of

catechol degrading Pseudomonas aeruginosa from

Cashew Industrial soil

Parvathy.G, and Prabhakumari .C

Department of Biotechnology, CEPC Laboratory and Research Institute ,

Mundakkal, Kollam, India.,

Abstract

Catechol is a reaction intermediate in the bacterial metabolism of phenol,

benzoic acid, anthranilic acid and other compounds. Among the most

abundant environmental pollutants; catechol and related products are of major

concern because of their long term persistence and the toxicity.Industrial

emissions and disposal, treatment or recycling must comply with applicable

regulations to preserve environment.Therefore, the removal of catechol is vital

before letting it into the environment.The present study made an attempt to

find out the biodegradation of catechol by using microorganisms isolated

from cashew industrial soil. Eleven morphologically different strains were

isolates. Amoung these microbes one bacteria shows promising degradation of

catechol up to 100 mg/l. Morphological and Molecular studies was done and

identified as Pseudomonas aeruginosa. Batch studies are done by using the

pure culture of Pseudomonas aeruginosa, catechol degradation was setup at

various pH (5, 6, 7, 8, 9) and temperature (10, 20, 30, 40, 50)0 C. Maximum

catechol degradation was at pH 7 and temperature 300C. From this study we

can concluded that the Pseudomonas aeruginosa. is one of the efficient

catechol degraders and has wide application in the field of bioremediation.

INTRODUCTION

One of the worldwide problem faced by envirornment is pollution and its potential to

influence the health of human populations is great (Fereidoun et al, 2007; Progressive

Insurance, 2005). The significance of environmental factors to the health and well-

being of human populations’ is increasingly apparent (Rosenstock 2003; World

Health Organization [WHO], 2010b) in the densely settled urban-industrial Pollution

Page 2: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

14 Parvathy.G, and Prabhakumari .C

reaches its most serious problem.(Kromm, 1973). Over the last three decades there

has been increasing global concern over the public health impacts attributed to

environmental pollution (Kimani, 2007). Environmental pollutants are compounds

that are toxic to living organisms; released into the ecosystem at high concentrations,

usually as a consequence of human activities. Catechol and related products are of

major concern because of their long term persistence and the toxicity The

International Agency for Research on Cancer (IARC) has classified catechol as a

Group 2B, possible human carcinogen.

Catechol used as industrial reagent in the manufacturing of dyes rubber plastics and

pharmeceuticals and cosmetics, in the production of insectiscides in metal plating and

coal refining. Catechol is very soluble in water and readily biodegradable. It has a low

potential for bioaccumulation. Various treatment strategies are available for its

removal; (M. Stanisavljevic and L. Nedic., 2004). Phenol biodegradation has been done by

applying different kinds of microbial culture in two recent decades.Many aerobic

bacteria have been confirmed to use aromatic compounds as the sole source of carbon

and energy (Paller et al., 1995), which suggests to use catechol as nutrient to the

organism and thereby converts catechol to nontoxic component. However, its removal

by biological means is much cheaper, less energy consuming and above all,

environment friendly.

India is largest producer, processor, exporter and second largest consumer of cashew

in the world. Kerala is the main processing and exporting center of cashew. The

industry provides livelihood for about 6-7 lakhs of employees and farmers, the

cashew industry has national importance. (Anonymous, 2009).The soil near to cashew

industry contains cashew nut shell liquid, a phenolic compound that is oozing out

from the cashew nut shell during the processing of cashew nut,contains a wide variety

of microbial population which has ability for degrading phenolic compounds.

Biological methods for the removal of phenolic compounds are possible because

some organisms have the capacity to degrade phenol utilizing it as their nutrients

(Kanekar et. al, 1999, Catia et.al, 2010). The aim of this work was to isolate catechol

degrading microorganisms from cashew industrial soil.

MATERIALS AND METHODS

Sampling

In this study the soil samples were collected from cashew industry near

Kollam,Kerala. The samples were put into sterile bottles, then into the containers full

of ice and then transferred to lab and stored in the refrigerator at temperature 4ºC prior

to analysis.

Page 3: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

Isolation,characterization and optimization of catechol degrading Pseudomonas… 15

Isolation of catechol degrading bacteria

For this experiment microorganisms were isolated from three different sites in cashew

industry near Kollam, Kerala. Pure colonies were isolated from spread plate method

using mineral salt medium (MSM) containing 1% v/v catechol. Firstly, different types

of colonies were selected and taken by using sterile loop and streaked onto mineral

salt medium agar plate containing 1% v/v catechol concentration. Then, the plates

were incubated overnight at 30°C. The growth of pure colonies was observed after 24

hours.

Screening of catechol degrading bacteria

Eleven different bacteria were labeled and cultured on nutrient agar and incubated for

24 hours at 37°C. Then, a single colony of each bacteria was inoculated into nutrient

broth and incubated at 37°C for 24 hours at 150 rpm. Then, the broths were

centrifuged at 4000 rpm at 4°C for 15 minutes. Supernatants were decanted and

pellets containing bacterial cells were centrifuged with 0.8 % NaCl twice to ensure

removal of all broth components The supernatant was thrown away and the pellet was

centrifuged again with 10 mL of 0.8% solution NaCl.

The centrifuged pellet of eleven bacteria were inoculated into 250mL conical flask

containing 100 mL mineral salt medium (Zajic and Supplison 1972) and 10 ppm

catechol. The medium was adjusted to pH 7.0. Each sample was assayed in replicates.

The samples were incubated at 150 rpm for 4 days, at 37°C. 1 mL of culture was

centrifuged at 5000 rpm for 10 minutes and assayed the biodegradation of catechol

colourimetrically by Folins Ciocalteous Method at 12 hour interval of time using UV-

VIS spectrophotometer and measured at 555 nm.

Identification of catechol degrading bacteria

Identification was done on one isolated catechol degrading bacteria, were

characterized and identified by their morphological characteristic based on size, shape

and colony morphology on nutrient agar plate the isolates were examined by gram

staining and Biochemical tests.

16S rRNA sequencing

Genomic DNA was isolated using NucleoSpin® Tissue Kit (Macherey-Nagel).

Sequencing of 16S rRNA region using universal primers

5’CAGGCCTAACACATGCAAGTC3’, 5’GGGCGGWGTGTACAAGGC3’

Page 4: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

16 Parvathy.G, and Prabhakumari .C

Catechol degradation under varying initial catechol concentrations.

10 ml of the isolate was centrifuged and the pellet was washed with 0.8% Nacl.Then

the pellet was added to 100 ml of mineral salt media containing different

concentration of catechol ie. 5, 10, 50, and 100mg/L and carried out in standard flask

culture experiments. These flasks were kept in dark to avoid photo decomposition.

1ml of sample were removed at different time intervals and microbial growth was

monitored by UV-Visible Spectrophotometer at 550nm. Then the samples were

clarified by centrifugation at 5000rpm for 10 minutes and supernatants were subjected

to Folins-Ciocalteus spectrophotometric method for monitoring the catechol

concentration.

Effect of different pH and temperature on catechol degradation.

10 ml of the isolate was centrifuged and the pellet was washed with 0.8% Nacl.Then

the pellet was added to 100 ml of mineral salt media containing different

concentration of catechol ie. 5, 10, 50, and 100mg/L and carried out in standard flask

culture experiments. These flasks were kept in dark to avoid photo decomposition.

1ml of sample were removed at different time intervals and microbial growth was

monitored by UV-Visible Spectrophotometer at 550nm. Then the samples were

clarified by centrifugation at 5000rpm for 10 minutes and supernatants were subjected

to Folins-Ciocalteus spectrophotometric method for monitoring the catechol

concentration.

RESULTS AND DISCUSSIONS

Isolation of catechol degrading bacteria

Three soil samples were collected from three different sites of Cashew Industry near

Kollam. Eleven different isolates are isolated, out of which one bacteria with high

potential to degrade catechol was selected for further studies.

Figure 1. Isolate on nutrient agar.

Page 5: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

Isolation,characterization and optimization of catechol degrading Pseudomonas… 17

Identification of catechol degrading bacteria

The potential isolate was characterized based on their gram reaction characteristics,

morphological features and biochemical properties. The results showed that the

isolate is a gram negative rod and the biochemical characterization are explained in

the table.(Table:1)

Table: 1 Biochemical Characterization of the isolate

S.No Test Response of the organism

1 Gram staining -

2 Indole -

3 Methyl Red -

4 Voges proskauer -

5 Simmon citrate agar +

6 Oxidase +

7 Catalase +

8 Gelatin Liquefaction + (Rapid liquefaction)

9 Triple Sugar iron Agar +

10 Nitrate reduction +

11 Glucose +

12 Lactose -

13 Fructose -

(+ = Positive reaction, - = Negative reaction)

16S rRNA sequencing

Genomic DNA was isolated using NucleoSpin® Tissue Kit (Macherey-Nagel).

Sequencing of 16S rRNA region using universal primers

5’CAGGCCTAACACATGCAAGTC3’, 5’GGGCGGWGTGTACAAGGC3’

Page 6: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

18 Parvathy.G, and Prabhakumari .C

Figure :2 DNA

Figure :3 PCR

Page 7: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

Isolation,characterization and optimization of catechol degrading Pseudomonas… 19

Figure 4. Phylogenetic analysis of strain PSEUDOMONAS AERUGINOSA PG4

16srRNA gene sequence with other PSEUDOMONAS AERUGINOSA species/strains

Catechol degradation under varying initial catechol concentrations.

The Isolate has an ability to degrade phenol up to 100 mg/l (Fig:6). 100 ppm was the

initial concentration after that a rapid decrease in phenol concentration in 96 hour.

This shows that the Isolate has a potential ability to degrade the phenol and has a wide

application in the field of bioremediation. Catia et al (2010) (Figure 5)

Page 8: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

20 Parvathy.G, and Prabhakumari .C

Figure 5: Catechol degradation under varying initial catechol concentrations.

Figure 6: Effect of different pH on catechol degradation.

0

20

40

60

80

100

120

0 12 24 36 48 60 72 84 96 108

Cat

ech

ol (

mg/

l)

Hours

Catechol Degradation

Catechol Degradation

0

2

4

6

8

10

12

0 12 24 36 48 60 72

Cat

ech

ol (

mg/

l)

Hours

CATECHOL DEGRADATION AT DIFFERENT pH

ph 6

ph 5

ph 7

ph 8

ph 9

Page 9: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

Isolation,characterization and optimization of catechol degrading Pseudomonas… 21

Figure 7: Effect of different temperature on catechol degradation.

Effect of different pH and temperature on catechol degradation.

To determine the effect of temperature and pH on phenol degradation the experiments

were carried out at different temperatures such as 100C 200C, 300C, 400C and 500C at

pH ranges from (5,6,7,8,9). The data shows that there was maximum phenol

degradation takes place at room temperature of 300C and on further increase in

temperature the rate of biodegradation decreases because the catalytic activity of the

enzymes is starts to decrease beyond that temperature. So the optimum temperature

for the maximum enzymatic activity is 300C and for pH, the results show that there

was maximum phenolic degradation occurs maximum at neutral pH due to maximum

utilization of carbon source (Figure 6&7).

At acidic or basic pH there is reduction in phenolic degradation due to the fact at that

culture utilize less carbon source. Viraraghavan and Rao (2002), used the cells of

Isolate .to treat the effluent of many waste water treatment plants to remove the

phenol from aqueous solution. Most of the organisms, cannot tolerate the pH values

below 4.0 and above 9.0 as because the acids and bases which can easily entered in to

the cell which affect the metabolic pathway and denature the proteins finally leads to

lethality Bandyopadhyay,et al (1998) & Annadurai et al (2000).

0

2

4

6

8

10

12

0 12 36 48 60 72

Cat

ech

ol (

mg/

l)

Hours

CATECHOL DEGRADATION AT DIFFERENT TEMPERATURE

10 C

20 C

30 C

40 C

50 C

Page 10: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

22 Parvathy.G, and Prabhakumari .C

CONCLUSION

From the above study it was concluded that the catechol is one of the most important

effluent of so many industries and it is harmful to the human system, so it has to be

removed. Biodegradation is a simple, cost effective method for the removal of

catechol and other effluents to protect the environment. In the present study we isolate

the Pseudomonas aeruginosa from Cashew Industry near Kollam for the

biodegradation of phenol. The Isolate degrade phenol up to 100mg/l. The catechol

degradation by Pseudomonas aeruginosa .was maximum at room temperature of 300

C and the degradation of catechol is maximum at neutral pH. Bioremediation is one of

the most effective method for the removal of catechol and it has wide application for

removing environmental pollutants.

ACKNOWLEDGEMENT

Authors are highly grateful to the CEPC Laboratory and Technical Division,

Mundakkal, Kollam for allowing us to carry out such a noble work for pollution free

environment.

REFERENCE

[1] Annadurai. G, Balan .M.S, and Murugesan .T, Design of experiments in the

biodegradation of phenol using immobilized Pseudomonas pictorium (NICM

– 2077) on activated carbon. Bioprocess Engineering 2000; 22: 101-107.

[2] Anonymous, 2008. Air pollution http// en. Wikipedia. Org/ wiki/ Air

pollution, Retrieved.

[3] Bandyopadhyay.D, Das, D. and Maitri. B.M , Kinetics of phenol degradation

using Pseudomonas putida MTCC 1194’. Bioprocess Engineering, 1998; 18:

373–377

[4] Catia T.D.P , Mariano.M ,Janaína. F, Medeiros. B , Susana. J.K, Carlos .A

and.Veiga.B , Biodegradation of phenol by free and encapsulated cells of a

new Aspergillus sp. isolated from a contaminated site in southern Brazil, Afri J

Biotechnol. 2010; 9(40): 6716-6720.

[5] The Environmental Protection Agency (EPA). Collation of toxicological data

and intake values for humans. EPA Report. 2004, pp: 44-64.

[6] Fereidoun. H, Nourddin .M.S, Rreza .N.A, Mohsen .A, Ahmad .R &

H.Pouria,The Effect of Long-Term Exposure to Particulate Pollution on the

Lung Function of Teheranian and Zanjanian Students, Pakistan Journal of

Physiology.2007;3, (2): pp. 1-5.

Page 11: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

Isolation,characterization and optimization of catechol degrading Pseudomonas… 23

[7] Kanekar PP, Sarnaik SS and Kelkar AS. Bioremediation of phenol by

alkaliphilic bacteria isolated from alkaline Lake of Lonar, India. J. Appl.

Microbiol.Symposium Suppl.1999; 85:1285-1335

[8] Kimani, N. G. Environmental Pollution and Impacts on Public Health:

Implications of the Dandora Dumping Site Municipal in Nairobi, Kenya,

United Nations Environment Programme, 2007. pp. 1-31.

[9] Kromm, D. E. Response to Air Pollution in Ljubljana, Yugoslavia, Annals of

the Association of American Geographers, 1973. 63(2), pp. 208-217.

[10] Paller, G., Hommel, R.K and Kleber, H.P. Phenol degradation by

Acinetobacter calcoaceticus NCIB 8250. J. Basic Microbial. 1995. 35 : 325-

335

[11] Progressive Insurance, Pollution Impact on Human Health. Retrieved from

http://www.progressiveic.com/n25feb05.htm, 2005

[12] Rosenstock, L. . The Environment as a Cornerstone of Public Health,

Environmental Health Perspectives, 2003 111(7), pp. A376-A377.

[13] Stanisavljević . M and Nedić., L Removal of Phenol from Industrial

Wastewaters by Horseradish (Cochlearia armoracia L.), Working and Living

Environmental Protection, 2004.2(4), 345-349

[14] Viraraghavan .T and Rao. J.R., “Biosorption of phenol from an aqueous

solution by Aspergillus niger biomass”, Bioresource Technology, 2002; 85 pp:

165-171.

[15] Zajic, E. & Supplison, B. 1972. Emulsification and degaradation of “Bunker

C” fuel oil by microorganisms. Biotechnology and Bioengineering 14: 331-

334.

Page 12: Isolation,characterization and optimization of catechol ... · from the cashew nut shell during the processing of cashew nut,contains a ... Isolate .to treat the effluent of many

24 Parvathy.G, and Prabhakumari .C