ISOLATION OF O-ACETYLSERINE THIOL LYASE GENOMIC DNA SEQUENCE FROM LEUCAENA LEUCOCEPHALA VIA PCR

Abirame AlP Segaran (33657)

QL Bachelor of Science with Honours

(Resource Biotechnology)L8 2015A149

2015

561

ACKNOWLEDGEMENTS

With completion of this thesis, there are many who deserve a word of appreciation. First, I

would like to express my sincere appreciation and deepest gratitude to my supervisor, Dr.

Ho Wei Seng, Faculty of Resource Science and Technology, UNIMAS, who had provided

me the opportunity to perform and complete my final year project research in Forest

Genomics and informatics Laboratory. Thanks a million for his countless advice, patience

and guidance, definitely deserves more recognition than a word of merit.

Extended assistance from the postgraduates in Forest Genomics and informatics

Laboratory is much treasured too. My truthful gratitude goes to especially, Miss Natalie

anak Gali for her guidance, advices and patience. She had dispensed wisdom on assortment

of basic molecular techniques which helped me a lot in performing the research. She spent

many hours ofmeticulous care in helping me to complete the research besides giving me

the very important knowledge on how to use th~ software and analyse my result data.

Next, I WQuld like to thank all my friends who had been with me with their constant

support throughout the progression of the thesis since day one. Last but not least, I would

like to express my gratitude to my lovely family members who always supporting me,

accommodating and understanding in every way.

Thank you all who ha&made this thesis a success.

UNIVERSITI MALAYSIA SARAWAK

Grade: __________

Please tick (-.1) Final Year Project Report [;2] Masters D PhD D

DECLARATION OF ORIGINAL WORK

This declaration is made on the ...?:.~ ........day of.J.~~~~~Y ..201~

Student's Declaration:

I _~1?~B~~f __~_lf __~~~_~_~E_~_~_~_~~~_:f:_,.J_~_~~hT_~ __~[__~~~~~_~~~ ___~_~~~~_~_~ _~_~_I~_(~~_~_~ct-~. ------- (PLEASE INDICATE STUDENT'S NAME, MATRIC NO. AND FACULTY) hereby ~ declare th;:t,t the work entitled ;I;~~l~:E~_':LM'__Q:-_~~~~~_iJ!~'--~~L~~_LU~J_~__~~tl1~~~~______~_ L~c~liIo, 'lU{Ot£.;;'~11i \lltI -PCp... . , .-------1". IS my ongmal work. I have not copIed from any other students work or from any other sources except where due reference or acknowledgement is made explicitly in the text, nor has any part been written for me by another person.

Date submitted Name of the student (Matric No.)

Supervisor's Declaration:

1-------------------------------------------------------------- (SUPERVISOR'S NAME) hereby certifies that.. the work entitled ---------------------------------------------------------.--- ---------------- (TITLE) was prepared by the above named student, and was submitted to the "FACULTY" as a * partial/full fulfillment for the conferment of --------------------------------------------------------------- ---------­. (PLEASE INDICATE THE DEGREE), and the aforementioned work, to the best of my knowledge, is the said student's work.

Received for examination by: Date:_________

(Name of the supervisor

ii

I

I declare that Project/Thesis is classified as (Please tick C-J»:

D CONFIDENTIAL (Contains confidential information under the Official Secret Act 1972)* DRESTRICTED (Contains restricted information as specified by the organisation where

research was done)* DOPEN ACCESS

Validation of ProjectIThesis

I therefore duly affirm with free consent and willingly declare that this said Project/Thesis shall be placed officially in the Centre for Academic Information Services with the abiding interest and rights as follows:

• This Project/Thesis is the sole legal property of Universiti Malaysia Sarawak (UNIMAS).

• The Centre for Academic Information Services has the lawful right to make copies for the purpose of academic and research only and not for other purpose.

• The Centre for Academic Information Services has the lawful right to digitalise the content for the Local Content Database.

• The Centre for Academic Information Services has the lawful right to make copies of the Project/Thesis for academic exchange between Higher Learning Institute.

• No dispute or any claim shall arise from the student itself neither third party on this Project/Thesis once it becomes the sole property of UNIMAS.

• This ProjectlThesis or any material, data and information related to it shall not be distributed, published or disclosed to any party by the student except with UNIMAS permission.

cAr: Student signature _2_3_1_,_!_?l)_r_~___ Supervisor signature: _______

(Date) (Date)

Current Address: Lc.. £50, ;]~N PI4Yf}-(Y)f)$ TArt1AN S't}JTOSIl,

Notes: * If the ProjectlThesis is CONFIDENTIAL or RESTRICTED, please attach together as annexure a letter from the organisation with the period and reasons of confidentiality and restriction.

[The instrument is duly prepared by The Centre for Academic Information Services]

iii

I

I

Pusat Khic1 mat l 1aklumat Akadcl. " UNlVERSfTI MALAY fA SAW WA"

TABLE OF CONTENTS

Acknowledgement

Declaration

Table of Contents

List of Abbreviations

List of Figures

List of Tables

Abstract

Introduction

Literature Review

2.1 Selection of Species Studied

2.1.1 Family Fabaceae

2.1.2 Genus

2.1.3 Species - Leucaena Leucocephala

2.2 O-acetylserine (thiol) lyase

2.3 Mimosine

Materials and Methods

3.1 DNA Extraction and Purification

3.1.1 Plant Materials

3.1.2 Chemicals and Reagents

" 3.1.3 DNA Extraction and Purification Prot@col

3.2 Primer Design

3.3 PCR Amplification

3.5 DNA Sequencing and Data Analysis

Results and Discussion

4.1 DNA Isolation and Purification

4.2 Polymerase Chain Reaction (PCR)

4.3 DNA Sequencing and Data Analysis

iv

I

II

IV

VI

VII

VIII

1

2

5

5

5

6

8

9

12

12

12

12

14

14

15

16

18

20

Conclusion and Recommendation 23

References 24

v

LIST OF ABBREVIATIONS

BLAST Basic Local Alignment Search Tool

CIA Chlorofonn-Isoamyl Alcohol

CTAB Cetyltrimethylammonium Bromide

DHP 3 -h ydrox y-4( 1 H)-pyridone

DNA Deoxyribonucleic Acid

EB Extraction buffer

EDTA Ethylenediamine tetraacetic acid

HP . 3-hydroxy-4-pyridone

NCBI National Centre for Biotechnology Infonnation

OAS O-acetyl-L-serine

OAS-TL O-acetylserine (thiol) lyase

PCR Polymerase Chain Reaction

PVP Polyvinylpyrrolidone

SAT Serine acetyl transferase

vi

LIST OF FIGURES

2.1 Map showing the distribution of Leucaena, about 2393 herbarium

specimen collection sites in South Mexico with verifiable localities. 6

2.2 Biosynthetic pathways of mimosine relative to the formation of cysteine.

SA T catalyses the activation of serine to the intermediate molecule, OAS in

the cysteine synthase complex. Formation ofmimosine is catalysed by

homodimers of OAS-TL in the presence of the appropriate substrates. 9

2.3 (a) Chemical structure of mimosine. 11

2.3 (b) Transformation of mimosine into dihydroxypyridine by the rumen

of microorganisms. 11

4.1 (a) Electrophoresis of DNA sample of un purified genomic DNA. 16

4.1 (b) Electrophoresis of DNA sample of purified genomic DNA. 16

4.2 Agarose gel electrophoresis of PCR protiucts of OASTL amplified using

different T a °C. 20

4.3 Graphic display of BLAST output for similarity searching ofOASTL of

Leucaena leucocephala. 21

vii

LIST OF TABLES

Table 3.3 (a) Primer (OASTL) 14

Table 3.3 (b) PCR reaction mixture 15

Table 3.3 (c) PCR reaction cycles, temperatures and durations 15

Table 4.3 BLAST search result for amplified 1667 bp of OASTL DNA

fragment. 21

viii

Isolation of O-acetylserine (thiol) lyase (OAS-TL) Genomic DNA Sequence from Leucaena leucocephala via PCR

Abirame AlP Segaran

Resource Biotechnology Prograllll)1e Faculty of Resource Science and Technology

University Malaysia Sarawak

ABSTRACT

Leucaena leucocephala is widely used as a fodder for livestock animals due to its high nutritious value compared to other tropical plants. However, quality of the plant product as a livestock fodder became questionable due to the toxic effect by its degradation product, mimosine (b-N-[3-hydroxy-4-pyridone]-a­aminopropionic acid) to herbivores upon ingestion. Studies suggest that inactivation or reduction of these substances will improve the quality ofL. leucocephala in animal feed production. Most of the studies have been done yet focus on reducing these substances by the use of chemicals such as FeCl3 and HCI or by the degradation enzymes extracted from ruminant microorganisms. On the other hand, the enzyme 0­acetylserine thiollyase which catalyzes the synthesis of mimosine is crucial in studies to reduce mimosine content. In this study, the leaf ofLeucaena leucocephala was used to extract the total genomic DNA. Forward and reverse primers were designed based on the O-acetylserine thiollyase mRNA sequences obtained from the NCBI database. Polymerase Chain Reaction (PCR) was performed based on the standard PCR method to amplify O-acetylserine thiollyase DNA fragment. The DNA fragment of about 1.7 kb was sent for sequencing.

Key words: O-acetylserine thiollyase, OASTL gene, Leucaena leucocephala, PCR

ABSTRAK

Leucaena leucocephala digunakan secara meluas sebagai makanan bagi haiwan ternakan kerana nilai berkhasiat yang tinggi berbanding dengan tumbuhan tropika lain. Walau bagaimanapun, kualiti produk tumbuhan sebagai makanan ternakan dipersoalkan kerana kesan toksik daripada produk degradasi. mimosine (b-N-{3-hydroxy-4-pyridoneJ-a-aminopropionic asid) kepada haiwan herbivor. Kajian menunjukkan bahawa inaktivasi atau pengurangan bahan-bahan ini akan meningkatkan kualiti L. leucocephala dalam pengeluaran makanan haiwan. Kebanyakan kajian yang dijalankan hanya memberi tumpuan kepada mengurangkan bahan-bahan ini dengan menggunakan bahan kimia seperti FeCl3 dan HCI atau dengan enzim degradasi yang diekstrak daripada mikroorganisma ruminan. Sebaliknya. enzim 0­acetylserine thiollyase·Yang memangkinkan sintesis mimosine adalah penting dalam kajian untuk mengurangkan kandungan mimosine. Dalam kajian ini. daun Petai belalang telah digunakan untuk mengekstrak DNA genomik. Primers telah direka berdasarkan urutan mRNA O-acetylserine thiollyase yang diperolehi dari NCB!. Polymerase Chain Reaction (PCR) dilakukan berdasarkan kaedah PCR standard untuk mengamplifikasi O-acetylserine thiollyase DNA/ragment. Fragmentasi DNA bersaiz kira-kira 1. 7 kb telah dihantar untuk sequencing.

Kata kunci: O-acetylserine thiollyase, OASTL gene, Leucaena leucocephala, PCR

1

INTRODUCTION

Leucaena leucocephala which is locally known as petai belalang is a perennial non-

climbing, non-spiny shrub or tree. It is originated from tropical America; two of the three

subspecies now have a pan-tropical distribution facilitated by its use as a fodder, wood

source and reclamation species. Described as the 'alfalfa of the tropics', it is considered a

versatile and widely used tree legume in the tropics for various purposes. Moreover, it is

considered as a weed in more than 25 countries around the globe (Walton, 2003).

Wood products manufacturers in Malaysia are now declining the good quality

timber supply due to deforestation especially rubber woods considering it's extended uses

as a raw material to many wood based industries. Therefore, wood industry sector in

Malaysia is now looking forward to other fast growing species to sustain the demand for a

new raw material. As one of the fast growing tropical species Petai belalang (Leucaena

leucocephala) has the potential to be developed as a raw material. The Malaysian

Agricultural Research Development Institute (MARDI) has used this tree for multipurpose.

For example, it has been used for shade and wind protection in a variety of crops,

especially during earlygrowth and food for some animals (Rahman et al., 2012).

L. leucocephala (leucaena) is fast-growing, nitrogen fixing leguminous tree that is

widely distributed in tropical and subtropical countries. Leucaena can grow under different

soil and environmental conditions, such as alkaline and arid regions, and it is highly

resistant to insects and diseases. In many countries, leucaena is used as fuelwood, and for I

2

producing pulp and charcoal. Leucaena foliage is especially useful as a fodder for livestock

animals, since it has high nutritional value, comparable to alfalfa. Moreover, the protein

content of leucaena (15-18%) is much higher compared to tropical grasses and cereal

straws (3-10%) making it a valuable protein supplement to low quality forage diets. The

foliage of leucaena is highly digestible and palatable, and a rich source of macro and

micro-elements. In spite of its high nutritious value, leucaena has an undesirable feature; it

produces the toxic free ammo acid mimosine (b-N-[3-hydroxy-4-pyridone]-a­

aminopropionic acid). L-mimosine, fi-(3-hydroxy-4-pyridon-1-yl)-L-alanine and its

degradation product 3-hydroxy-4-pyridone (HP) are thyrotoxic amino acid where they

have toxic effect that can cause loss of hair in growing animals (Jkegami et al., 1990).

Therefore, leucaena can be fed to animals only in limited amounts. Mimosine is produced

by all species in the genera Leucaena and Mimosa. In the young leaves, pods, seeds, shoots

and stems, which are the parts of the plant used in animal feed, mimosine concentration

can be as high as 5% on a dry weight basis (JUDe & Borthakur, 2010).

It is important to study the gene that transcribes the synthesis of mimosine to

produce mimosine free in order to improve the quality of livestock feed products.

Unfortunately, not many studies have been carried out at present to reduce the mimosine

content in leucaena species. So far, most of the work on mimosine that has been done is

restricted to the reduction of this compound from Leucaena by the use of chemicals such

as FeC13 and Hel or by the degradation enzymes extracted from ruminant microorganisms

(Xuan et al., 2006).

3

The objective of this study was to isolate and characterise the O-acetylserine (thiol)

lyase genomic DNA sequence from Leucaena leucocephala using peR method. The .0­

acetyl serine (thiol) lyase catalyses the synthesis of mimosine in Leucaena leucocephala.

4

Pusat Khirlmat Maklumat Ak d " , "~ " a eo! ' I. YsrA SARA\ '

LITERATURE REVIEW

2.1 Selection of Species Studied

2.1.1 Family Fabaceae

Under the order of Fabales, the Fabaceae or Leguminosae is the species-rich third largest

flowering plant family and extensively distributed worldwide. Fabaceae are also

commonly known with other names like Leguminosae, legume family, legumes, bean and

pea family. There are about 720 genera in the Fabaceae family and it is further divided into

three subfamilies: Caesalpinioideae, Mimosoideae, and Faboideae (Wojciechowski, 2003).

The three subfamilies are recognized based on particular characteristics such as its flower,

size, symmetry, aestivation of petals, sepals (united or free), stamen number and

heteromorphy, pollen (single or polyads), even the presence of a pleurogram, embryo

radicle shape, leaf complexity, and presence of root nodules. These distinguishable

characteristics led to the inspection that the Mimosoideae and Papilionoideae are unique

and distinct lineages in the family which arose independently within a paraphyletic "basal"

caesalpinioid assemblage. The Dimorphandra group of tribe Caesalpinieae and papilionoid

tribe Swartzieae were considered to be respectively transitional groups between them

(Herendeen & Dilcher, 1990).

2.1.2 Genus

Leucaena (Leguminosae - Mimosoideae) is a small genus of seventeen diploid and five

tetraploid species, six infraspecific taxa, and two named hybrids. They are available from

small to medium-sized trees that grow in seasonally dry tropical forests of Mexico, Central

America and northern South America. The economic importance of Leucaena species, and

5

- --- - - -- -- -------- - -

especially L. leucocephala for the production of livestock fodder, green manure, small

wood products and for soil conservation is well known and widely acknowledged.

Map shOVlfing the distribution of ~coeno. Data points ....e 2393

herbarium specimen collection sites vwtt:h veriftable localities.

FIGURE 2.1 Map showing the distribution of Leucaena, about 2393 herbarium specimen collection sites in South Mexico with verifiable localities (Retrieved from: http://herbaria. plants. ox.ac. uk/bol/ content! groups/leucaena/images/research. pdf

2.1.3 Species - Leucaena /eucocepha/a

L. leucocephala and L. glabrata are the two subspecies of L. leucocephala. The

distinguishable characteristics between these two subspecies are L. leucocephala IS a

relatively smaH and much-branched tree with younger stems covered by dense fine

greyish-coloured hairs while L. glabrata is a rather large and sparsely-branched tree with

hairless younger stems. L. leucocephala is native of Yucatan Peninsula and the Isthmus of

Tehuantepec in southern Mexico, and is widely distributed throughout the tropics. The

origin of the species from South Mexico and the northern part of Central America is

6

extended for the most part of Southeast Asia, except Laos after it has been introduced

throughout the tropics and has become grow wild in many places. For examgle, in the 16th

century, this species is introduced into the Philippines as a feed for ruminant livestock

before it is spread throughout Asia-Pacific area.

Its leaves structure found to be bipinnately compound with 10-20 pairs of leaflets

on each pinnae. It has white flowers in round heads which are 2-2.5 cm in diameter. The

"giant" forms of the species are distinguished from L. diversifolia by two 1-2 mm wide

round glands on the leaf stalk at the first and last pair of pinnae of most leaves.

Several types exist from shrubs to small or medium sized trees. "Giant" types may

reach 20 m in height. Bark is smooth, grey tq brown with small tan spots. Leaves alternate,

evenly bipinnate and 10-20 cm long with 4-10 cm long pinnae. Each pinnae has 10-20

pairs of oblong or lanceolate leaflets that are 8-15 mm long and 3 mm wide which folds up

in the night. Leaf base is sub-equal or oblique. The yellowish-white flowers are grouped in

round flower heads that 2- 2.5 cm in diameter. Pods are 10-20 em long and 1.5 to 2 cm

wide, flat and pointed in both ends which tum to brown colour when ripe.

L. leucocephala is a tropical lowland pioneer species which has ability of fast

growing, competitive and thrives in full sunlight and survives with little water. However, it

grows best with 1,000-3,000 mm evenly distributed annual rain, neutral to alkaline soils

and temperatures between 22-30°C. Although some provenances are adapted to higher

elevations, most forms thrive better below 500 m elevation. The prevalent infestation of

psyllids has been a main restriction in exploitation of this species (Devi, 2013).

7

There are various benefits from this speCIes which can be exploited such as

reforestation, erosion control and soil improvement. Its wood can be used for light

construction, poles, pit props, pulp, furniture, flooring and fuel wood while the other green

parts are used as fodder and green manure.

2.2 O-acetylserine (thiol) lyase

O-acetylserine (thiol) lyase (OAS-TL) is an enzyme from the family of ~-replacement

enzymes that require pyridoxal phosphate (PLP) as its cofactor. Multiple copies of OAS­

TL found in plants which are located in the cytosol, chloroplast, and mitochondria.

Mimosine formation is a two-step process. The two steps of biosynthesis of mimosine are

identical to the pathway of the cysteine synthesis. The first step in cysteine synthesis is the

formation of O-acetylserine (OAS) from acetyl-CoA and serine which is catalyzed by

serine acetyltransferase (SAT). Whereas OAS-TL involve in the second step of the

process where it conduct the catalytic activity of the formation of cysteine by replacing

acetate with sulphide in the intermediate molecule, ~AS. On the other hand, a heterocyclic

ring of 3-hydroxy-4-pyridone (3H4P) is used in place of sulphide for mimosine formation,

the formation ofa ~-substituted alanine (Yafuso et at., 2014).

Study about the formation of L-mimosine from 3,4-dihydroxypyridine (DHP) and

O-acetyl-L-serine (OAS) has been conducted by Murakoshi using cell-free extracts of

Leucaena seedlings (Murakoshi et at., 1984). According to Murakoshi (1984), mimosine is

synthesized by a reaction mechanism comparable to the biosynthesis of cysteine in that

both use O-acetyl-L-serine as the donor of the alanyl group. In fact, it was shown in L.

8

leucocephala the enzymatic activities catalyzjng the synthesis of mimosine and cysteine

reside in a single enzyme, O-acetylserine thiollyase, known as cysteine synthase.

.. SAT+

Coli'0)-<. A 0

Serine AcetylCoA

Mimosine

Figure 2.2 shows biosynthetic pathways of mimosine relative to the formation of cysteine. SAT catalyses the activation of serine to the intermediate molecule, OAS in the cysteine synthase complex. Formation of mimosine is catalysed by homodimers

ofOAS-TL in the presence of the appropriate substrates (Yafuso et al. , 2014).

Based on the study conducted by Wirtz (2004), the genes encoding isoforms of

OAS-TL proteins are expressed more or less ubiquitously in all plant organ cell types

analysed so far with little variation of contents of RNA, protein, and extractable enzyme

activity in response to external factors. OAS-TL activity has not only been found In

plastids as the site of sulphate reduction, but also in the cytosol and mitochondria.

2.3 Mimosine

Mimosine is a major chemical compound present in all plant parts of Mimosaceae, which

includes Leucaena (Leucaena leucocephala) while the seeds and foliage of leguminous

trees and shrubs of the genera Leucaena and Mimosa contribute the largest quantity of

mimosine. Mimosine [B-N-(3-hydroxy-4-pyridone)-a-aminopropionic acid] is a non­

9

protein ammo acid and is structurally comparable with dihydroxyphenylalanine as it

contain a 3-hydroxy-4-pyridone ring instead of a 3,4-dihydroxyphenyl ring.

The quantity of mimosine in the young leaves and mature seeds was the greatest,

2.66 and 2.38% of dry weight, respectively, while the quantity in the root xylems and

xylems was the lowest: 0.18 and 0.11 % of dry weight, respectively. Younger plant parts of

Leucaena contained greater amounts of mimosine than the mature parts. The seeds, stems,

pods, and leaf tissues of different Leucaena species have been shown to contain mimosine

in various amounts. Seeds contain 4 to 5% mimosine on a dry-weight basis. The mimosine

contents of different parts of the shoot vary from 1 to 12%; old stems contain the smallest

and growing tips contain the largest amounts. Leucaena root also contains 1 to 1.5%

mimosine.

Both mimosine and 3-hydroxy-4(fH)-pyridone (DHP), the degradation product of

mimosine are toxic upon ingestion by herbivores. Thus, their inactivation or reduction

would improve the quality of the plant product as livestock fodder (Chanchay, 2009). The

toxicity ofmimosine is attributable by the presence of -OH and -0 in the pyridine ring and

known to suppress iron-containing enzymes and compete with tyrosine. The characteristic

activity of growth inhibitory properties of mimosine is a hydroxyl group a to the oxo .' function of the pyridone ring. The location of the' amino acid side chain seems to be less

critical and an isomer. The synthesis of two mimosine isomers with the position of the a­

hydroxy-oxo function in the pyridine ring of mimosine was at least as active in vitro and in

vivo as the natural amino acid. The constituent properties of the a-hydroxy-oxo group are

involved in the biological activity of mimosine and other systems and may play a key

factor in growth suppression. The structure of the heterocyclic ring in mimosine is possible

10

to modify the chelate properties of the molecule and their biological activity which could

lead to the design of a mimosine analogue (Xuan et al., 2013).

o HO

N o

o FIGURE 2.3 (a): Chemical structure ofmimosine (Borthakur et a/. , 2013)

o OH

OH nainal

H

I CHz-CH(NHV-COOH

Mimosine 3.4-dihydrCDCy­pyridine

FIGURE 2.3 (b) Transfonnation ofmimosine into dihydroxypyridine by the rumen of micro-organisms (Meulen, 1979)

11

MATERIALS AND METHODS

3.1 DNA Extraction and Purification

3.1.1 Plant Materials

Young leaves sample of Leucaena leucocephala were obtained at Forest Genomics &

Informatics Laboratory (/GiL) of Faculty ofResource Science and Technology, UNIMAS.

3.1.2 Chemicals and Reagents

List of solutions to be prepared: Liquid nitrogen, 1 M Tris HCl (pH8.0), 0.5 M EDT A

(pH8.0), CTAB extraction buffer (EB), CIA: Chloroform - isoamyl alcohol (24:1),

isopropanol, wash buffer and TE buffer (pH8.0).

3.1.3 DNA Extraction and Purification Protocol

A total of 120 III of 2% ~-mercaptoethanol was added into 6 ml of 2X CT AB buffer. The

mixture was preheated in a 60°C water bath. 1 g of leaf tissue was grinded in a pre-chilled

pestle and mortar into fine powder. Liquid nitrogen was added while grinding the leaf

tissue as it is necessary to avoid thaw. The plant powder was transferred to a 15/50 ml snap

cap Falcon tube containing 6 ml CT AB buffer and incubated in a water-bath for 2 hours at .'

60°C. The tube was inverted occasionally. The slurry was allowed to cool to room

temperature. An equal volume of chloroform-isoamyl alcohol (CIA) (24: 1) was added and

mixed gently for 15 minutes. The mixture was centrifuged at 4,000 rpm for 15 minutes at

room temperature. The aqueous phase was transferred to a clean 15/50 ml snap cap Falcon

tube and re-extracted with equal volume of CIA. The solution was mixed gently for 15

minutes, centrifuged for 15 minutes at 4,000 rpm. The aqueous phase was transferred again

12

to a clean snap cap 15/50 ml Falcon tube. 2/3 volume of cold isopropanol (-20°C) was

added, gently mixed, and kept at -20°C for overnight. The nucleic acid was collected by

centrifuge at 1,500 rpm for 15 minutes at room temperature. The supernatant was poured

off. 1 ml of wash buffer was added and washed for 1 hour. The pellet was transferred

together with wash buffer to a clean 1.5 ml microcentrifuge tube and centrifuged at 13,000

rpm for 10 minutes. The supernatant was poured off and the pellet was air dried.

DNA purification was conducted using Wizard® Genomic DNA Purification Kit

(Prom ega, USA). Total volume of DNA was to up to 500 ml. 3 III of RNAse was added

and mixed. The mixture was incubated at 37°C for 1 hour. The mixture was allowed to

cool down to room temperature before proceeding with next step. 20 J.1l of protein

precipitation solution was added and vortex vigorously at high speed for 20 seconds. The

solution was centrifuged at 13,000 rpm for 15 minutes following vortexed to obtain pellet.

The supernatant was transferred into new 1.5 ml of microcentrifuge tube. Equal volume of

cold isopropanol of -20°C was added into the tube. The solution was mixed by inverting

the tube and stored at -20 °C overnight. The mixture was centrifuged again the next day at

13,000 for 15 minutes to throwaway excess isopropanol. The supernatant was discarded

and 1 ml of 70% EtOH of -20°C was added. The solution was inverted several times for 1

hour. The solution·' was centrifuged at 13,000 rpm, for 15 minutes. The supernatant was

poured off and air dried the pellet at room temperature. 50 J.1l of ultrapure H20 was added

to resuspend the pellet. The DNA solution was mixed well and stored at -20°C. 5 III of the

DNA suspension was run on 0.8% agarose gel for DNA quantification.

13

3.2 Primer Design

The nucleotide sequences of O-acetylserine (thiol) lyase from closely related species were

determined from the Genebank database. The sequence alignment of O-acetylserine (thiol)

lyase with different species was done using CLC Sequence Viewer software for the

determination of conserved region. The parameters that were used for sequence alignment

was the default parameters set in that programme.

Primers were designed based on the conserved region by using the Primer 3.0

software. The parameters of the primer design such as target sequences, primer length,

melting temperature and GC content were adjusted. 20 base pairs of forward and reverse

primers were designed and sent for synthesis.

3.3 peR Amplification

From the database results obtained, PCR method was used to detect gene of O-acetylserine

(thiol) lyase with the designed primer. Amplification was carried out by using the forward

and reverse primers that were designed from cDNA sequence of OASTL (KF754356.l) in

cell cytosol from Leucaena leucocephala. The details of the primers were described in the

table below.

Table 3.3 (a): Primer (OASTL)

Primer OASTL Forward Sequence 5' TATGGAACCCCTCTCTAGTG 3' Reverse Sequence 5'CACCAATCCCATAAATCCCA3' Forward Tm 52.7°C Reverse Tm 52.4 °C Expected Product Size 569 bp

14

Later, the PCR product was examined on 1.5 % agarose gel and 100bp DNA ladder

(Promega, USA). The amplification of OASTL was performed in Mastercycler Gradient

Thennal Cycler (Eppendorf; Germany) and the profile was set as Table 3':3 (b) and (c)

shown below.

Table 3.3 (b): PCR reaction mixture

Reagent Stock concentration Final concentration Final volume ddH20 PCR buffer 10 x 1 x 2.5 III dNTP 2.0mM 0.2mM 2.0 III Forward primer 2.5 pmol/1l1 5 pmol 2.0 III Reverse primer 2.5 pmol/1l1 5 pmol 2.0 III Template DNA lOng/ill 20 ng/1l1 2.0 III Taq DNA polymerase 0.5 U/lll 1.0 UIIlI 2.0 III Total

Table 3.3 (c): PCR reaction cycles, temperatures and durations

Stage Temperature Duration Cycles Initial denaturation 95°C 2 min 1 Denaturation 94°C 45 s 35 Annealing 59°C 45 s 35 Extension 72°C 1 min 35 Final extension 72 °c 10 min 1

The PCR products were checked using electrophoresis in a 1.5% agarose gel. The

agarose gel was stained with EtBr and visualized under UV.

3.4 DNA Sequencing and Data Analysis

DNA fragment obtained from the amplification was sent for sequencing later. The

sequencing result was viewed using Chromas Lite software version 7.5. NCBI Blast was

used for comparison of nucleotide gene sequences in data analysis.

15