Isolation and nucleotide sequence of cDNA clones encoding potato chitinase genes

  • Published on
    06-Jul-2016

  • View
    216

  • Download
    4

Transcript

<ul><li><p>Plant Molecular Biology 13: 249-250, 1989. 1989 Kluwer Academic Publishers. Printed in Belgium. 249 </p><p>Isolation and nucleotide sequence of cDNA clones encoding potato chitinase genes </p><p>Daniel Laflamme and Robert Roxby Biochemistry Department, University of Maine, Orono, ME 04469, USA </p><p>Received 23 January 1989; accepted 18 April 1989 </p><p>Chitinases are among a group of proteins expressed by plants in response to infection by pathogens [6]. Broglie et al. [ 1] and Shinshi et al. [9] have published sequences of basic chitinases from bean and tobacco, respectively, and immunologically related acidic chitinases are among the pathogenesis-related proteins that have been described in tobacco [7]. Multiple chitinase genes exist in bean [ 1 ] and several pro- teins having chitinase activity have been isolated from potato [5]. We have isolated chitinase cDNA and genomic clones from potato which restriction mapping and sequencing data indicate represent at least four different genes. This com- munication reports the sequence of one cDNA clone. </p><p>A cDNA encoding bean chitinase [ 1 ] was used to isolate a chitinase containing genomic fragment from a lambda library of potato DNA [3]. This fragment was subcloned and used to identify cDNA clones in a library constructed from mRNA of ethephon-treated potato plants [4]. Northern blots of this RNA show that all mes- sages are about the same size, 1.2 kb. Northern and slot-blots comparing RNA from ethephon- treated and untreated plants show that these mes- sages are only moderately, 3- to 5-fold, inducible by 24-hour treatment of whole, cultured plants with ethephon. The sequence of one of the cDNA clones, CCH4, is given in Figure 1. This sequence can be translated in a single 315 amino acid read- ing frame to give a deduced protein sequence rich in cysteine (5~o mol/mol) and proline (6.6~o mol/mol). The 5' end encodes a sequence having </p><p>the properties of a signal peptide, which, accord- ing to consensus patterns [2, 8], is probably cleaved after glycine 16 or asparagine 18. The calculated isoionic point is at pH 7.0, with or without the signal peptide. The nucleotide se- quence is 86~o homologous to that of the tobacco gene [9]. The size of the deduced protein and the high homology to the tobacco gene suggest that CCH4 is similar to the basic chitinases previously described. </p><p>Note and acknowledgements </p><p>The CCH4 sequence is in the EMBL/GenBank/ DDBJ nucleotide sequence databases under the accession number X14133. This work was sup- ported by USDA Competitive Grant 85-CRCR- 1-1558 and Grant ME8406 from the Maine Agri- culture Experiment Station, of which this is publi- cation number 1352. </p><p>References </p><p>1. Broglie K, Gaynor J, Broglie R: Ethylene-regulated gene expression: molecular cloning of the genes encoding a chitinase from Phaseolis vulgaris. Proc Natl Acad Sci USA 83:6820-6824 (1986). </p><p>2. von Heijne G: Patterns of amino acids near signal- sequence cleavage sites. EurJ Biochem 133:17-21 (1983). </p><p>3. Horovitz D: Construction of a potato genomic library and screening for sequences homologous to a bean chitinase gene. M.S. thesis, University of Maine (1986). </p><p>4. Jendrisak J, Young R, Engel J: Cloning into 2gtl0 and 2gtll. In: Berger SL, Kimmel AR (eds) Methods in Enzymology, vol. 152:358-371 (1987). </p></li><li><p>250 </p><p>ACT ATT TTT TCT TTA CTA TTC TCT CTC CTT TTG CTG AAC GCC TCG GGG AGC AM GTG GTT T I F S L L F S L L L L N A S G S N V V </p><p>CAC AGG CCG GAC GCG CTT TGT GCC CCA GGA CTC TGT TGT AGC AAA TTC GGC TGG TGT GGT H R P D A L C A P G L C C S K F G W C G </p><p>AAT ACA AAT GAC TAT TGT GGT CCA GGT AAT TGC CAG AGC CAG TGT CCT GGC GGC CCC GGT N T N D Y C G P G N C Q S G C P G G P G </p><p>CCT TCA GGG GAC TTA GGC GGT GTT ATT TCA AAT TCC ATG TTT GAT CAG ATG CTT AAT CAT P S G D L G G V I S N S H F D Q M L N H </p><p>CGC AAC GAT AAT GCT TGT CAA GGA AAG AAT AAT TTC TAT AGT TAC AAT GCC TTC ATC AGT R N D N A C q G K N N F Y S Y N A F I S </p><p>GCT GCT GGG TCT TTT CCT GGC TTT GGC ACT ACT GGT GAT ATA ACT GCC CGT AAA AGG GAA A A G S F P G F G T T G D I T A R K R E </p><p>ATT GCT GCT TTC CTT GCC CAA ACT TCC CAT GAA ACT ACT GGA GGA TGG CCT TCA GCA CCT I A A F L A q T S H E T T G G W P S A P </p><p>GAT GGA CCA TAC GCA TGG GGT TAC TGC TTC CTT AGA GAA CAA GGT AGC CCG GGC GAT TAC D G P Y A W G Y C F L R E Q G S P G D Y </p><p>TGT ACA CCA AGT AGT CAA TGG CCT TGT GCT CCT GGA AGG AAA TAT TTC GGA CGA GGC CCA C T P S S Q W P C A P G R K Y F G R G P </p><p>ATC CAA ATT TCA CAC AAC TAC AAC TAT GGG CCA TGT GGA AGA GCC MC GGA GTG GAC CTT I Q I S H N Y N Y G P C G R A I G V D L </p><p>TTA AAC AAT CCT GAT TTA GTA GCC ACA GAC TCA GTC ATC TCA TTT AAA TCA GCT ATC TGG L N N P D L V A T D S V I S F K S A I W </p><p>TTC TGG MG ACA CCT CAA TCA CCA AAG CCT TCT YGC CAC GAT GTC ATC ACC GGA AGA TGG F W M T P Q S P K P S C H D V I T G R W </p><p>CAA CCA TCT GGC GCT GAC CAA GCA GCT AAT CGT GTC CCT GGA TTC GGT GTC ATC ACA AAC G P S G A D G A A N R V P G F G V I T A </p><p>ATC ATC AAT GGT GGC TTG GAA TGT GGT CAT GGA AGT GAC AGC AGG GTC CAG GAC CGA ATT I I N G G L G C G H G S D S R V Q D R I </p><p>GGA TTT TAC AGG AGG TAT TGC GGA ATT CTT GGA GTT AGT CCT GGT GAC AAT CTT GAT TGT G F Y R R Y C G I L G V S P G D N L D C </p><p>GGC AAC CAG AGG TCT TTT GGA AAC GGA CTC TTA GTC GAT ACT GTG TAA GCATCGACTTCATCA G N G R S F G N G L L V D T V </p><p>60 </p><p>120 </p><p>180 </p><p>240 </p><p>300 </p><p>360 </p><p>420 </p><p>480 </p><p>540 </p><p>600 </p><p>660 </p><p>720 </p><p>780 </p><p>840 </p><p>900 </p><p>963 </p><p>TATAAGGCCCCAACTATAAATAAAGTTATGTATBTACGAAATTGTATGAATTGTGATTGTAATATGATGGAACCACGAC 1042 </p><p>TTATAATTGTTTGTTTTTTATAATAAACAAGACTATTGGTTCTTCTTCT 1091 </p><p>Fig. l. Nucleotide and deduced amino acid sequences ofpotato chitinase cDNA clone CCH4. Polyadenylation signals are underlined. </p><p>5. Kombrink E, Schr6der M, Hahlbrock K: Several 'patho- genesis related' proteins of potato are 1,3-~-glucanases and chitinases. Proc Natl Acad Sci USA 85:782-786 (1988). </p><p>6. Lamb C, Lawton M, Dron M, Dixon R: Signals and transduction mechanisms for activation of plant defenses against microbial attack. Cell 56:215-224 (1989). </p><p>7. van Loon L, Gerritson Y, Ritter C: Identification, purifi- cation and characterization of pathogenesis-related pro- </p><p>8. </p><p>teins from virus-infected Samsun NN tobacco leaves. Plant Mol Biol 9:593-609 (1987). Perlman D, Halvorson H: A putative signal-peptidase recognition site and sequence in eukaryotic and pro- karyotic signal peptides. J Mol Biol 167:391-409 (1983). Shinshi H, Mohnen D, Meins, Jr., F: Regulation of a plant pathogenesis related enzyme: inhibition of chitinase and chitinase mRNA accumulation in tobacco tissues by auxin and cytokinin. Proc Natl Acad Sci USA 84:89-93 (1987), </p></li></ul>

Recommended

View more >