Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.)

Plant Molecular Biology 28: 369-380, 1995. © 1995 Kluwer Academic Publishers. Printed in Belgium. 369

Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.)

R. Steven Conlan 1,2,4, Leslie-Ann Griffiths 1, Johnathan A Napier 2 Peter R Shewry2, Sinclair Mantell 3 and Charles Ainsworth 1,, 1 Plant Molecular Biology Laboratory, Department of Biological Sciences, Wye College, University of London, Wye, Kent TN25 5AH, UK (* author for correspondence); 2Department of Agricultural Sciences, University of Bristol, IA CR Long Ashton Research Station, Long Ashton, Bristol, BS18 9AF, UK; 3 Unit for Advanced Propagation Systems, Department of Horticulture, Wye College, University of London, Wye, Kent TN25 5AH, UK; 4 Present address: Molecular Genetics Department, John lnnes Centre for Plant Science Research, Colney Lane, Norwich, NR4 7U J, UK

Received 8 January 1995; accepted in revised form 27 March 1995

Key words: yam, Dioscorea cayenensis, tuber storage protein, dioscorin, cDNA clones

Abstract

cDNA clones encoding dioscorins, the major tuber storage proteins (M r 32000) of yam (Dioscorea cayenensis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1 ~o similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of Mr 30015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6~o similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

Introduction

Most plants synthesise storage proteins whose major function is to provide a store of nitrogen,

sulphur and carbon. Storage proteins have been most widely studied in seeds where they are mo- bilised to support growth of the seedling and provide important sources of dietary protein for

The nucleotide sequence data reported will appear in the EMBL and GenBank Nucleotide Sequence Databases under the accession numbers X76187 and X80637.

370

humans and their livestock. However, storage proteins are also synthesised in storage tubers (such as yam and potato tubers) where they are required to support sprouting and regrowth, and transiently in vegetative tissues, such as the leaves and young pods of soybean and the bark of de- ciduous trees [31 ]. These proteins have been less intensively studied, and tuber storage proteins have only been characterised in detail from two species: potato (patatin) and sweet potato (sporamin). These are both dicotyledonous species, but are only distantly related and the tubers formed have different botanical origins: from stems in potato and swollen roots in sweet potato. The major storage proteins in these tubers also differ, the sporamins being related to Kunitz protease inhibitors and patatins exhibiting enzy- matic activity as a lipid acyl hydrolase [3].

Yams (Dioscorea species) are members of the monocotyledonous family Dioscoreaceae and are major tuber crops in West Africa, SE Asia and the Caribbean. Several species are of economic importance, particularly D. alata, D. rotundata and D. cayenensis [2]. In contrast to potato and sweet potato the underground tubers originate from the hypocotyl [ 18]. Proteins account for between 1.5 and 4~o of the tuber dry weight [4], and preliminary studies of the major tuber storage protein from D. rotundata have shown a molecular weight of 32000 [10]. We report here the isolation and analysis of cDNA clones encoding the major tuber storage proteins of D. cayenensis.

Materials and methods

Plant material

D. cayenensis plants were grown in the glasshouse at 25 °C under a 16 h photoperiod. Tubers were harvested shortly after initiation and, also, at the end of the growing season. Nodal cuttings were cultured and maintained following the method of Mantell etal. [19]. Established plantlets were transferred to tuber induction conditions by supplementing the basic MS medium with either 7~o sucrose [12], 2.5 #g/l kinetin [20] or 2 mg/l

jasmonic acid [15]. Plants were maintained on 0.4~o (w/v) agar at 25 °C under 8 h photoperiods [19]. Plantlets were maintained under each growth regime for 3 weeks before the aerial tissues above the first internode were harvested for extraction of RNA and soluble protein.

Estimation of genome size

Actively growing root tips were fixed in 4~o formaldehyde for 2 h and then washed in distilled water for 24 h with frequent changes. The tips were then fixed in 1:3 acetic acid/ethanol for at least 24 h. Fixed root tips were washed in distilled water for 30 min and hydrolysed in 5 M HC1 for 1 h. Hydrolysed root tips were rinsed in distilled water for 1 min, blotted dry and stained in Feul- gen solution for 1 h. Root tips were washed in 3 changes of freshly prepared 2 ~ sodium met- abisulphate solution (10min each wash) and transferred to distilled water. The tips were squashed in a drop of 50~o glycerol and the density of the stained root tip nuclei of the samples estimated by microdensitometry. Allium cepa, with a known genome size was prepared in par- allel with the sample and the absolute values obtained from the control were used to estimate the genome size of the sample tissue. The densities of both 1C and 2C nuclei were estimated.

RNA isolation and analysis

Total RNA was extracted from yam plantlet and tuber material. Freshly harvested tissue was snap-frozen in liquid nitrogen, ground in liquid nitrogen and dispersed in RNA extraction buffer (1.5 ml/g FW of 100 mM Tris-HC1 pH 9, 100 mM NaCI, 2 mM EDTA, 2 mM MgC12, 1 ~o SDS), a 1:1 mixture ofphenol/CH3C1 pH 8 (1.5 ml/g FW) and 2-mercaptoethanol (0.33 ml/g FW). The mixture was incubated at room temperature for 60 min and centrifuged at 12000 × g for 30 min. The supernatant was extracted twice with phenol/ CH3C1 and once with CH3C1. 8 M LiC1 was added to a final concentration of 2 M and the

RNA was precipitated overnight at 4 °C and col- lected by centrifugation at 12000 x g for 30 min. The resultant RNA pellet was washed with 2 M LiC1, air-dried and dissolved in water.

10/~g of each RNA sample was separated on 1.5 ~o formaldehyde agarose gels [21 ], transferred to Hybond-N (Amersham) following the suppli- ers instructions. Northern blots were pre-hybridised in 0.5 M Na2HPO4/7~o (w/v) SDS at 65 °C for 30 min and then hybridised at 65 °C overnight. Probe labelling was carried out by ran- dom priming (Prime-It, Stratagene). Filters were washed in 2 x SSC, 0 .1~ (w/v) SDS for 10 min and then in 0.5× SSC, 0.1~o SDS for 10rain.

10/~g of total RNA was used as a template for in vitro translation using a rabbit reticulocyte lysate system (Amersham) following the manufac- turer's instructions.

Hybrid release translation

Hybrid select translation was carried out as described by Ainsworth et al. [ 1 ].

cDNA library construction and screening

Poly(A) + RNA was isolated from total RNA by one round of oligo-dT cellulose chromatography [21] and used in cDNA synthesis (using an Amersham kit). After cloning into the Eco RI site of 2gtl0, plaque lifts on nitrocellulose filters (Hy- bond C, Amersham), were probed with 32p. labelled first-strand cDNA; hybridisation was carried out overnight at 65 °C in a buffer containing 3 x SSC, 0.5~o BSA, 0.1~o PVP, 0.1~o Ficoll, 100 ng/ml denatured salmon sperm DNA. Filters were washed twice in 1 × SSC, 0.5 ~o SDS for 20 min before autoradiography.

Reverse-transcription PCR

This was as described by Gurr et al. [9].

DNA isolation and Southern blot analysis

Genomic DNA was isolated from 4 g of young leaves by freezing in liquid nitrogen, grinding to a

371

fine powder and incubating for 60 min at 55 °C in DNA extraction buffer (2 ml/g FW of 50 mM Tris-HCl pH 8, 10 mM EDTA, 0.7 M NaCI, 1 ~o (w/v) CTAB). The resultant slurry was centrifuged at 12 000 x g for 30 minutes, the supernatant removed using a wide-bore pipette tip and extracted with and equal volume of CH3C1. The supernatant was transferred to a new tube and DNA precipitated with propan-2-ol. DNA was removed using a sterile sealed glass Pasteur pipette, washed in 70 ~o (v/v) ethanol, air-dried and dissolved in water. This DNA was pure enough to be used in PCR experiments. Further purifi- cation of the DNA, by CsC1 density gradient ul- tracentrifugation, was necessary for restriction enzyme digestion. 10 #g of purified genomic DNA was digested for 6 h and separated on 1 ~o (w/v) agarose gels. Standard techniques were used for Southern blotting and hybridisation.

In vitro transcription and translation

2 #g of circular plasmid DNA was added directly to a coupled reticulocyte lysate system, following the supplier's instructions (Promega), together with 5 ~ul 3SS-methionine (10 mCi/ml), 1 #1 RNA- sin ribonuclease inhibitor (40 U/#I) and 1 #1 SP6 RNA polymerase, was made to a final volume of 50/~1 and incubated for l h at 30 °C. Co- translational processing of translation products was assessed using canine pancreatic microsomal membranes (Promega). 2.5/A of microsomes were included in the coupled transcription/ translation reaction maintaining the final reaction volume at 50 #1. 2/~1 of the translation products was analysed on a 15~o SDS-PAGE gel [16]. SDS-PAGE gels were fixed by boiling in 10~o (w/v) TCA (2 x 5 min) before being dried at 60 °C. Translation products were visualised by autoradiography.

DNA sequence analysis

The nucleotide sequences of selected clones were determined using a Sequenase D N A sequencing

372

kit (Amersham), based on the method of Sanger etal. [27], with double-stranded plasmid DNA as the starting material. DNA sequences were analysed using the DNAStar (Madison, WI) programs and the UWGCG programs.

Results

Isolation of two classes of cDNA clones for yam tuber storage proteins (dioscorins)

Previous analysis of the soluble proteins from D. cayenensis tubers by SDS-PAGE showed that a single major band of Mr 32000 accounted for about 80~ of the total fraction [8, 6] and an abundancy cloning approach was used to isolate cDNA clones encoding this predominant protein species. 40 000 recombinants from a 2gtl0 cDNA library, made using poly(A) + RNA from developing tubers of D. cayenensis, were screened with 32p-labelled first-strand cDNA prepared from total tuber mRNA. Cross-hybridisation analysis of the inserts from twenty of the most intensely hybridising clones indicated the presence of two main classes (designated A and B) ofcDNA clone (data not shown). Two clones from each of the classes (pYSPll0 and pYSP106, representing class A and pYSPl l4 and pYSP105, representing class B) were used in hybrid release translation experiments with tuber RNA (Fig. 1). The four cDNAs each hybridised to two mRNAs yielding translation products of similar size to the major band of 32 000. The larger protein product predominated in the selection with the class A cDNAs (pYSP110 and pYSP106 whilst the two products were produced in more equal propor- tions in translations with the class B cDNA selected RNA. These results indicate that the major tuber storage protein of Mr 32000 is actually a mixture of more than one protein and that the individual proteins are encoded by at least two, closely related, genes.

The cDNA inserts from several clones from each class were sequenced; no sequence variation within the classes was found, pYSP110 (class A) and pYSPl l4 (class B), the cDNA clones with

Fig. 1. Characterisation of putative tuber storage proteins by hybrid release translation. Class A (pYSP110 and pYSP106) or class B (pYSP114 and pYSP105) dioscorin cDNA clones and a pUC18 plasmid control was used in hybrid selection with D. cayenensis tuber RNA. Hybrid release translation products and translation products ofD. cayenensis total tuber RNA were electrophoresed on a 15 % polyacrylamide gel and visualised by fluorography. The main 32 kDa storage protein translation product and the selected products are arrowed.

the longest inserts (610 bp and 641 bp) were as- sumed to be incomplete at the 5' ends since an Mr 32 000 protein would require an mRNA with a coding region of about 970 bp. An oligonucleo- tide based on a conserved region at the 5' ends of both cDNAs (primer SC5, Fig. 2) was used to direct first strand cDNA synthesis from total tuber mRNA, and the products were PCR am- plified (after adding an oligo-dG tail) using primer SC5 and an oligo-dC primer and cloned. All clones sequenced contained identical 516 bp inserts of the class A type and were designated pYSP5. The nucleotide sequence of pYSP5 has a putative open reading frame (of 414 bp) extend- ing from a possible ATG translation initiation site (positions 75 to 77) to the 3' end of the insert. Three further primers (SC2, designed to a conserved sequence 3' to the termination codons of both pYSPl l0 and pYSPll4; SC6, designed to a sequence 5' to the ATG codon of pYSP5 and SC4 (GCCGACGACTTCTTCTAC; based on

3 7 3

I " "~ pY SP5 r--~pYSPll 1 *TAA*TCAAAGAGCCCTCAACT~"~AA¢CCACTCCA~CTAAGC*AACGCAAGGAATTAA A

14 S S S T L L H L L L L S S L 61 GAAAGATAACAATCATGAGTTCATCCACCCTTCTCCATCTCCTCCTCCTCTCCTCCCTCC A

121 TCTTCTCTTGCCTTCCAAATGCAAK6CCTCAGCk~GCTGAGGATGAGTI"I'AGCT~CATTG l 1 SC4*$$$*$****$*** *$***$$$ B

I E D E F S Y ? G G p ~' 'pYSl)20 E G S P N G P E N IV G N L K K E W E T C

$81 AAGGAAGTCCTAATGGTCCTGAAAACTGGGGAAATCTTAAAAAGGAGTGGGAGACTTGT* A

E G S P N G P E N W G N L R P E W K T C

G K G M E Q S P T Q L R O N R V T F D Q 241 GCAAAGGCATGGAGCAGTCACCCATTCAATTGCGTGATAACAGAGTGAT*TTCGATC~A *

83 * * * *Teeeeee** * * * * * * * * * * * * * A * T * * * T * * * * *GeT*A**ee*e*CAGAC**C* * B G N G M g Q S P N Q L C D D K V Z Q T O

T L G E L R R N Y R A A E * T L R N S G 3e l CTTTGGGGGAGCTGAGAAGAAATTATAGAGCCGCTGAAGCAACA'I'I;AAGGAACAGTGGAC A 143 * * * * * * * $ * $ * * $ * * * * * * * * G * * * * C * G $ * * * * * * G T e * * * e * * * * * * * * * $ * A * * $ * * B

A L G K L R T S Y Q A A R A T L K N N G

H D V L V E F E G N * G S L S T N R V A 361 ATGATGTATTGGTGGAATTTGAGGGTAATGCTGGTTCACTATCCATCAATCGAGTTGCAT A 2eS *****A**Aee*e*A*CeeeA*AAeeG****ee******A**T************ACA** B

H O Z M V N F K S D A G S Q F Z N R V Q ~-,~pYSP110

Y Q L K RI T H F H S P S E H E N N G E R 421 ACC/U~.CTCAAGCGAATTCATTTTCACTCCCCTTCAGAGCATGAAATG*ATGGCGA*AGGT A

~ 7 " ; ~ " 7 " ~ , * ' ~ ' 7 " 7 " 7 " 7 " ; * ' 7 " i * ' 7 " ~ ' ~ * ' 7 " 7 " ; " 7 " " - - ~ FYSP114

pYSPS.,~--~ $ O L Y H E S O D I O R R A V T

F D L E A Q L V H E S Q D ' Q K R A V V S 481 TTGACCTTGAGGCACAGCTGGTCCATGAGAGCCAAGACCAA~GAGAGCAGTGGTTTCTA A i 323 A********e*ATC***Ae******************~d~'~**G$********AAC*G *** B

Y D L E T Q M V H E S Q D Q R R A V T A

Z L F R F G R A D * F L S D L E D F Z K 541 TT~.I IITCAGATTTGGACGTGCTGATACATTCCTCTCAGATCTT*AAGACTTTATCe, AG* 583 $ * * * G * * * $ * * * * * $ * * * $ $ T $ * * $ C C $ * * * * * $ * * $ * $ * C * * $ * $ $ * * * $ * $ $ $ * * * $ * ~

Z M F R F G R S D P F L S D L E D F "r K

Q F S S S Q K N E Z N A G V V O P N Q L 6~1 AGTTTAGCAGTAGCCAGAAGA*TGJU~ATAAATGCAGGAGTTGTGGATCCAJU~TCAATTA- A 443 * * * * * * * * * * * * * * * * * * * T T T * * * * * * * G * * * * T * * $ $ * * * * * * $ $ $ * $ * G G * $ $ * * * T B

Q I S R S E N F E V D A G V V D P R Q L

- Q F D D C * Y F R Y N G S F T A P P C 66e - - CAGTTTGAT*AC'r GT* *ATATTTTAGATACA* GGGCTCATT CACAGCTCCACCTTGCA A

~ 3 ~ , . ~ . . ; . . ; . . ; . T T T . 7 . ? . 7 . T . 7 . ~ . . 7 7 . 7 . . 7 . ; . . ; . . ? . 8 T E G I S W T V M R K V * T V S P R Q V

718 CTGAAG GTATTTCATGGAC CGTCATGAG~AGGTTGCAACTGTTTC*CCAAGGCAAGTA* A 563 ******A*e*eAe*eeee*eeeTeeTeAeee* ceeeGeeee*eeeeee***A******** g

T E D I T W T V I K K L G T V S P K Q V

L L L K Q * V N E N * Z N N * R P L Q P 778 TTCTGTTGAAGCAGGCAGTGAATG~tAATGCTATAAAC, IUtTGCG*GACCACTTCA*CC*A A 623 * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * B

L M L K Q A V N E N A I N N * R P L Q P

T N Y R S V F Y F E Q L K S K L G V 1' 838 CCAATTACCGCTCCGTTTTTTACT'i-rGAACAGCTGA~TCGAAGCTTGGTGTCATATAA* * 683 TGee*eTTeeeA** * * * * ***TGeA* CCGeeTeAee* *C* CeeT*AeeAe******* * * * B

L K F R T V F L Y P H Q K P N H D A Z pYSPI0,pYSPI 1

sgs --***AT, . . . . . . * * * ~ , c r * * - - * * r * * * * ~ * * * * ~ ' * * * * ~ a , 743 CT***C**GCTCGT . . . . T***TI* AG . . . . . . . . . . . . * * * * * . ~ * C . . . . . . . . . . . . B

pY SF20 ~ " - J 948 GGTGGAGTGCTCCACTCTGCATGTAC . . . . TATCATGCCACGTAT . . . . . . AATAAA*AA * 883 * * * * * * * * * * * * * * * * * * * * * * * * * * * * C T * $ * $ * * * * * * * A * * * GGG*AA**$$ * *$*$ B

pYSPllO ~ - - i 998 TGT GTCTTTT GG GT(*) .,:. u A 863 *C* C** * * * * * A * * *T~i'J 3e B

pYSP114,~:.~-J

Fig. 2. Dioscorin c D N A sequences and deduced amino acid sequences. Complete nucleotide sequences of class A and class B tuber storage protein c D N A clones. The nucleotide sequences have been aligned and gaps inserted to maximise the alignment. The class A sequence is shown with the protein sequence over it. The class B sequence is shown with the protein sequence underneath it. Nucleotides which differ in the class B gene are shown; similar nucleotides are represented by asterisks. Putative polyadenylation signals are underfined and overlined in the class A and B sequences, respectively. Peptide sequences obtained by protein sequencing are shown in italics. The 5' and 3' ends of the c D N A inserts are arrowed over (class A) and under (class B) the nucleotide sequences. Possible sites of transit peptide cleavage are arrowed (A, B, C, D) in the class A protein. Arrows between the class A and B nucleotide sequences correspond to the named PCR primers.

374

the N-terminal protein sequence obtained by protein sequencing [6] and adjusted for monocot codon usage [22]) were used to PCR amplify cDNAs containing the almost full-length coding sequences of the class A and class B genes (Fig. 2). Near full-length (770 bp) clones for the class A (pYSP10) and class B (pYSP20) genes were generated with primers SC2 and SC4; full- length class A clones (pYSP11, 819 bp) were generated with SC2 and SC6.

Analysis of the nucleotide and deduced amino acid sequences of class A and class B cDNA clones

Class A cDNAs contain an ORF of 819 bp (from the ATG at positions 75 to 77, to a TAA termination codon at positions 894 to 896). Transla- tion of the open reading frame gives a deduced protein of 273 amino acids with a molecular mass of 30015 (Fig. 2). Two regions of protein sequence were determined from the purified protein [6]. The sequence of the first of these is similar in eight of the twelve amino acids to the deduced sequence (residues 28-35, Fig. 2); the sequence of the second is similar in twelve of the fifteen amino acids. In the latter, the three different amino acids appear in the deduced amino acid sequence of the class B protein. These simi- larities provide evidence that the cDNAs represent the dioscorin genes.

A hydrophilicity plot of the amino acid sequence (not shown) shows an N-terminal hy- drophobic region of 20 residues which could correspond to a signal peptide, while the UWGCG Sig-Cleave program indicates that the most probable cleavage site would be after position 18 (A in Fig. 2), with less probable sites after positions 21, 16 and 24 (B, C and D in Fig. 2). None of these corresponds to the N-terminus determined by direct protein sequencing (after position 27; Fig. 2). However, this could result from further post-translational processing within the secretory pathway or proteolysis during protein preparation. The calculated molecular mass of the protein after signal peptide cleavage (assuming cleavage at site A) is 28 600.

The class B clone with the longest 5' sequence (pYSP20), is probably incomplete at the 5' end and, by comparison with the class A sequence (Fig. 2), probably lacks the region encoding the signal sequence. However, this sequence could encode the mature protein, less the first amino acid, as the 5' primer (SC4) was based on the directly determined N-terminal sequence minus the first residue (Fig. 2). The Class B cDNA sequence has an open reading frame of 738 bp from the start of the cDNA sequence to a TAA termination codon at positions 739 to 741, the deduced protein from which would be of 246 amino acids with a predicted Mr of 28 200 (Fig. 2).

Comparison of the nucleotide sequences of the Class A and Class B cDNAs using the Wilbur and Lipman method shows that they are 82.5~o similar. When the coding regions only were considered, the level of similarity is 84.1 ~ . Compari- son of the deduced amino acid sequences by the Lipman and Pearson method gives a figure of 69.6~o similarity. The main differences between the two classes are the insertion of a single lysine codon in class B cDNAs, and nucleotide inser- tions in the 3' untranslated region of the class B cDNAs (Fig. 2).

The amino acid compositions of the encoded proteins are similar to each other, and to the composition determined by analysis of the protein purified from tubers ofD. cayenensis [6] (Table 1). In particular, the proteins are very low in cysteine and methionine with ca. 1.4 and 2.0 molto, respectively.

Comparisons of the nucleotide and deduced amino acid sequences with those in the available databases did not identify proteins with signifi- cant amino acid sequence similarity.

In vitro transcription/translation

The putative full-length cDNA was used in a rabbit reticulocyte coupled transcription/translation system and yielded a single band of Mr 30 300, which similar to that of the protein purified from tubers (Fig. 3). However, when the transcription/ translation was carried out in the presence of ca-

375

Table 1. Comparison of the amino acid composition of class A and B proteins derived from both the analysis of purified D. cayenensis tuber storage protein [8] and from the protein sequences deduced from the cDNA clones. The possibility that some amino acids are missing from the class B N-terminus (deduced from the cDNA sequence) has been shown as the actual number (calculated from the deduced sequence) + X (where X is the additional number of residues present in the class A sequence).

Amino Class A Class A Class B Class B Purified protein acid (mol%) (residues) (mol%) (residues) (mol%)

A Ala 4.16 17 3.90 14 ( + 2) 7.88 C cys 1.42 4 1.41 3 (+ 1) - D Asp 4.75 12 6.31 16 11.75 E Glu 9.33 21 6.19 14 9.19 F Phe 7.60 15 6.56 13 10.20 G Gly 2.95 15 2.54 13 9.94 H His 2.36 5 3.29 7 1.74 I Ile 4.28 11 5.43 14 3.39 K Lys 5.29 12 6.59 14 (+ 1) 4.51 L Leu 8.18 21 7.37 18 (+ 1) 6.68 M Met 1.81 4 2.70 6 2.00 N Asn 7.06 18 6.65 16 ( + 1) - P Pro 4.01 12 5.66 16 ( + 2) 5.08 Q Gin 7.49 17 7.90 16 (+ 1) - R Arg 9.13 17 8.03 15 5.74 S Ser 5.69 19 4.78 16 4.58 T Thr 3.13 9 3.81 11 9.07 V Val 5.45 16 4.42 13 5.25 W Trp 1.92 3 1.91 3 - Y Tyr 3.93 7 4.47 8 2.98

nine pancreatic microsomes, the translation effi- ciency was increased and a second band of faster mobility (28 600) was also observed. Such a product is likely to be generated by the signal processing peptidase activity present in the microsomes and is characteristic of the interaction of a cleavable N-terminal signal sequence with components of the SRP-mediated insertion pathway [25]. These results are consistent with the co-translational cleavage of a signal peptide, as discussed below. The higher molecular mass of the native protein (32000) relative to the sizes of the transcription/translation products and the proteins deduced from the cDNAs (30015) may result • form post-translational modifications, such as glycosylation. In the storage protein from the related yam species, D. rotundata, no evidence of sugar residues has been found [10].

Fig. 3. Coupled in vitro transcription/translation of dioscorin cDNA clone pYSPl l . 15% SDS-PAGE gel of the class A cDNA clone p Y S P l l was used in coupled in vitro transcription/translation in the presence ( + M) and absence ( - M) of canine pancreatic microsomes; the autoradiograph of this is shown. Protein products were electrophoresed in the same gel as purified dioscorin protein from tubers of D. cayenensis and molecular weight markers; the stained gel is shown.

376

Analysis of expression

Northern blot analysis using the eDNA insert from the class A cDNA clone, pYSP11 as probe, showed that transcripts of about 1300 nucleotides were present in young developing tubers (Fig. 4), but are not detectable in leaves or non-tuberous roots of glasshouse-grown plants (data not shown). Given the nucleotide similarity between the class A and B genes, and the stringency of the filter washing (0.5 × SSC, 0.1 ~ SDS), it is likely

Fig. 4. Analysis of dioscorin RNA and dioscorin protein pro- duction in developing tubers ofD. cayenensis and aerial plant parts from in vitro cultured plantlets grown under tuber- inducing conditions of MS supplemented with 7~ sucrose (MS + Sucrose), 2% sucrose + 2.5 g/1 kinetin (MS + Kinetin) or 2% sucrose + 2.5 mg/1 jasmonic acid (MS + JA). The upper panel shows the silver stained 12.5% SDS-PAGE protein gel of total soluble proteins isolated from the leaves, stems and petioles of the plantlets. The middle panel shows the western blot of this gel probed with purified polyclonal antiserum raised against purified 32 kDa soluble yam tuber protein from D. cayenensis tubers. The bottom panel shows the northern blot of total RNA isolated from the plantlets hybridised with the 32p-labelled eDNA insert from pYTP11. 10 #g of each RNA sample was separated on 1.5% formaldehyde agarose gels, transferred to Hybond-N. Blots were pre-hybridised in 0.5 M Na2HPO4/7~ (w/v) SDS at 65 °C, hybridised at 65 °C and washed in 2 x S SC, 0.1% (w/v) SDS for 10 min and then in 0.5× SSC, 0.1% SDS for 10min.

that this hybridisation band also represents the class B transcripts. In vitro translation of the RNA fraction from young tubers confirmed the presence of major translation products of Mr 32 000, but these were not observed when RNA from mature tubers was translated (not shown). These results indicate that, under normal growth conditions, expression of tuber storage protein genes occurs in the developing but not in the mature tuber.

Further experiments were carried out to deter- mine whether storage protein gene expression is induced under conditions that are likely to be found in tuber tissue and under conditions which have been shown to induce tuberisation of micro- propagated yam plants or expression of other tuber storage protein genes. Tuberisation in yam has been shown to be induced by sucrose (or sucrose plus cytokinins) [20] and jasmonic acid [ 15 ], whereas patatin and sporamin gene expression are both induced by sucrose and are, under normal conditions, only synthesised in tubers [ 32, 13 ]. However, synthesis of patatin and sporamin also occurs in other plant organs if tubers are removed, and is induced by sucrose in in vitro- grown plants or cultured explants [26, 32, 12, 13].

To induce micro tuberisation, yam plantlets were cultured for three weeks on MS salts medium containing 2~o (w/v) sucrose with 2.5 ~tg/l kinetin [20], 2 mg/l of jasmonic acid [ 15] or 7~o (w/v) sucrose (Table 2). The aerial parts of the plantlets (leaves, petioles and stems above basal node) were harvested and the RNA and total soluble protein fractions extracted. Neither northern blot analysis using the insert from p Y S P l l nor western blotting with a storage protein- specific antibody [ 6] provided evidence of storage protein gene expression or synthesis under these conditions (Fig. 4).

Genomic organisation of Class A genes

The genome size of D. cayenensis was estimated by microdensitometry of Feulgen-stained root tip nuclei as 0.8 pg per haploid nucleus. The copy number of the genes encoding dioscorins in

377

Table 2. Comparison of the frequency of the codons used for the twenty amino acids in the class A and class B dioscorin genes with the monocot and dicot preferred codons [28]. The codons used in the dioscorin genes and their frequency are shown.

Amino Yam Dicot Monocot Amino Yam Dicot Monocot acid acid

Ala GCA 14/31 GCT GCC Lys AAA 9/26 AGG AGG GCC 2/31 AAG 17/26

GCG 1/31 Met ATG 11/11 ATG ATG GCT 14/31

Phe TTC 9/29 TTC TTC Arg AGA 14/32 AGA AGC TTT 20/29

AGG 8/32 CGA 4/32 Pro CCA 14/28 CCA CCA CGC 2/32 CCC 3/28 CGT 4/32 CCG 2/28

CCT 9/28 Asn AAC 8/34 AAC AAC

AAT 26/34 Ser AGC 7/41 TCT TCC AGT 8/41

Asp GAC 9/28 GAT GAC TCA 15/41

GAT 19/28 TCC 7/41

Cys TGC 3/7 TGC TGC TCG 1/41 TGT 4/7 TCT 3/41

Gin CAA 19/33 CAA CAG Thr ACA 7/21 ACT ACC CAG 14/33 ACC 5/21

ACT 9/21 Glu GAA 19/35 GAA/ GAG

GAG 16/35 G Trp TGG 6/6 TGG TGG

Gly GGA 11/28 GGA GGC Tyr TAC 8/15 TAC TAC GGC 7/28 TAT 7/15

GGG 2/28 Val GTA 6/29 GTT GTG GGT 8/28 GTC 4/29

His CAC 2/13 CAT CAC GTG 9/29 CAT 11/13 GTT 10/29

Ilu ATA 9/25 ATT ATC ATC 5/25 ATT 11/25

Leu CTA 1/47 CTT CTC CTC 11/47 CTG 8/47 CTT 1/47 TTA 4/47 TTG 8/47

D. cayenensis was estimated by genomic South- ern analysis and copy number reconstruction. Southern blots of digested genomic DNA were hybridised with the oligolabelled insert from pYSPl l and were washed at two stringencies: 0.2 × SSC at 65 °C or 2× SSC at 65 °C. Auto- radiographs of the blots washed at the higher stringency showed single major hybridising bands

corresponding to one copy per haploid genome (Fig. 5). The hybridising fragment produced by digestion with Eco RI was of 600 bp. Since a single Eco RI site is present within the class A coding sequence, this fragment may represent two parts of the gene running as equal sized fragments. Blots washed at lower stringency showed the same strongly hybridising fragments together

378

Fig. 5. Genomic organisation of dioscorin genes. Southern blots of gels carrying 10/~g genomic DNA isolated from D. cayenensis leaves, digested with Pst I, Eco RV, Eco RI or Barn HI hybridised with the 32P-labelled cDNA insert from pYTPl l . Blots were washed at 2 x SSC (at 65 °C) or 0.2 x SSC (at 65 °C). 1, 10 and 100 copy equivalents of cDNA clone pYSPl l undigested DNA were included on the gel washed at 0.2 x SSC.

with weakly hybridising bands which could correspond to class B genes or other related sequences.

Discussion

The results reported here show that the major tuber storage proteins (dioscorins) ofD. cayenensis are encoded by at least two single-copy genes which are about 82~o similar in nucleotide sequence. It is of interest that the storage proteins of sweet potato (sporamin) and potato (patatin), although structurally unrelated to each other or to dioscorin, are also each encoded by two subfamilies of genes. In the case of sporamin, the coding regions of the two subfamilies are 83 ~o similar and, as in yam, both are strongly expressed in developing tubers [ 14]. In the case of patatin, the two sub-families (or classes) of genes are about 98~o similar in their coding regions, but show differences in expression; class I genes account for most of the protein in tubers, while class II genes are only weakly expressed in tubers but are also expressed in roots [23]. The class I and II patatins, therefore, appear to have different roles

which may be related to their biological activity as lipid acyl hydrolases. Neither sporamin nor dioscorin has been demonstrated to have physi- ological activity and the significance of the exist- ence in both cases of two sub-families of genes is not known.

Dioscorin appears to synthesised with an N-terminal signal peptide, which is consistent with its location in vacuoles of the tuber cells [6]. This is similar to patatin [30] and sporamin [11 ]. In addition, sporamin has been demonstrated to initially be synthesised as a pro-protein with a cleavable 16 residue N-terminal sequence which is necessary and sufficient to ensure correct targeting to the vacuole [24]. Related sequences do not appear to be present in dioscorin and patatin, and their targeting mechanisms are not known. Studies of other vacuolar plant proteins show little homology between targeting sequences which may be located at the protein N-terminus, C-terminus or internally.

Dioscorin genes appear to be highly regulated, being expressed only in the developing tuber, and expression in other plant organs does not appear to be induced by sucrose as occurs with patatin and sporamin [ 26, 32, 13]. Similarly, gene expression is not induced when plantlets are grown on compounds which are known to induce tuberisation: kinetin [20] and jasmonic acid [15]. The control of dioscorin gene expression would clearly justify further detailed studies, once structural genes have been isolated and characterised.

The genome size ofD. ¢ayenensis was estimated to be 0.8 pg per haploid nucleus. This is a rela- tively small genome and is equivalent to species such as soybean, rice and spinach. D. cayenensis is a polyploid species with 2n = 4x = 40, 2n = 6x -~ 60 or 2n = 14x = 140 [7], with the tetraploid form used in the present study.

Analysis of the preferred codons for the amino acids present in the class A and class B dioscorin proteins (Table 2) shows a pattern more typical of dicotyledonous than monocotyledonous plants. For 9 of the 20 amino acids (Ala, Arg, Asp, Gin, Gly, His, Ilu, Thr, Val) the most frequently used codon (when the codon usage frequencies for class A and B genes are combined) agree with the

preferred codon in dicots (as identified by Murray et al. [22] in a survey of 207 plant gene sequences). In contrast, only one amino acid (Leu) shows a codon preference typical of monocot genes. For nine of the remaining ten amino acids the preferred dicot and monocot codons are the same while the tenth (Ser) shows a codon preference which differs from those in both monocot and dicot genes. Although the Dioscoreaceae has been classified in the Monocotyledoneae (based on the presence of one cotyledon only), the members show many of the features associated with dicotyledonous plants. Significantly, the family was considered by early taxonomists (e.g. Beccari [5]) as belonging to the Dicotyledoneae and the more recent studies of Lawton and Lawton [17] re- vealed that many Dioscorea species do indeed have two cotyledons, one emerging from the seed and carrying out the normal photosynthetic func- tions of a leaf, while the other remains within the seed and acts as the absorptive organ within the endosperm. The codon usage data presented here would also support the classification of Dioscoreaceae, or at least of D. cayenensis, as dicotyledonous.

In conclusion, we have demonstrated that the major storage protein fraction of yam tubers (dioscorin) is a novel type of plant storage protein which is not closely related to any other plant proteins. Thus, the three storage tubers which have been studied in detail (potato, sweet potato, yam) contain structurally unrelated types of storage protein, which is consistent with their distant taxonomic relationships and the different botanical origins of the tubers, but contrasts with seed storage albumins and globulins which appear to be highly conserved not only among flowering plants but also in ferns [28, 29]. In addition, dioscorin gene expression also appears to be highly tuber-specific, and may lack the sucrose in- ducibility demonstrated for patatin and sporamin genes.

Acknowledgements

We are grateful to Cathie Martin for help with cDNA cloning and to Arthur Tatham for help

379

with the protein work. We also wish to thank Vicky Buchanan-Wollaston and Cathie Martin for critically reading the manuscript. L.A.G. and S.R.C. were supported by SERC studentships.

References

1. Ainsworth CC, Clark J, Balsdon J: Expression, organisation and structure of the genes encoding the waxy protein (granule bound starch synthase) in wheat. Plant Mol Biol 22:67-82 (1993).

2. Akoruda MO: Genetic improvement of vegetable crops: yam (Dioscorea spp.) In: Kasloo et al. (ed), Genetic Im- provement of Vegetable Crops, pp. 717-733. Pergamon Press (1984).

3. Andrews DL, Beames B, Summers MD, Park WD: Characterization of the lipid acyl hydrolase activity of the major potato (Solanum tuberosum) tuber protein, patatin, by cloning and abundant expression in a baculovirus vector. Biochem J 252:199-206 (1988).

4. Baguar SR, Oke OL: Protein in Nigerian yams (Dioscorea sp.). Nutr Rep Int 14:237-248 (1976).

5. Beccari O: Nota sull' embrione delle Dioscoreaceae. Nuovo G Bot Ital 2:150 (1870).

6. Conlan RS, Griffiths L-A, Shewry PR, Ainsworth CC, Tatham AS: Isolation and characterisation of the major soluble tuber protein dioscorin from Dioscorea alata L. and Dioscorea cayenensis (in preparation).

7. Coursey DG: Yams. In Simmonds NW (ed) Evolution of Crop Plants, pp. 70-74. Longman, London (1976).

8. Griffiths LA: Characterisation of yam (Dioscorea) tuber storage proteins and cDNA clones. Ph.D. thesis, Uni- versity of London (1991).

9. Gurr S J, McPherson MJ: PCR-directed cDNA libraries. In: McPherson M J, Quirke P, Taylor GR (eds) PCR: Practical Approach, pp. 147-170. IRL Press (1991).

10. Harvey PJ, Boulter D: Isolation and characterisation of the storage protein of yam tubers. Phytochemistry 22: 1687-1693 (1983).

11. Hattori T, Matsuoka K, Nakamura K: Subcellular locali- sation of the sweet potato tuberous root storage protein. Agric Biol Chem 52:1057-1059 (1988).

12. Hattori T, Nakagawa S, Nakamura K: High-level expression of tuberous root storage genes of sweet potato in stems of plantlets grown in vitro on sucrose medium. Plant Mol Biol 14:595-604 (1990).

13. Hattori T, Fukumoto H, Nakagawa S, Nakamura K: Sucrose-induced expression of genes coding for the tuberous root storage protein, sporamin of sweet potato in leaves and petioles. Plant Cell Physiol 32:76-86 (1991).

14. Hattori T, Yoshida N, Nakamura K: Structural relation- ship among the members of a multigene family coding for the sweet potato tuberous root storage protein. Plant Mol Biol 13:563-572 (1989).

380

15. KodaY, Kikuta Y: Possible involvement ofjasmonic acid in tuberisation of yam plants. Plant Cell Physiol 32: 629- 633 (1993).

16. Laemmli UK: Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227:680-685 (1976).

17. Lawton JR, Lawton JRS: The morphology of the dor- mant embryo and young seedling of five species of Dioscorea from Nigeria. Proc Linn Soc Lond 178: 153- 159 (1967).

18. Lawton JR, Lawton JRS: The development of the tuber in seedlings of five species of Dioscorea from Nigeria. Bot J Linn Soc 62:223-232 (1969).

19. Mantell SH, Hague SQ, Whitehall AP: Clonal multipli- cation of Dioscorea alata and D. rotundata Poir Yams by tissue culture. J Hort Sci 53:95-98 (1978).

20. Mantell SH, Hugo SA: Effects of photoperiod, mineral medium strength, inorganic ammonium and cytokinin on root, shoot and microtuber development in shoot cultures of Dioscorea alata L. and D. bulbifera L. yams. Plant Cell Tissue Organ Culture 16:23-37 (1989).

21. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1982).

22. Murray EE, Lotzer J, Eberle M: Codon usage in plant genes. Nucl Acids Res 17:477-498 (1989).

23. Nakamura K, Matsuoka K: Protein targeting in the vacuole in plant cells. Plant Physiol 101:1-5 (1993).

24. Pickard CS, Mignery GA, Ma DP, Stark YJ, Park WD:

Sequence of two apparent pseudogenes of the major potato protein, patatin. Nucl Acids Res 14:5564-66 (1986).

25. Rapoport TA: Transport of proteins across the endoplas- mic reticulum membrane. Science 258:931-936 (1992).

26. Roche-Sosa M, Sonnewald U, Frommer W, Stratmann M, Schell J, Willmitzer L: Both developmental and meta- bolic signals activate the promoter of a class I patatin gene. EMBO J 8:23-29 (1989).

27. Sanger F, Niklen S, Coulson AR: DNA sequencing with chain termination inhibitors. Proc Natl Acad Sci USA 74:5463-5467 (1977).

28. Shewry PR: Biological and evolutionary aspects of cereal seed storage proteins. In: Shewry PR, Stobart AK (eds) Seed Storage Compounds: Biosynthesis, Interactions and Manipulation, pp. 53-78. Oxford University Press, Oxford (1993).

29. Shewry PR: Plant storage proteins. Biol Rev (in press). 30. Sonnewald UE, Strum A, Chrispeels M, Willmitzer L:

Targeting and glycosylation of patatin, the major potato tuber protein in the leaves of transgenic tobacco. Planta 179:171-180 (1989).

31. Staswick P: Novel regulation of vegetative seed storage proteins. Plant Cell 2 :1-6 (1990).

32. Wenzler HC, Mignery GA, Fisher LM, Park WD: Analy- sis of a chimeric Class I patatin-GUS gene in transgenic potato plants: High level expression in tubers and sucrose-inducible expression in cultured leaf and stem explants. Plant Mol Biol 12:41-50 (1989).

Documents

Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.)