iosystematic Studies on the Family Piperaceae (Piperales

Piperales Bercht. & J. Presl have long attract-ed attention as primitive angiosperms (Cronquist 1957, 1988, Takhtajan 1969, Tamura 1974, En-dress & Friis 1994). They share apocarpy, mono-sulcate pollen grains, ethereal oil cells, and rich endosperm with other primitive angiosperms, such as Magnoliales Juss. ex Bercht. & J. Presl, Canellales Cronq., and Chloranthales Mart., all of which (including Piperales) are included in the basal clades of angiosperms (APG IV 2016). Piperales may also be related to monocots. Burg-er (1977) reported the morphological similarity to monocots; e.g. atactostele and 3-merous flowers. Nevertheless, the taxonomy of Piperales has not been adequately studied.

Piperaceae Giseke, along with Saururaceae Rich. ex T. Lestib. and Aristolochiaceae Juss., constitute the Piperales. (APG IV 2016). The family is considered to be one of the more mor-phologically advanced of the Piperales (Tamura 1974), because it has simple flowers with only one orthotropous ovule per ovary and lacks a peri-anth. Based on Samain et al. (2008), the Pipera-ceae include five genera: Piper L., Peperomia Ruiz & Pav., Zippelia Blume, Manekia Trel., and Verhuellia Miq.

The molecular phylogenetics of the Pepero-mia has been studied by Wanke et al. (2006), Smith et al. (2008), Samain et al. (2009), and Frenzke et al. (2015). They analyzed the DNA se-

Biosystematic Studies on the Family Piperaceae (Piperales) I. Plastid DNA Phylogeny and Chromosome Number of

Peperomia subgenus Micropiper

Yukihiro h. kobaYashi*, shizuka Fuse and Minoru n. TaMura

Department of Botany, Graduate School of Science, Kyoto University,Kitashirakawa-oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan.

* [email protected] (author for correspondence)

To evaluate the evolutionary relationships among species of Peperomia subg. Micropiper, a phylogenet-ic analysis based on the DNA sequences of plastid regions atpB-rbcL, psbK-I, rpL16, rpS16, trnG, trnK (including matK), trnL-L-F, and trnS-G was conducted using 20 species, in addition to four outgroup species. The trnK sequences of 46 species and trnL-L-F sequence of one species were quoted from Gen-Bank and also included in the analysis. The results showed that P. subg. Micropiper includes seven major clades, which are also supported by morphological characteristics. They are recognized as section-equivalent plant groups, namely Alatoid, Blandoid, Glabelloid, Glaucoid, Japonicoid, Lanceolatoid, and Rotundifolioid. A chromosome analysis of the subgenus yielded nine new counts: 2n = 22 (diploid) for P. alata, P. bicolor, P. diaphanoides, P. flexicaulis, P. hylophila, P. polystachya and P. prosterata, 2n = 44 (tetraploid) for P. okinawensis and 2n = 132 (dodecaploid) for P. reticulata. Japonicoid, which occurs outside the Americas, i.e. in Asia, Africa, and the Pacific islands, is tetraploid, decaploid, and dodeca-ploid (not diploid), while the remaining six plant groups are native to the Americas and diploid (except Glaucoid, which is tetraploid). Further, P. diaphanoides is conspecific with P. glabella. Peperomia boninsimensis from the Ogasawara Islands, Japan, is more closely related to Polynesian species than to other Japanese species. Peperomia okinawensis should be regarded as a variety of P. japonica.

Key words: chromosome number, Micropiper, molecular phylogeny, Peperomia blanda, Peperomia boninsimensis, Peperomia diaphanoides, Peperomia japonica var. okinawensis, Piperaceae, plastid DNA, primitive angiosperms

Acta Phytotax. Geobot. 70 (1): 1–17 (2019)doi: 10.18942/apg.201815

ISSN 1346-7565

2 Vol. 70Acta Phytotax. Geobot.

quences of trnK (3,204 bp), trnL+trnL-F+ndhF+g3pd (5,235 bp), trnK+ITS+26S (5,906 bp), and trnK+trnK-psbA (4,870 bp), respectively, and revealed the monophyly of the genus and the subgeneric relationships. Frenzke et al. (2015) classified Peperomia (1,520 spp.) into 14 subgen-era primarily based on molecular phylogenetic data: Micropiper (Miq.) Miq. (596 spp.), Pseudo-cupula Frenzke & Scheiris (157 spp.), Leptorhyn-chum (Dahlst.) Trel. ex Samain (147 spp.), Multi-palmata Scheiris & Frenzke (105 spp.), Tildenia (Miq.) Miq. ex Dahlst. (58 spp.), Oxyrhynchum (Dahlst.) Samain (57 spp.), Fenestratae Pino (42 spp.), Peperomia (18 spp.), Erasmia (Miq.) Dahlst. (13 spp.), Pleurocarpidium Dahlst. (11 spp.), His-pidulae Frenzke & Scheiris (10 spp.), Perlucida Scheiris & Frenzke (7 spp.), Phyllobryon (Miq.) Scheiris & Frenzke (7 spp.), and Panicularia Miq. (6 spp.). However, the remaining 286 spe-cies have not been assigned to any of the subgen-era.

In this study, we focused on Peperomia subg. Micropiper (Fig. 1), which was circumscribed by Frenzke et al. (2015). It consists of pantropically distributed terrestrial or epiphytic herbs that are

distinguished from other subgenera by densely the viscid-papillose fruits. Based on Frenzke et al. (2015) and Tropicos (2018), 419 of the 596 spe-cies of P. subg. Micropiper are endemic to the American tropics, while the remaining 177 spe-cies are distributed in Asia, Africa, and the Pa-cific islands. In contrast, the 13 subgenera are en-demic to the Americas, with the exception of P. tetraphylla of subg. Pseudocupula. Thus, molec-ular phylogenetic studies of P. subg. Micropiper are needed to improve our understanding of Asian Peperomia. In addition, few data regarding chromosome number and polyploidy are avail-able (Table 1), although these are important char-acters for tracing evolution along molecular phy-logenetic trees.

In Japan, there are three species of Pepero-mia, P. boninsimensis, P. japonica and P. oki-nawensis, all of which have taxonomic issues. Peperomia boninsimensis is endemic to the Oga-sawara Islands, which are ca. 1,000 km distant from Honshu, and its close relatives are unknown. In Tseng et al. (1999), P. japonica is treated as a synonym of P. blanda; however, this synonymy has not been confirmed by molecular methods.

Fig. 1. Morphology and habit of species of Peperomia subg. Micropiper. A, P. verticillata (Blandoid) [Kobayashi 90 (KYO)] with dimorphic leaves (a, b); B, P. prostrata (Alatoid) [Kobayashi 6 (KYO)] with shoot continuing to grow after flowering (c) and white-lined veins of leaves (d); C, P. bicolor [Kobayashi 96 (KYO)]; D, P. japonica (Japonicoid) [Tamura et al. 44019 (KYO)]; E, P. glabella (Glabelloid) [Kobayashi 34 (KYO)] with grooved veins of leaves (e); F, P. galioides (Glau-coid) [Kobayashi 86 (KYO)] with dimorphic leaves (f, g).

February 2019 3kobaYashi & al. –Cp Phylogeny of Peperomia subg. Micropiper

Although the independence of P. okinawensis has been questioned (Yonekura 2015), its molecular phylogeny has not been evaluated.

The purpose of this study was first to con-struct a molecular phylogenetic tree of Pepero-mia subg. Micropiper to show species-level reso-lution and to reveal the relationships among the

species, second to accumulate information on chromosome number and ploidy level of P. subg. Micropiper to assess the cytological diversity in the subgenus, and third to revise the previous species-level taxonomic treatments and deter-mine the evolutionary units within P. subg. Mi-cropiper based on all available information.

Table 1. Present and previous cytological studies of the Peperomia subg. Micropiper species that were investigated here mo-lecular phylogenetically.

Taxon Present count Previous count Reference

(2n) (n) (2n)

P. alata Ruiz & Pav. 22*

P. bicolor Sodiro 22* 36 Jose et al. (1994)

P. blanda (Jacq.) Kunth 22 22 Samuel & Morawetz (1989)

P. boninsimensis Makino 110 Okada (1986)

P. boninsimensis c.110 Ono (1977)

P. diaphanoides Dahlst. 22*

P. dindygulensis Miq. 44 Mathew et al. (1999)

P. dindygulensis 44II Mathew et al. (1998)

P. fenzlei Regel 44 Samuel & Morawetz (1989)

P. fernandeziana Miq. 22+2 Valdebenito et al. (1992)

P. fernandeziana 23+2, c.22 Spooner et al. (1987)

P. fernandeziana c.22 Sanders et al. (1983)

P. flexicaulis Wawra 22*

P. galioides Kunth 44 c.22 Valdebenito et al. (1992)

P. glabella (Sw.) A. Dietr. 22 22 Samuel & Morawetz (1989)

P. glabella ‘Variegata’ 36 Jose et al. (1992)

P. heyneana Miq. 22 Mathew et al. (1999)

P. heyneana 22II Mathew et al. (1998)

P. hylophila C. DC. 22*

P. japonica Makino 44 Okada (1986)

P. okinawensis T. Yamaz. 44*

P. polystachya (Ait.) Hook. 22*

P. portulacoides (Lam.) A. Dietr. 22 44 Mathew et al. (1999)

P. portulacoides 22II Mathew et al. (1998)

P. prostrata B. S. Williams 22*

P. reticulata Balf. f. 132*

P. rotundifolia (L.) Kunth 22 Jose et al. (1994)

P. rubella Hook. 22 22 Bai & Subramanian. (1985),

Samuel & Morawetz. (1989)

P. skottsbergii C. DC. c.24 Valdebenito et al. (1992)

P. skottsbergii c.23 Spooner et al. (1987)

P. skottsbergii 22–24 Sanders et al. (1983)

P. urvilleana A. Rich. 22 Beuzenberg & Hair (1983)

P. urvilleana 44 Murray & Lange (1999)

P. verticillata (L.) A. Dietr. 22 22 Samuel & Morawetz (1989)

*These numbers are first counted.


Table 2. Plant materials used in this study. All voucher specimens are preserved in the herbarium of Kyoto University (KYO).Taxon Source /

VoucherOrigin Chro-

mosome Accession number

observa-tion atpB-rbcL psbK-I rpL16 rpS16 trnG trnK trnL-L-F trnS-G

Peperomia subg. Micropiper

P. alata Cult. KBGa, Kobayashi 92 America ○ LC440976 LC440939 LC456943 LC456906 LC440902 LC457017 LC440693 LC456980

P. bicolor Cult. KBG, Kobayashi 96 America ○ LC440962 LC440925 LC456929 LC456892 LC440888 LC457003 LC440679 LC456966

P. blanda Cult. KBG, Kobayashi 75 America ○ LC440973 LC440936 LC456940 LC456903 LC440899 LC457014 LC440690 LC456977

P. blanda Cult. KBG, Kobayashi 88 America ○ LC440965 LC440928 LC456932 LC456895 LC440891 LC457006 LC440682 LC456969

P. blanda Cult. KBG, Kobayashi 89 America LC440967 LC440930 LC456934 LC456897 LC440893 LC457008 LC440683 LC456971

P. blanda Cult. KBG, Kobayashi 141 America LC440968 LC440931 LC456935 LC456898 LC440894 LC457009 LC440684 LC456972

P. boninsimensis

Cult. TBGb (collected from Japan: Tokyo, Hahajima Isl.), Kobayashi 35

Asia LC440957 LC440920 LC456924 LC456887 LC440883 LC456998 LC440674 LC456961

P. boninsimensis

Japan: Tokyo, Minami-Iwo-jima Isl.,Takayama 17061618


P. cochinensis C. DC.

Thailand: Doi Phu Wae, Tamura et al.T-30013


P. diaphanoides Cult. OCU, Kobayashi 21 America ○ LC440970 LC440933 LC456937 LC456900 LC440896 LC457011 LC440687 LC456974

P. flexicaulis Cult. KBG, Kobayashi 77 America ○ LC440978 LC440941 LC456945 LC456908 LC440904 LC457019 LC440695 LC456982

P. galioides Cult. KBG, Kobayashi 86 America ○ LC440982 LC440945 LC456949 LC456912 LC440908 LC457023 LC440699 LC456986

P. galioides Cult. KBG, Kobayashi 98 America LC440981 LC440944 LC456948 LC456911 LC440907 LC457022 LC440698 LC456985

P. glabella Cult. KBG (collected from Brazil), Kobayashi 99

America LC440979 LC440942 LC456946 LC456909 LC440905 LC457020 LC440696 LC456983

P. glabella Cult. KBG, Kobayashi 87 America LC440969 LC440932 LC456936 LC456899 LC440895 LC457010 LC440686 LC456973

P. glabella Cult. KBG, Kobayashi 34 America ○ LC440971 LC440934 LC456938 LC456901 LC440897 LC457012 LC440688 LC456975

P. heyneana Thailand: Doi Phu Wae, Tamura et al. T-30631


P. hylophila Cult. KBG (collected from Guatemala),Kobayashi 95

Amerca ○ LC440977 LC440940 LC456944 LC456907 LC440903 LC457018 LC440694 LC456981

P. inaequalifolia Ruiz & Pav.

Cult. KBG, Kobayashi 97 Amerca LC440980 LC440943 LC456947 LC456910 LC440906 LC457021 LC440697 LC456984

P. japonica

Cult. KBG (collected from Japan: Kagoshima Pref., Amami Oshima Isl.), Kobayashi 83


P. japonica

Cult. MBGc (collected from Japan: Kochi Pref.), Kobayashi 48


P. japonica

Cult. KBG (collected from Japan: Okinawa Pref., Okinawa Isl.), Kobayashi 73



Materials and Methods

Plant materialsThe sources of the plant materials used for

DNA analysis and chromosome observations are listed in Table 2, and some are shown in Fig. 1. For the DNA analysis, we used Peperomia cape-rata (subg. Multipalmata), P. incana (subg. Lep-torhynchum), P. maculosa (subg. Leptorhyn-chum) and P. verschaffeltii (subg. Multipalmata) as outgroups, with reference to Frenzke et al. (2015). All sequence data are deposited in the DNA Data Bank of Japan (DDBJ). We quoted 53 sequences of trnK and two sequences of trnL-L-F from GenBank (Table 3), and used them, in addi-

tion to our sequence data, for the phylogenetic re-construction. Voucher specimens are preserved in the herbarium of Kyoto University (KYO).

DNA extraction, PCR amplification and DNA se-quencing

The DNA sequences of the plastid regions of atpB-rbcL intergenic spacer, psbK-I intergenic spacer, rpl16 gene, rps16 gene, trnG gene, trnK gene (including matK), trnL gene, trnL-F inter-genic spacer, and trnS-G intergenic spacer for 24 species (36 OTUs) were determined in this study (Table 2). Total DNA was extracted from fresh or silica gel-dried leaves using the modified CTAB method of Doyle & Doyle (1987). All regions were amplified by polymerase chain reaction

Taxon Source / Voucher

Origin Chro-mosome Accession number

observa-tion atpB-rbcL psbK-I rpL16 rpS16 trnG trnK trnL-L-F trnS-G

Peperomia subg. Micropiper

P. japonica

Cult. KBG (collected from Japan:Okinawa Pref., Okinawa Isl.), Kobayashi 74


P. japonica Japan: Okinawa Pref.,Okinawa Isl., Tamura et al.44016


P. japonica Japan: Okinawa Pref.,Okinawa Isl., Tamura et al.44019


P. langsdorffii (Miq.) Miq.

Cult. OCUd, Kobayashi 14 America LC440966 LC440929 LC456933 LC456896 LC440892 LC457007 LC440685 LC456970

P. okinawensis Cult. KUSe, Kobayashi 8 Asia ○ LC440956 LC440919 LC456923 LC456886 LC440882 LC456997 LC440673 LC456960

P. polystachya Cult. KBG, Kobayashi 76 America ○ LC440972 LC440935 LC456939 LC456902 LC440898 LC457013 LC440689 LC456976

P. prostrata Cult. OCU, Kobayashi 6 America ○ LC440975 LC440938 LC456942 LC456905 LC440901 LC457016 LC440692 LC456979

P. reticulata Cult. KBG, Kobayashi 93 Africa ○ LC440959 LC440922 LC456926 LC456889 LC440885 LC457000 LC440676 LC456963

P. rubella Cult. KBG, Kobayashi 85 America ○ LC440974 LC440937 LC456941 LC456904 LC440900 LC457015 LC440691 LC456978

P. verticillata Cult. KBG, Kobayashi 90 America ○ LC440963 LC440926 LC456930 LC456893 LC440889 LC457004 LC440680 LC456967

P. verticillata Cult. KBG, Kobayashi 91 America LC440964 LC440927 LC456931 LC456894 LC440890 LC457005 LC440681 LC456968

Peperomia subg. LeptorhynchumP. incana (Haw.) A. Dietr.

Cult. OCU, Kobayashi 13 America LC440985 LC440948 LC456952 LC456915 LC440911 LC457026 LC440702 LC456989

P. maculosa (L.)Hook.


Peperomia subg. MultipalmataP. caperata Yunck.


P. verschaffeltii Lem.


a, Kyoto Botanical Gardens; b, Tsukuba Botanical Garden; c, The Kochi Prefectural Makino Botanical Garden; d, Botanical Gardens, Faculty of Science, Osaka City University; e, Botanical Gardens, Graduate School of Science, Kyoto University.

Table 2. Continued


(PCR) using a GeneAmp PCR System 2700 or 2720 (Applied Biosystems). The amplification re-

action mixture was prepared using TaKaRa Ex Taq DNA polymerase, following the manufactur-er’s instructions (TaKaRa Shuzo). We used the 20 primers listed in Table 4 and the following PCR profile: a 35 cycle reaction with denaturation at 94 °C for 0.5 min, annealing at 50 °C for 0.5 min, and extension at 72 °C for 0.5–2 min, in addition to an initial denaturation at 94 °C for 5 min and a final extension at 72 °C for 7 min. We purified the PCR products by treating them with Exonuclease I (Takara Bio) and Calf Intestine Alkaline Phos-phatase (Toyobo) to degrade the remaining prim-ers and dephosphorylate the remaining dNTPs. Direct sequencing was conducted using 25 prim-ers (Table 4) on an ABI Prism 3130 Genetic Ana-lyzer (Applied Biosystems) with the BigDye Ter-minator v.3.1 Cycle Sequencing Kit (Applied Bio-systems), according to the manufacturer’s in-structions. We sequenced both strands, with the exception of the matK sequencing for which we sequenced only a single strand. We aligned the obtained DNA sequences using MAFFT (Katoh et al. 2005) and adjusted them manually.

Phylogenetic analysisWe employed the methods of maximum like-

lihood and Bayesian inference based on the com-bined DNA sequences of plastid regions atpB-rbcL, psbK-I, rpL16, rpS16, trnG, trnK (including matK), trnL-L-F, and trnS-G to construct phylo-genetic trees. All base substitutions were unor-dered and equally weighted. Gaps were treated as missing data. The DNA substitution model was selected by jModelTest (Darriba et al. 2012), and TPM1uf+G+I was the best model. For the maxi-mum-likelihood (ML) analysis, we used RAx-ML-ng 0.7.0 beta (Kozlov et al. 2018) and a boot-strap (BS) analysis with 500 replications. The credibility of each clade was evaluated by Felsen-stein’s bootstrap expectation (FBE) and transfer bootstrap expectation (TBE) (Lemoine et al. 2018). Bayesian inference analysis was conducted using MrBayes v.3.2.6 (Ronquist et al. 2012). Four simultaneous runs of 1,000,000 Markov chain Monte Carlo (MCMC) generations were performed and trees were sampled every 100 generations. The convergence was examined

Table 3. DNA sequences obtained from GenBank.

Taxon Accession number Reference

[trnK] P. alata KR002963.1 Frenzke et al. (2015) P. abyssinica Miq. KR002913.1 Frenzke et al. (2015) P. blanda DQ212763.1 Wanke et al. (2006) P. ciliaris C. DC. KR002920.1 Frenzke et al. (2015) P. congona Sodiro KR003072.1 Frenzke et al. (2015) P. aff. emarginulata C. DC. KX451154.1 Frenzke et al. (2016) P. fenzlii KR003021.1 Frenzke et al. (2015) P. aff. fenzlii KX451164.1 Frenzke et al. (2016) P. galioides DQ212748.1 Wanke et al. (2006) P. glabella DQ212757.1 Wanke et al. (2006) P. glabella KR002962.1 Frenzke et al. (2015) P. aff. glabella KX451152.1 Frenzke et al. (2016) P. glauca Pino KR002933.1 Frenzke et al. (2015) P. hendersonensis Yunck. KR002973.1 Frenzke et al. (2015) P. humilis A. Dietr. KR002975.1 Frenzkeet al. (2015) P. hylophila DQ212758.1 Wanke et al. (2006) P. aff. hylophila KX451153.1 Frenzke et al. (2016) P. aff. ilaloensis Sodiro KX451157.1 Frenzke et al. (2016) P. inaequalifolia DQ212749.1 Wanke et al. (2006) P. inaequalifolia KR002976.1 Frenzke et al. (2015) P. inaequalifolia var. galioides (Kunth)Pino

KR002932.1 Frenzke et al. (2015)

P. aff. inaequalifolia KX451158.1 Frenzke et al. (2016) P. lanceolata C. DC. KR003033.1 Frenzke et al. (2015) P. lanuginosa Pino KR003032.1 Frenzke et al. (2015) P. leptostachya Hook. & Arn. KX451171.1 Frenzke et al. (2016) P. aff. macrothyrsa Miq. KX451159.1 Frenzke et al. (2016) P. microphylla Kunth KR002943.1 Frenzke et al. (2015) P. molleri C. DC. KR003035.1 Frenzke et al. (2015) P. pallida Seem. KR002946.1 Frenzke et al. (2015) P. pedunculata C. DC. KR002985.1 Frenzke et al. (2015) P. pilicaulis C. DC. KR002947.1 Frenzke et al. (2015) P. pitcairnensis C. DC. DQ212762.1 Wanke et al. (2006) P. pitcairnensis KR002989.1 Frenzke et al. (2015) P. polystachya KR002948.1 Frenzke et al. (2015) P. polystachya FJ424468.1 Samain et al. (2009) P. puberulispica C. DC. KR002959.1 Frenzke et al. (2015) P. ratticaudata G. Mathieu KR002958.1 Frenzke et al. (2015) P. riocaliensis Trel. & Yunck. KR003009.1 Frenzke et al. (2015) P. rotundifolia KR002994.1 Frenzke et al. (2015) P. rotundifolia var. rotundifolia

DQ212754.1 Wanke et al. (2006)

P. rotundilimba C. DC. KR002995.1 Frenzke et al. (2015) P. saxicola C. DC. KR002997.1 Frenzke et al. (2015) P. skottsbergii KR002951.1 Frenzke et al. (2015) P. societatis J. W. Moore KR002999.1 Frenzke et al. (2015) P. succulenta C. DC. KR003001.1 Frenzke et al. (2015) P. trichophylla Baker KR003004.1 Frenzke et al. (2015) P. tuisana C. DC. ex Pittier DQ212756.1 Wanke et al. (2006) P. vulcanica Baker & C.H. Wright KR003012.1 Frenzke et al. (2015)

P. sp.* KR002971.1 Frenzke et al. (2015) P. sp.298 DQ212760.1 Wanke et al. (2006) P. sp.3 KX451162.1 Frenzke et al. (2016) P. sp.4 KX451163.1 Frenzke et al. (2016)[trnL-L-F] P. pitcairnensis EF422828.1 Wanke et al. (2007) P. pitcairnensis AY689145.1 Neinuis et al. (2005)*This sample was possibly erroneously named P. falanana in Frenzke et al. (2015).


with Tracer 1.7 (Rambaut & Drummond 2018). Consensus trees and the posterior probability (PP) of each clade were calculated after the first 25% of sampled trees were discarded as burn-in.

Chromosome observationRoot tips for the examination of chromosomes

were prepared by using a modification of the 8-hydroxyquinoline and lacto-propionic orcein squash method (Yamamoto et al. 2008). Voucher specimens are preserved in KYO.

Results

DNA sequence variation of Peperomia subg. Mi-cropiper

The DNA strands sequenced in this study (ex-cept for the four outgroup species) ranged from 818 to 857 bp for the atpB-rbcL intergenic spacer region, 439–463 bp for the psbK-I intergenic spacer region, 743–859 bp for the rps16 gene re-gion, 917–997 bp for the rpl16 gene region, 714–728 bp for the trnS-G intergenic spacer region, 666–672 bp for the trnG gene region, 838–1,080

Table 4. Name, direction, sequence and reference for primers used in this study. The primers with an asterisk were used only for DNA sequencing, the others both for PCR amplification and DNA sequencing.

Primer name Direction Sequence (5’-3’) Reference

[aptB-rbcL intergenic spacer]atpB-1 Forward ACATCKARTACKGGACCAATAA Chiang et al. (1998)rbcL-1 Reverse AACACCAGCTTTRAATCCAA Chiang et al. (1998)

[psbK-I intergenic spacer]psbK-psbI(F) Forward TTAGCATTTGTTTGGCAAG Wang et al. (2010)psbK-psbI(R) Reverse AAAGTTTGAGAGTAAGCAT Wang et al. (2010)

[rpL16 gene]rpL16F71 Forward GCTATGCTTAGTGTGTGACTCGTTG Shaw et al. (2005)rpL16R1516 Reverse CCCTTCATTCTTCCTCTATGTTG Shaw et al. (2005)

[rpS16 gene]rpS16F Forward AAACGATGTGGTARAAAGCAAC Shaw et al. (2005)rpS16R Reverse AACATCWATTGCAASGATTCGAT Shaw et al. (2005)

[trnK gene (including matK)] trnK-11 Forward CTCAACGGTAGAGTACTCG Liston & Kadereit (1995)trnK-710F-mod-Pi Forward GTATCGCACTATGTATCMTTT Modified Johnson & Soltis (1995) trnK-710R* Reverse TCAAATGATACATAGTGCGATAC Johnson & Soltis (1995)matK-1470R Reverse AAGATGTTGATCGTAAATGA Johnson & Soltis (1995)matK-1805F Forward GGTAAGGAGTCAAATGCTAGAGAAT This studymatK-2040R* Reverse TCCAAATACCAAATACGTTC This studymatK-8F* Forward TCGACTTTCTTGTGCTAGAACTTT Steel & Vilgalys (1994)matK-8R Reverse AAAGTTCTAGCACAAGAAAGTCGA Ooi et al. (1995)trnK-2621 Reverse AACTAGTCGGATGGAGTAG Liston & Kadereit (1995)

[trnL gene & trnL-F intergenic spacer]trnL-c Forward CGAAATCGGTAGACGCTACG Taberlet et al. (1991)trnL-d* Forward GGTTCAAGTCCCTCTATCCC Taberlet et al. (1991)trnL-e* Reverse GGGGATAGAGGGACTTGAAC Taberlet et al. (1991)trnF-f Reverse ATTTGAACTGGTGACACGAG Taberlet et al. (1991)

[trnS-G intergenic spacer & trnG gene]trnSGCU Forward AGATAGGGATTCGAACCCTCGGT Shaw et al. (2005)trnG2S Reverse TTTTACCACTAAACTATACCCGC Shaw et al. (2005)trnG2G Forward GCGGGTATAGTTTAGTGGTAAAA Shaw et al. (2005)trnGUUC Reverse GTAGCGGGAATCGAACCCGCATC Shaw et al. (2005)


Pep

ero

mia

subg. M

icro

pip

er

Glaucoid

Glabelloid

Japonicoid

Alatoid

Blandoid

Rotundifolioid

Lanceolatoid

Fig. 2. Strict consensus of maximum-likelihood (ML) tree and Bayesian tree of Peperomia subg. Micropiper derived from analysis of sequences of atpB-rbcL, psbK-I, rpl16, rps16, trnG, trnK (including matK), trnL-L-F, and trnS-G. Numbers above branches indicate ML bootstrap support (Felsenstein’s bootstrap expectation/transfer bootstrap expectation; FBE/TBE); numbers below branches are Bayesian posterior probability (PP).


bp for the region of the trnL gene and trnL-F in-tergenic spacer, and 2,448 to 2,533 bp for the trnK gene region.

Phylogenetic analysisThe aligned DNA-sequence dataset, includ-

ing the sequences determined in this study, those from GenBank, and the sequences of four out-group species comprised 9,016 bp, of which 960 bp (10.6%) were variable, and 575 bp (6.4%) were parsimony informative. The consistency index (CI), retention index (RI), and rescaled consisten-cy index (RC) were 0.83, 0.93, and 0.76, respec-tively.

The strict consensus of the ML tree and the Bayesian tree (Fig. 2) showed the monophyly of Peperomia subg. Micropiper, as supported by BS values of 100/100 (FBE/TBE) and a PP value of 1.00. A clade comprising P. congona, P. galioi-des, P. glauca, P. inaequalifolia, P. microphylla, P. skottsbergii and P. succulenta (FBE/TBE/PP = 100/100/1.00, named Glaucoid) was sister to the remaining species of P. subg. Micropiper (100/100/1.00). A clade comprising P. ciliaris and P. rotundifolia (64/74/0.96, Rotundifolioid) di-verged as the next branch. The clade of the re-maining species (83/98/1.00) consisted of two smaller clades plus P. pilicaulis. One of the small-er clades (52/84/0.99) comprised a subclade of P. lanceolata, P. riocaliensis, and P. saxicola (95/97/1.00, Lanceolatoid), a subclade of P. di-aphanoides and P. glabella (100/100/1.00, Gla-belloid), and P. tuisana. The other smaller clade comprised the remaining species (90/99/1.00) from which a clade of P. abyssinica, P. boninsi-mensis, P. cochinensis, P. hendersonensis, P. heyneana, P. japonica, P. molleri, P. pallida, P. pitcairnensis, P. ratticaudata, P. rotundilimba, P. trichophylla, and P. vulcanica (39/84/1.00, Japo-nicoid) diverged as the next branch. A clade of the remaining species (35/93/0.70) consisted of two subclades and P. bicolor. One subclade was composed of P. alata, P. emarginulata, P. flexi-caulis, P. hylophila, and P. prostrata (82/97/1.00, Alatoid); and the other of P. blanda, P. fenzlei, P. humilis, P. ilaloensis, P. langsdorffii, P. lanugi-nosa, P. leptostachya, P. macrothyrsa, P. pedun-

culata, P. polystachya, P. puberulispica, P. ru-bella, and P. verticillata (59/93/0.81, Blandoid).

In the Glabelloid clade, Peperomia diapha-noides was embedded within P. glabella (100/100/1.00). In the Japonicoid clade, P. bonin-simensis was sister to the clade comprising P. pallida, P. hendersonensis and P. societatis (79/89/0.97); the four species formed a larger clade (100/100/1.00). Peperomia okinawensis was embedded in P. japonica (96/98/1.00). In the Blandoid clade, P. langsdorffii and three individ-uals of P. blanda had identical DNA sequences for all nine plastid regions analyzed (9,016 bp).

Chromosome examinationChromosomes at the mitotic metaphase in the

14 species of Peperomia subg. Micropiper were examined (Figs. 3 & 4). The basic chromosome number of the 14 species was x = 11 (Table 1), in agreement with the reports of Smith (1966) and Okada (1986) for Peperomia. The number and size of the chromosomes of each species are de-scribed as follows (Tables 1 & 5).

(1) Peperomia alata — 2n = 22, diploid (Fig. 3A): This is the first report of the chromosome number for this species. The pairs of chromo-somes ranged from 2.2 to 4.4 μm in length in the same cell.

(2) Peperomia bicolor — 2n = 22, diploid (Fig. 3B): This is a new chromosome number for P. bicolor; it was reported as 2n = 36 by Jose et al. (1994). The pairs of chromosomes ranged from 1.8 to 2.5 μm in length in this study.

(3) Peperomia blanda — 2n = 22, diploid (Fig. 3C, D): Two individuals from Kyoto Botanical Gardens were examined; both were diploid with 2n = 22. The chromosomes ranged from 1.8 to 2.8 μm in length in one individual (Fig. 3C), and from 1.8 to 2.9 μm in the other (Fig. 3D).

(4) Peperomia diaphanoides — 2n = 22, diploid (Fig. 3E): This is the first report of a chromo-some number for this species. The chromo-some pairs ranged from 2.2 to 3.4 μm in length.

(5) Peperomia flexicaulis — 2n = 22, diploid (Fig. 3F): This is the first report of a chromosome


Fig. 3. Somatic chromosomes of species of Peperomia subg. Micropiper. A, P. alata (2n = 22) [Kobayashi 92 (KYO)]; B, P. bicolor (2n = 22) [Kobayashi 96 (KYO)]; C, P. blanda (2n = 22) [Kobayashi 75 (KYO)]; D, P. blanda (2n = 22) [Kobayas-hi 88 (KYO)]; E, P. diaphanoides (2n = 22) [Kobayashi 21 (KYO)]; F, P. flexicaulis (2n = 22) [Kobayashi 77 (KYO)]; G, P. glabella (2n = 22) [Kobayashi 34 (KYO)]; H, P. hylophila (2n = 22) [Kobayashi 95 (KYO)]. Bars = 5μm.


Fig. 4. Somatic chromosomes of species of Peperomia subg. Micropiper. A, P. polystachya (2n = 22) [Kobayashi 76 (KYO)]; B, P. prostrata (2n = 22) [Kobayashi 6 (KYO)]; C, P. rubella (2n = 22) [Kobayashi 85 (KYO)]; D, P. verticillata (2n = 22) [Kobayashi 90 (KYO)]; E, P. okinawensis (2n = 44) [Kobayashi 8 (KYO)]; F, P. galioides (2n = 44) [Kobayashi 86 (KYO)]; G, P. reticulata (2n = 132) [Kobayashi 93 (KYO)]. Bars = 5μm.


number for this species. The chromosomes were 2.0 to 3.4 μm in length.

(6) Peperomia galioides — 2n = 44, tetraploid (Fig. 4F): The chromosomes were 1.6 to 3.1 μm in length.

(7) Peperomia glabella — 2n = 22, diploid (Fig. 3G): The chromosomes were 2.0 to 4.1 μm long.

(8) Peperomia hylophila — 2n = 22, diploid (Fig.

3H): This is the first report of a chromosome number for this species. The chromosomes ranged from 2.4 to 3.9 μm long.

(9) Peperomia okinawensis — 2n = 44, tetraploid (Fig. 4E): This is the first report of a chromo-some number for this Japanese species. The chromosomes were 1.3 to 3.1 μm long.

(10) Peperomia polystachya — 2n = 22, diploid (Fig. 4A): This is the first report of a chromo-

Table 5. Morphology, chromosomes, species and distribution of each section-equivalent plant group of Peperomia subg. Micropiper.

Blandoid Alatoid Japonicoid Glabelloid Lanceolatoid Rotundifolioid Glaucoid

MorphologyPhyllotaxis opposite,

verticillate or alternate

mostly alternate opposite, verticillate or alternate

mostly alternate mostly verticillate

mostly alternate verticillate

Leaf dimorphism

dimorphic monomorphic monomorphic monomorphic monomorphic monomorphic dimorphic

Leaf nerves upper leaves conspicuous, lower leaves inconspicuous

conspicuous conspicuous or inconspicuous

conspicuous ? inconspicuous inconspicuous

Stem habit erect erect or procum-bent

erect or procumbent

erect erect procumbent erect

Stem color reddish mostly reddish mostly green reddish mostly reddish green reddishStolon present absent present or

absentabsent ? absent present

Shoot withered after fruiting

continuing to grow after fruiting

withered after fruiting




withered after fruiting

Chromosomesnumber 2n = 22 (2X) 2n = 22 (2X) 2n= 44, 110, 132

(4X, 10X, 12X)2n = 22 (2X) ? 2n = 22 (2X) 2n = 44 (4X)

length (μm) 1.7-2.9 (P. polystachya)

2.0-3.4 (P. flexicaulis)

1.3-3.1 (P. okinawensis)

2.0-4.1 (P. glabella)

1.6-3.1 (P. galioides)

1.7-3.1 (P. verticillata)

2.2-4.4 (P. alata)

1.5-3.3 (P. reticulata)

2.2-3.4 (P. diaphanoides)

1.8-2.9 (P. blanda)

2.3-4.1 (P. prostrata)

1.8-2.9 (P. rubella)

2.4-3.9 (P. hylophila)

Species P. blanda P. alata P. abyssinica P. diaphanoides P. lanceolata P. cilialis P. congonaP. fenzlii P. emarginulata P. boninsimensis P. glabella P. riocaliensis P. rotundifolia P. galioidesP. humilis P. flexicaulis P. cochinensis P. saxicola P. glaucaP. ilaloensis P. hylophila P. hendersonensis P. inaequalifolia P. langsdorffii P. prostrata P. heyneana P. microphylla P. lanuginosa P. velutina P. japonica P. skottsbergii P. leptostachya P. molleri P. succulentaP. macrothyrsa P. okinawensisP. pedunculata P. pallidaP. polystachya P. pitcairnensis P. puberulispica P. ratticaudata P. rubella P. reticulataP. verticillata P. rotundilimba

P. societatisP. trichophyllaP. vulcanica

Distribution America America Asia America America America AmericaAfricathe Pacific islands


some number for this species. The chromo-somes were 1.7 to 2.9 μm long.

(11) Peperomia prostrata — 2n = 22, diploid (Fig. 4B): This is the first report of a chromosome number for this species. The chromosomes were 2.3 to 4.1 μm long.

(12) Peperomia reticulata — 2n = 132, dodeca-ploid (Fig. 4G): This is the first report of a chromosome number for this African species. The chromosomes were 1.5 to 3.3 μm long.

(13) Peperomia rubella — 2n = 22, diploid (Fig. 4C): The chromosomes were 1.8 to 2.9 μm long.

(14) Peperomia verticillata — 2n = 22, diploid (Fig. 4D): The chromosomes were 1.7 to 3.1 μm long.

The metaphase chromosomes in somatic cells were comparatively large in Peperomia alata, P. diaphanoides, P. flexicaulis, P. glabella, P. hy-lophila, and P. prostrata. The shortest chromo-somes in each cell were 2.0–2.4 μm long, and the longest were 3.4–4.4 μm long. In contrast, the chromosomes of P. bicolor, P. blanda, P. galioi-des, P. okinawensis, P. polystachya, P. reticulata, P. rubella, and P. verticillata were comparatively small. The shortest chromosomes in each cell were 1.3–1.8 μm long, and the longest were 2.9–3.3 μm long. These values are in good agreement with the findings of Okada (1986), who reported the shortest chromosomes of P. japonica to be ca. 1 μm long and the longest to be ca. 3 μm long.

Discussion

Section-equivalent plant groups of Peperomia subg. Micropiper

The resolution of our molecular phylogenetic tree (Fig. 2) was higher than in previous studies based on trnK and trnK-psbA regions (Frenzke et al. 2015). Our tree of Peperomia subg. Micropip-er formed seven major clades. Each of the seven clades received more than 60% BS (FBE), 90% BS (TBE), or 1.00 PP. The clades were also sup-ported by morphological features, such as phyl-

lotaxis, leaf dimorphism, conspicuousness of leaf nerves, stem habit (erect or procumbent), stem color, presence or absence of stolons, and growth pattern of shoots (Table 5). Thus, we recognize them as section-equivalent groups, which we name Alatoid, Blandoid, Glabelloid, Glaucoid, Japonicoid, Lanceolatoid, and Rotundifolioid (Fig. 2). Because we analyzed only 57 of the 596 species of P. subg. Micropiper, and three species were not included in any of the seven clades (Fig. 2), we avoid using formal taxonomic names for the seven clades, instead using tentative informal names.

The seven clades are distinguishable not only morphologically, but also by karyotype and geo-graphic distribution (Table 5), and appear to be discrete evolutionary entities. Among them, Ja-ponicoid, Blandoid, and Glaucoid have shoots that wither immediately after fruiting. Japonicoid is the only clade of Peperomia subg. Micropiper that occurs outside the Americas; i.e. in Asia, Af-rica and the Pacific islands. It consists primarily of totally greenish species (Fig. 1D), which are tetraploid, decaploid, and dodecaploid (not dip-loid) with comparatively small chromosomes (1.3–3.3 μm). Blandoid and Glaucoid have dimor-phic leaves (Fig. 1Aa, b, Ff, g) and small chromo-somes (1.6–3.1 μm); the former is diploid and pro-duces stolons; the latter is tetraploid and lacks stolons.

The remaining four plant groups of Pepero-mia subg. Micropiper have shoots that continue to grow after fruiting (Fig. 1Bc). Plants of Lan-ceolatoid are usually reddish in part or overall with verticillate leaves, at least at a few nodes. Plants of Rotundifolioid are diploid and totally green, with procumbent stems and strictly alter-nate leaves. Plants of Glabelloid and Alatoid are highly similar both morphologically and karyo-logically. Both are diploid with comparatively large chromosomes (2.0–4.4 μm). They have al-ternate leaves with conspicuous veins on the ad-axial surface; i.e. grooved (Fig. 1Ee) or white-lined (Fig. 1Bd), and reddish and usually erect stems. Under cultivation, Glabelloid plants are quite vigorous, while those of Alatoid are not. However, it is difficult to distinguish them in the


wild. Further studies are needed to know why they are so similar morphologically, although they are remotely positioned in our plastid phylo-genetic tree (Fig. 2). An artificial key to each sec-tion-equivalent group of P. subg. Micropiper is provided below.

Peperomia bicolorPeperomia bicolor was not included in any of

the seven groups, but was positioned as a sister to the common Blandoid and Alatoid clades (Fig. 2). Peperomia bicolor (Fig. 1C) is morphologically similar to plants of the Alatoid group (Fig. 1B). Further, although its chromosome number was reported as 2n = 36 (Jose et al. 1994), we con-firmed that it is 2n = 22 (Table 1), as in Alatoid. The only difference between P. bicolor and Ala-toid is in chromosome size: the chromosomes of P. bicolor (Fig. 3B) are much smaller than in Ala-toid (Figs. 3A, F, H, & 4B).

New findings on American species of Peperomia In this study, the molecular sequences of four

species of Peperomia subg. Micropiper from America, P. diaphanoides, P. flexicaulis, P. langsdorffii, and P. verticillata, were analyzed for the first time and their phylogenetic positions are reported here. Peperomia langsdorffii had DNA sequences identical to P. blanda (Blandoid; Fig. 2) for all nine of the plastid regions analyzed (9,016 bp). This study therefore supports the treat-ments of Trelease & Yuncker (1950), Yuncker (1953) and Zuloaga et al. (2008), who considered P. langsdorfii to be conspecific with P. blanda. Peperomia diaphanoides was shown to be em-bedded within the clade of P. glabella (Glabel-loid) (Fig. 2), which is highly similar morphologi-cally to P. diaphanoides. Thus, P. diaphanoides should be placed in synonym under P. glabella. Further, two American species, P. flexicaulis and P. verticillata, were included in Alatoid and Blan-doid, respectively (Fig. 2).

New findings on Asian, including Japanese, spe-cies of Peperomia

Three Japanese species, Peperomia boninsi-mensis, P. japonica and P. okinawensis, and two

Thai species, P. cochinensis and P. heyneana, as-signed to P. subg. Micropiper, were included in a molecular analysis for the first time, and all were revealed to be in the same clade, Japonicoid (Fig. 2), confirming that the Japonicoid clade consists exclusively of species from outside the Americas (Table 5).

Peperomia japonica is sometimes considered a synonym of P. blanda (Tseng et al. 1999). In our analysis, however, they appeared in different sec-tion-equivalent plant groups: Japonicoid and Blandoid, respectively (Fig. 2). They also differed in chromosome number: 2n = 22 for P. blanda and 2n = 44 for P. japonica (Table 1). Thus, we consider them different species. Peperomia oki-nawensis was embedded within the clade of P. japonica (Fig. 2). Although P. japonica is hairy while P. okinawensis is glabrous, there are no other remarkable differences between them; they also have the same chromosome number, 2n = 44 (Table 1). Thus, we consider P. okinawensis to be a glabrous variety of P. japonica occurring in the central Ryukyu and Daito islands, Japan. Further, P. boninsimensis, which is endemic to the Ogas-awara Islands, Japan, was not in a clade with oth-er Japanese species, but rather with species from the Pacific islands; i.e. P. pallida, P. henderso-nensis, and P. societatis (Fig. 2). Thus, we con-sider P. boninsimensis of the Ogasawara Islands to have originated from a common ancestor with species from the Pacific islands rather than those from Japan.

Taxonomic treatmentPeperomia japonica Makino var. okinawensis (T. Yamaz.) Y. H. Kobay. & M. N. Tamura, stat. nov.

Basionym: Peperomia okinawensis T. Yamaz. in J. Jap. Bot. 67: 15, f. 1a, 2 & 3 (1992).—Type: Japan, Okinawa Isl., the peak of Hedoishiyama, 80 m alt., in shady crevice on rock, 26 June 1955, S. Hatusima 1844 (TI).

Peperomia japonica Makino f. glabra Hatus., Fl. Ryukyus: 217 (1971), nom. nud.

Peperomia japonica Makino f. okinawensis


(T. Yamaz.) Hatus. in Hatusima & Amano, Fl. Ryukyus, 2 ed.: 29 (1994), nom. nud.

We express our sincere gratitude to Dr. Koji Takayama for his comments. We extend our hearty thanks to Dr. No-buko Yamamoto for her help in observing the chromo-somes. Our cordial thanks are due to Dr. Hiroshi Tobe, Mr. Junichi Nagasawa and other staff members of the Kyoto Botanical Gardens, Dr. Satoshi Koi and other members of the staff of the Botanical Gardens, Faculty of Science, Osaka City University, Dr. Chie Tsutsumi and

other staff members of Tsukuba Botanical Garden, Dr. Akihiro Seo and other staff members of The Kochi Pre-fectural Makino Botanical Garden, and staff members of the Botanical Gardens, Graduate School of Science, Kyo-to University for supplying us with the plant materials used in this study. We are much indebted to Mr. Manop Poopath and other members of BKF, Department of Na-tional Parks, Wildlife and Plant Conservation, Thailand, and Prof. Tetsuo Denda for their assistance during our fieldwork. This study was supported in part by JSPS KA-KENHI (Grants-in-Aid for Scientific Research) Grant Number JP16H05763.

Key to the section-equivalent plant groups of Peperomia subg. Micropiper

1a. Leaves dimorphic, lower leaves 2/3 times as large as upper leaves; lower leaves highly succulent, 2 mm thick or more, upper leaves less succulent, ca. 1 mm thick ............................................................................................................................ 21b. Leaves not all alike ................................................................................................................................................................... 32a. Stolons present; leaves verticillate or opposite at least at middle of stem; diploid (2n = 22) .................................. Blandoid2b. Stolons absent; leaves strictly verticillate; tetraploid (2n = 44) ................................................................................. Glaucoid3a. Shoots withering after fruiting; stems usually green; tetraploid, decaploid, dodecaploid (2n=44, 110, 132); Asia, Africa and Pacific islands ........................................................................................................................................ Japonicoid3b. Shoots continuing to grow after fruiting; stems reddish or sometimes green; diploid (2n = 22) or chromosome number unknown; America .................................................................................................................................................................. 44a. At least several leaves verticillate; stem usually reddish; chromosome number unknown .............................. Lanceolatoid 4b. Leaves alternate; stem reddish or green; diploid (2n = 22) ..................................................................................................... 55a. Nerves on adaxial surface of leaves not conspicuous; stems green, procumbent ........................................... Rotundifolioid5b. Nerves on adaxial surface of leaves conspicuous; stems reddish, usually erect ................................................................... 66a. Most species prominently vigorous in cultivation .................................................................................................. Glabelloid 6b. Most species growing poorly in cultivation ................................................................................................................. Alatoid

References

APG IV. 2016. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV. Bot. J. Linn. Soc. 181: 1–20.

Bai, G. V. S. & D. Subramanian. 1985. Cytotaxonomical studies of south Indian Piperaceae. Cytologia 50: 583–592.

Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a chromosome atlas of the New Zealand flora – 25 mis-cellaneous species. New Zealand J. Bot. 21: 13–20.

Burger, W. C. 1977. The Piperales and the monocots: al-ternate hypotheses for the origin of monocotyledon-ous flowers. Bot. Rev. (Lancaster). 43: 345-393.

Chiang, T. Y., A. S. Barbara & P. I. Ching. 1998. Univer-sal primers for amplification and sequencing a non-coding spacer between the atpB and rbcL genes of chloroplast DNA. Bot. Bull. Acad. Sin. 39: 245–250.

Cronquist, A. 1957. Outline of a new system of families and orders of dicotyledons. Bull. Jard. Bot. État. Bruxelles. 27: 13–40.

Cronquist, A. 1988. The Evolution and Classification of Flowering Plants, 2nd ed. The New York Botanical Garden, New York.

Darriba, D., G. L. Taboada, R. Doallo & D. Posada. 2012. jModelTest 2: more models, new heuristics and paral-lel computing. Nature, Meth. 9: 772.

Doyle, J. J. & J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11–15.

Endress, P. K. & E. M. Friis. 1994. Introduction – Major trends in the study of early flower evolution. Pl. Syst. Evol., Suppl. 8: 1–6.

Frenzke, L., E. Scheiris, G. Pino, L. Symmank, P. Goet-ghebeur, C. Neinhuis, S. Wanke & M. S. Samain. 2015. A revised infrageneric classification of the ge-nus Peperomia (Piperaceae). Taxon 64: 424–444.

Frenzke, L., P. Goetghebeur, C. Neinhuis, M. S. Samain & S. Wanke. 2016. Evolution of Epiphytism and Fruit


Traits Act Unevenly on the Diversification of the Spe-cies-Rich Genus Peperomia (Piperaceae). Front. Pl. Sci. 7: 1145.

Johnson, L. A. & D. E. Soltis. 1995. Phylogenetic infer-ence using matK sequences. Ann. Missouri Bot. Gard. 82: 149–175.

Jose, J., J. E. Thoppil & L. Mathew. 1992. Chromosome complement analysis in five species of Peperomia Ruiz and Pav. Cytologia 57: 227–229.

Jose, J., J. E. Thoppil & L. Thomas. 1994. Karyotype analysis in Peperomia Ruiz & Pav. Caryologia 47: 75–79.

Katoh, K., K. Kuma, H. Toh & T. Miyata. 2005. MAFFT version 5: improvement in accuracy of multiple se-quence alignment. Nucl. Acids Res. 33: 511–518.

Kozlov, A. M., D. Darriba, T. Flouri, B. Morel & A. Sta-matakis. 2018. RAxML-NG: A fast, scalable, and us-er-friendly tool for maximum likelihood phylogenetic inference. bioRxiv. doi:10.1101/447110.

Lemoine, F., J. B. Entfellner, E. Wilkinson, D. Correia, M. D. Felipe, T. D. Oliveira & O. Gascuel. 2018. Re-newing Felsenstein’s phylogenetic bootstrap in the era of big data. Nature 556: 452–456.

Liston, A. & J. W. Kadereit. 1995. Chloroplast DNA evi-dence for introgression and long distance dispersal in the desert annual Senecio flavus (Asteraceae). Pl. Syst. Evol. 197: 33–41.

Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1998. Cytological studies in south Indian Piperaceae II. Peperomia. J. Cytol. Genet. 33: 155–158.

Mathew, P. J., P. M. Mathew & P. Pushpangadan. 1999. Cytology and its bearing on the systematics and phy-logeny of the Piperaceae. Cytologia 64: 301–307.

Murray, B. G. & P. J. Lange. 1999. Contributions to a chromosome atlas of the New Zealand flora – 35. Mis-cellaneous families. New Zealand J. Bot. 37: 511–521.

Neinhuis, C., K. W. Hilu, K. Müller & T. Borsch. 2005. Phylogeny of Aristolochiaceae based on parsimony, likelihood, and Bayesian analyses of trnL-trnF se-quences. Pl. Syst. Evol. 250: 7–26.

Okada, H. 1986. Karyomorphology and relationships in some genera of Saururaceae and Piperaceae. Bot. Mag. (Tokyo) 99: 289–299.

Ono, M. 1977. Cytotaxonomical studies on the flowering plants endemic to the Bonin Islands. Mem. Nat. Sci. Mus., no. 10: 63–76. (in Japanese with English sum-mary).

Ooi, K., Y. Endo, J. Yokoyama & N. Murakami. 1995. Useful primer designs to amplify DNA fragment of the plastid gene matK from angiosperm plants. J. Jap. Bot. 70: 328–333.

Rambaut, A., A. J. Drummond, D. Xie, G. Baele & M. A. Suchard. 2018. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst. Biol. 67: 901–904.

Ronquist, F., M. Teslenko, P. V. Mark, D. L. Ayres, A. Darling, S. Höhna, B. Larget, L. Liu, M. A. Suchard

& J. P. Huelsenbeck. 2012. MRBAYES 3.2: Efficient Bayesian phylogenetic inference and model selection across a large model space. Syst. Biol. 61: 539–542.

Samain M. S., S. Wanke, G. Mathieu, C. Neinhuis & P. Goetghebeur. 2008. Verhuellia revisited–unravelling an intricate taxonomical history and a new subfamil-ial classification of Piperaceae. Taxon 57:583–587.

Samain M. S., L. Vanderschaeve, P. Chaerle, P. Goetghe-beur, C. Neinhuis & S. Wanke. 2009. Is morphology telling the truth about the evolution of the species rich genus Peperomia (Piperaceae)? Pl. Syst. Evol. 278: 1–21.

Samuel, R. & W. Morawetz. 1989. Chromosomal evolu-tion within Piperaceae. Pl. Syst. Evol. 166: 105–117.

Sanders, R. W., T. F. Stuessy & R. Rodriguez. 1983. Chro-mosome numbers from the flora of the Juan Fernan-dez Islands. Amer. J. Bot. 70: 799–810.

Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Miller, K. C. Siripun, C. T. Winder, E. E. Schilling & R. L. Small. 2005. The tortoise and the hare II: rela-tive utility of 21 noncoding chloroplast DNA se-quences for phylogenetic analysis. Amer. J. Bot. 92: 142–166.

Smith, J. B. 1966. Chromosome numbers in Peperomia Ruiz & Pav. (Piperaceae) and a note on chromosome number of Piper magnificum Trelease. Kew Bull. 20: 521–526.

Smith, J. F., A. Stevens, E. J. Tepe & C. Davidson. 2008. Placing the origin of two species-rich genera in the late cretaceous with later species divergence in the tertiary: a phylogenetic, biogeographic and molecular dating analysis of Piper and Peperomia (Piperaceae). Pl. Syst. Evol. 275: 9–30.

Spooner, D. M., T. F. Stuessy, D. J. Crawford & M. Silva. 1987. Chromosome numbers from the flora of the Juan Fernandez Islands II. Rhodora 89: 351–356.

Steele, K. P. & R. Vigalys. 1994. Phylogenetic analyses of Polemoniaceae using nucleotide sequences of the plastid gene matK. Syst. Bot. 19: 126–142.

Taberlet, P., L. Gielly, G. Pautou & J. Bouvet. 1991. Uni-versal primers for amplification of three non-coding regions of chloroplast DNA. Pl. Molec. Biol. 17: 1105–1109.

Takhtajan, A. 1969. Flowering Plants, Origin and Disper-sal, Eng. ed. Oliver & Boyd, Edinburgh.

Tamura, M. 1974. Phylogeny and Classification of the An-giosperms. Sanseido, Tokyo (in Japanese).

Trelease, W. & G. T. Yuncker. 1950. The Piperaceae of northern South America. University of Illinois Press, Urbana, Illinois.

Tropicos.org. Missouri Botanical Garden. <http://www.tropicos.org.> [accessed 14 Mar. 2018]

Tseng, Y.-C., N. Xia & M. G. Gilbert. 1999. Piperaceae. In: Wu, Z. Y. & P. H. Raven (eds.), Flora of China, vol. 4, pp. 110–131. Science Press, Beijing, and Missouri Botanical Garden Press, St. Louis.

Valdebenito, H., T. F. Stuessy, D. L. Crawford & M. Silva.


1992. Evolution of Peperomia (Piperaceae) in the Juan Fernandez Islands, Chile. Pl. Syst. Evol. 182: 107–119.

Wang, W., Y. Wu, Y. Yan, M. Ermakova, R. Kerstetter & J. Messing. 2010. DNA barcoding of the Lemnaceae, a family of aquatic monocots. B. M. C. Pl. Biol. 10: 205.

Wanke, S., M. S. Samain, L. Vanderschaeve, G. Mathieu, P. Goetghebeur & C. Neinhuis. 2006. Phylogeny of the genus Peperomia (Piperaceae) inferred from the trnK/matK region (cpDNA). Pl. Biol. (Stuttgart). 8: 93–102.

Wanke, S., M. A. Jaramillo, T. Borsch, M. S. Samain, D. Quandt & C. Neinhuis. 2007. Evolution of Piperales – matK gene and trnK intron sequence data reveal lin-eage specific resolution contrast. Molec. Phylogen. Evol. 42: 477–497.

Wanke, S., L. Vanderschaeve, G. Mathieu, C. Neinhuis, P. Goetghebeur & M. S. Samain. 2007. From forgotten taxon to a missing link? The position of the genus Verhuellia (Piperaceae) revealed by molecules. Ann.

Bot. 99: 1231–1238.White, T. J., T. D. Bruns, S. B. Lee & J. W. Taylor. 1990.

Amplification and direct sequencing of fungal ribo-somal RNA genes for phylogenetics. In: Innis, M. A., D. H. Gelfand, J. J. Sninsky, & T. J. White (eds.), PCR Protocols: A Guide to Methods and Applications, pp. 315–322. Academic Press, San Diego.

Yamamoto, N., H. Ikeda & T. Hoshino. 2008. Cytotaxo-nomical studies of flowering plants in Yakushima Is-land, Kagoshima Prefecture, Japan. Part I: dwarf taxa. J. Phytogeogr. Taxon. 56: 79–93.

Yonekura, K. 2015. Piperaceae. In: Ohashi, H., Y. Kadota, J. Murata & K. Yonekura (eds.), Wild Flowers of Ja-pan 1, pp. 55–56. Heibonsha, Tokyo (in Japanese).

Yuncker, T. G. 1953. The Piperaceae of Argentina, Bo-livia and Chile. Lilloa 27: 97–303.

Zuloaga, F. O., O. Morrone & M. J. Belgrano. 2008. Piperaceae. In: Zuloaga, F. O., O. Morrone & M. J. Belgrano (eds.), Catálogo de las plantas vasculares del Cono Sur. Monogr. Syst. Bot. Missouri Bot. Gard. 107: 2712–2730.

Received May 7, 2018; accepted August 21, 2018

Documents

iosystematic Studies on the Family Piperaceae (Piperales