In Vitro Reconstitution of an Escherichia coli RNA-guidedImmune System Reveals Unidirectional, ATP-dependentDegradation of DNA Target*

Received for publication, March 25, 2013, and in revised form, May 28, 2013 Published, JBC Papers in Press, June 11, 2013, DOI 10.1074/jbc.M113.472233

Sabin Mulepati and Scott Bailey1

From the Department of Biochemistry and Molecular Biology, Johns Hopkins University Bloomberg School of Public Health,Baltimore, Maryland 21205

Background: The CRISPR-Cas immune system protects E. coli against invasive DNA.Results:We have reconstituted this immune system in vitro using recombinant proteins.Conclusion: Degradation of invasive DNA is tightly regulated and unidirectional.Significance: Reconstitution provides an invaluable tool for understanding the CRISPR-Cas immune system.

Many prokaryotes utilize small RNA transcribed fromclustered, regularly interspaced, short palindromic repeats(CRISPRs) to protect themselves from foreign genetic elements,such as phage and plasmids. In Escherichia coli, this small RNAis packaged into a surveillance complex (Cascade) that uses theRNA sequence to direct binding to invasive DNA. Once bound,Cascade recruits the Cas3 nuclease-helicase, which then pro-ceeds to progressively degrade the invading DNA. Here, usingindividually purified Cascade and Cas3 from E. coli, we recon-stituteCRISPR-mediated plasmid degradation in vitro. Analysisof this reconstituted assay suggests thatCascade recruitsCas3 toa single-stranded region of the DNA target exposed by Cascadebinding. Cas3 then nicks the exposed DNA. Recruitment andnicking is stimulated by the presence, but not hydrolysis, ofATP. Following nicking and powered by ATP hydrolysis, theconcerted actions of the helicase and nuclease domains of Cas3proceed to unwind and degrade the entire DNA target in a uni-directional manner.

Prokaryotes are protected from invasion by foreigngenetic elements, such as plasmids and bacteriophage, by animmune system composed of clustered regularly interspacedshort palindromic repeats (CRISPRs)2 and their associated(cas) genes (1). CRISPR arrays consist of stretches of variableDNA sequence, called spacers, separated by short repeatsequences (2, 3). CRISPR systems function in three phases.Short fragments of invasive DNA are integrated as spacerswithin a CRISPR array during the integration phase. In theexpression phase, transcripts from CRISPR arrays are pro-cessed into short CRISPR RNAs (crRNAs) that are incorpo-rated into effector complexes. Directed by the sequence of the

crRNA, effector complexes identify and signal foreign nucleicacids for destruction during the final phase, interference.CRISPR systems have been classified as Type I, II, or III,

based on the presence of the signature gene cas3, cas9, or cas10,respectively (4). Each of these types has a distinct mechanismfor processing CRISPR transcripts and for the interferencephase (4). Of the three, the Type I system is the most prevalentand can be further subdivided into six subtypes (I-A to I-F),each containing related but subtype-specific genes. Much ofour understanding of the Type I systems comes from studies ofthe Type I-E system of Escherichia coli K12.The E. coli Type I-E system consists of eight cas genes and a

downstream CRISPR array. Five of these cas genes encode pro-tein subunits (CasA to -E) that with the crRNA form a 405-kDacomplex called the CRISPR-associated complex for antiviraldefense (Cascade) (5–7). Cascade acts as a surveillance com-plex, identifying DNA as foreign if it contains a sequence com-plementary to the crRNA (protospacer) and a protospacer-ad-jacent motif (PAM) (8–10) (Fig. 1). CRISPR arrays lack a PAMand, therefore, escape Cascade-mediated targeting (8, 9, 11).When Cascade binds foreign DNA, a flexible loop of the CasAsubunit recognizes the PAM (11, 12). Then base pairs formbetween the crRNA and the target strand of the protospacer,displacing the non-target strand to form an R-loop (Fig. 1) (6).Base pairing is thought to nucleate within the 8 bases of proto-spacer sequence adjacent to the PAM (seed sequence) and thenproceed over the complete protospacer (8, 11).Mutations in thePAM or seed sequence have a detrimental effect on Cascadebinding and thus the CRISPR immune response (8).Cas3, the signature protein of the Type I system (4), is

responsible for degrading foreign DNA. It is a two-domainprotein comprising an N-terminal histidine-aspartate (HD)domain and a C-terminal superfamily 2 helicase domain.TheHD domain exhibitsmetal-dependent nuclease activity onsingle-stranded DNA (ssDNA) (13–15). The helicase domaindisplays ATP- and magnesium-dependent DNA-DNA andDNA-RNA 3�–5� unwinding activity (15, 16). Recruited to pro-tospacer sites by Cascade, Cas3 progressively unwinds anddegrades the foreign DNA target through its combined ATP-dependent helicase and nuclease activities (17). Cas3 does not

* This work was supported, in whole or in part, by National Institutes of HealthGrant GM097330 (to S. B.).

1 To whom correspondence should be addressed: Dept. of Biochemistry andMolecular Biology, 615 N. Wolfe St., W8704, Baltimore, MD 21205. Tel.: 443-287-4769; Fax: 410-955-2926; E-mail: scbailey@jhsph.edu.

2 The abbreviations used are: CRISPR, clustered regularly interspaced shortpalindromic repeat; crRNA, CRISPR RNA; Cascade, CRISPR-associated com-plex for antiviral defense; PAM, protospacer-adjacent motif; HtpG, hightemperature protein G.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 31, pp. 22184 –22192, August 2, 2013© 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

22184 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 31 • AUGUST 2, 2013

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

interactwithCascade in the absence of targetDNA, andboth itsnuclease and helicase activities are essential for the interferencephase of Type I CRISPR immunity (17).Biochemical analysis of E. coli Cas3, and consequently the

E. coli Type 1-E system, has been hindered by the inability togenerate recombinant Cas3 (14, 16, 17). To resolve this,Westraet al. (17) observed that Cas3 and the CasA subunit of Cascadeoccur as fusion proteins in three species (Streptomyces sp.SPB78, Streptomyces griseus, andCatenulispora acidiphiaDSM44928) and then produced chimeric Cas3 fused to CasA by alinker sequence identical to that of S. griseus. This chimericprotein was expressed and purified with the other subunits aspart of a Cascade-Cas3 fusion complex. This complex coulddegrade target DNAboth in vitro and in vivo (17). However, thevastmajority of Type I systems contain stand-aloneCas3, and itis unknown if there are mechanistic differences between thefused and stand-alone systems.Here, we describe the purification of stand-alone E. coliCas3

and subsequent reconstitution of the bona fide E. coli Type I-Esystem.We show that transitionmetal ions, in particular cobalt,stimulate the nuclease activity of Cas3 and that Cas3 isrecruited by Cascade to DNA targets that contain both proto-spacer and PAM sequences. We also find that, unlike the Cas-cade-Cas3 fusion, the stand-alone proteins degrade a linearDNA target. Finally, we mapped the sites of DNA target cleav-age and determined that degradation by Cas3 is unidirectional.

EXPERIMENTAL PROCEDURES

Cloning and Mutagenesis—The genes encoding E. coli Cas3and high temperature protein G (HtpG) were amplified fromgenomic DNA (American Type Culture Collection) anddirectionally cloned into pMAT and pRSFDuet-1 (Novagen),respectively. pMAT was engineered by inserting DNAencoding maltose-binding protein into the SpeI site of pHAT4(18). QuikChange site-directed mutagenesis (Stratagene) wasused to create point mutants. Plasmid targets were prepared bycloning synthetic oligonucleotides carrying the appropriatesequence into pBAT4 (18). Primers and oligonucleotides arelisted in Table 1. All clones were verified by DNA sequencing.Protein Expression and Purification—E. coli Cascade, CasA,

and a subcomplex of Cascade lacking the CasA subunit(CasBCDE) were expressed and purified as described previ-ously (12). E. coli Cas3 was overexpressed in the T7Expressstrain of E. coli (New England Biolabs). Cells were grown at20 °C to an A600 of �0.3, at which point protein expression wasinduced with 0.2 mM isopropyl-�-D-thiogalactopyranoside.After overnight growth, the cells were harvested, lysed in bufferL (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, and 10% glycerol),clarified by centrifugation, and loaded onto a 5-ml immobilizedmetal affinity chromatography column (Bio-Rad). The columnwas washed consecutively with buffer L supplemented with 5mM imidazole and then 1 M NaCl. The remaining bound pro-teins were eluted with buffer L supplemented with 250 mM

imidazole. The sample was directly loaded onto aHiLoad 26/60S200 size exclusion column (GE Healthcare) pre-equilibratedin buffer A (20 mM Tris-HCl, pH 8.0, 200 mM NaCl, and 1 mM

dithiothreitol). Fractions containing Cas3 were pooled anddesalted into buffer B (20 mM Tris-HCl, pH 8.0, and 200 mM

NaCl). The N-terminal His6-maltose-binding protein tag wasremoved by overnight treatment with tobacco etch virus pro-tease at 4 °C. The cleaved sample was then flowed through animmobilized metal affinity chromatography column, concen-trated, and loaded onto a HiLoad 26/60 S200 size exclusioncolumn pre-equilibrated with buffer B. Purified Cas3 was con-centrated to �5 �M, flash-frozen, and stored at �80 °C. The

FIGURE 1. Schematic representation of the R-loop formed between Cas-cade and DNA target. The positions of the PAM and protospacer are shadedyellow and red, respectively. The location of the seed sequence is also indi-cated. Outlining delineates the region of the DNA protected in footprintingexperiments (6).

TABLE 1Primers and oligonucleotides used in these studies

Sequence (5�–3�)

Primers for gene amplificationCas3 forward GTGTGTGAATTCATGGAACCTTTTAAATATATATGCCCas3 reverse GTGTGTCTCGAGTTATTTGGGATTTGCAGGGATGHtpG forward GTGTGTCCATGGCGAAAGGACAAGAAACTCGTGGHtpG reverse GTGTGTGAATTCTCAGGAAACCAGCAGCTGGTTC

Primers for site directed mutagenesisD75A forward GTTATTTTTCATTGCTCTTCATGCTATTGGAAAGTTTGATATACGD75A reverse CGTATATCAAACTTTCCAATAGCATGAAGAGCAATGAAAAATAACD452A forward GTCGAAGTGTTTTAATTGTTGCTGAAGTTCATGCTTACGACACD452A reverse GTGTCGTAAGCATGAACTTCAGCAACAATTAAAACACTTCGAC

Oligonucleotides used to construct theplasmid targeta

Target strand CATGGACAGCCCACATGGCATTCCACTTATCACTGGCATGNon-target strand AATTCATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTC

Oligonucleotides used to construct syntheticDNA targets

Target strand TTAAAGGCCGCTTTTTCAATCTACACAATTGAGCAAATCAGACAGCCCACATGGCATTCCACTTATCACTGGCATTGATTTGCTCAATTTTGTAGATTGACGGAACGAGGGTAGA

Non-target strand TCTACCCTCGTTCCGTCAATCTACAAAATTGAGCAAATCAATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCTGATTTGCTCAATTGTGTAGATTGAAAAAGCGGCCTTTAA

a Oligonucleotides used to construct plasmid targets with variant Protospacer and PAM sequences contained mutations as indicated throughout.

Reconstitution of the E. coli CRISPR System

AUGUST 2, 2013 • VOLUME 288 • NUMBER 31 JOURNAL OF BIOLOGICAL CHEMISTRY 22185

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

D75A and D452A Cas3 mutants were co-expressed with HtpGin T7Express cells and purified like the wild-type protein.Preparation of Synthetic DNA Targets—PAGE-purified

oligonucleotides (Table 1) were 5�-labeled with �-[32P]ATP(PerkinElmer Life Sciences) using T4 polynucleotide kinase(New England Biolabs). Duplexes were formed by mixing thetarget and non-target strands, heating at 95 °C for 2 min, andthen cooling to room temperature over 2 h. DNA ladders wereprepared using a Sanger sequencing kit (Asymmetrix).Reconstitution Assay—Reactions were performed in buffer

containing 5mMHEPES, pH 7.5, and 60mMKCl. The indicatedamounts of divalentmetal ions, targetDNA,Cascade, Cas3, andATP were assembled together and incubated at 37 °C for 30min or the indicated duration. All reactions were terminated bythe addition of 20 mM EDTA. The range in divalent metal ionconcentrations was chosen based on their estimated cellularconcentrations (19–21). Proteins were removed by phenolextraction. Plasmid DNA was analyzed by electrophoresisthrough 1% agarose gels and ethidium bromide staining.Labeled synthetic DNA was analyzed by electrophoresisthrough 10% polyacrylamide gels and autoradiography.ATPase Assay—ATP hydrolysis by Cas3 was monitored

using an NADH-coupled ATPase assay as described previously(22). Two reaction mixtures were prepared, each in 10 mM

HEPES, pH 7.5, 60 mM KCl, and 10% glycerol. Mixture A con-tained 0.5 mM NADH, 4 mM ATP, and 20 mM MgCl2 as well as4 nM DNA where indicated. Mixture B contained 6 mM phos-phoenol pyruvate (Sigma-Aldrich) and 0.4 units/�l pyruvatekinase/lactate dehydrogenase (Sigma-Aldrich) as well as 40 nMCascade and/or 200 nM Cas3 where indicated. Mixtures A andB were incubated separately at 37 °C for 10 min before equalvolumes of both were mixed to initiate a 100-�l reaction.Absorbance at 340 nM was measured every 30 s for 10min. Therate of NADH oxidation was calculated from the lineardecrease in A340. All reactions were performed at 37 °C.

RESULTS

Overexpression and Purification of Recombinant E. coliCas3—To facilitate expression and purification, the geneencoding E. coliCas3was clonedwith anN-terminal His6malt-ose-binding protein tag. The maximum yield of soluble protein(�1 mg of pure protein/liter of culture) was obtained whencultures were grown at 20 °C, and expression was induced inearly log phase (A600 of 0.3). Cultures grown at higher temper-atures or cultures that were induced above an A600 of 0.3 pro-

duced little or no soluble Cas3. Tagged protein was purifiedfrom clarified cell lysate by nickel affinity and size exclusionchromatographies. Tobacco etch virus protease was added toremove the tag, and untagged proteinwas isolated by additionalnickel affinity and size exclusion steps. Untagged Cas3 elutedfrom the size exclusion column at the volume expected for aCas3monomer andwas over 90%pure, as judged by SDS-PAGEandCoomassie staining (Fig. 2A).Mutant variants of Cas3wereproduced in a similar manner as wild-type protein, except forco-expression with the chaperone HtpG (23), to compensatefor their lower solubility.Cascade-directed Cleavage of Plasmid DNA by Cas3—The

HD domain of Cas3 specifically cleaves ssDNA (13–15). Previ-ously, we have shown that transition metal ions and not mag-nesium ions activate the nuclease activity of Thermus thermo-philus Cas3 (13). Therefore, we tested the nuclease activity ofE. coliCas3 on circular single-stranded DNA (M13 phage) witha selection of divalentmetal ions before attempting to reconsti-tute the activity of the E. coli CRISPR system. Consistent withthe results from T. thermophilus, nickel ions stimulated thenuclease activity of the E. coli protein (Fig. 2B). Because mag-nesium ions are necessary for the ATPase activity of Cas3 (14),magnesium and transition metal ions were included in subse-quent reconstitution assays.To test whether Cascade can direct stand-alone Cas3 to

degrade DNA target in a reconstituted system, we incubatedCas3 and Cascade with a plasmid target bearing functionalPAM and complementary protospacer sequences. Followingincubation, proteins were removed by phenol extraction, andthe DNA was analyzed by electrophoresis through agarose gelsand ethidium bromide staining. We found that in the presenceof ATP, Mg2�, and transition metal ions, in particular Co2�,Cascade directed Cas3 to degrade the plasmid target, as shownby a nonspecific smear of dsDNA products on the agarose gel(Fig. 3A). Reactions containing eitherMg2� or select transitionmetal ions, but not both, degraded plasmid target to a muchlesser extent, consistent with the differing metal ion require-ments of the twodomains ofCas3 (Fig. 3,A–C) (13, 14). Controlplasmids lacking a protospacer sequence were not degraded.Target degradation was also ablated when a critical residue inthe nuclease active site of Cas3 was mutated (D75A) (Fig. 3B)(13–15, 17).Previous electrophoretic mobility shift assays have demon-

strated thatCascade requires theCasA subunitwhenbinding to

FIGURE 2. Purification and single-stranded DNA nuclease activity of E. coli Cas3. A, Coomassie-stained SDS-polyacrylamide gel of samples taken duringpurification of Cas3. B, Cas3 nuclease activity is stimulated by transition metals. Reaction mixtures containing 500 nM Cas3, 4 nM circular, single-strandedM13mp18 DNA, and different metal ions, as indicated, were incubated for 1 h at 37 °C.

Reconstitution of the E. coli CRISPR System

22186 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 31 • AUGUST 2, 2013

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

dsDNA target (11, 12, 24). Consistently, a subcomplex of Cas-cade lacking the CasA subunit (CasBCDE) was unable to directdegradation of the plasmid target. The addition of CasA to thereaction restored this activity (Fig. 3D).ATP is required for DNA target degradation (17) (Fig. 3). In

the absence ofATP, theCascade-Cas3 fusionwas shown tonickthe DNA target, and an ATPase-deficient variant of the fusionnicked the target both in the presence or absence of ATP (17).With 50 nM stand-alone Cas3, only 13% of the plasmid targetwas nicked in the absence of ATP (Fig. 3A). However, when theconcentration ofCas3was varied, nicking activity increased in aconcentration-dependent manner (Fig. 3E); 68% of the targetwas nicked at 300 nM Cas3. When ATP was included in the

reaction, target was completely degraded except at the lowestconcentrations of Cas3. In addition, the nicking activity of anATPase-deficient variant (D452A) of Cas3 was stimulated bythe presence of ATP (Fig. 3E). In the absence of ATP, the vari-ant Cas3 nicked 55% of the target DNA, but in the presence ofATP, close to 100% of the target DNA was nicked. These datasuggest that Cas3 recruitment to target DNA is stimulated bythe binding but not the hydrolysis of ATP. To further examinethe effects of ATP on Cas3 activity, we monitored target degra-dation as a function of ATP concentration (Fig. 3F). At highATP concentrations, we observed a smear on the agarose gelcorresponding to degradation products with a wide range ofsizes. At lower ATP concentrations, the average product size

FIGURE 3. Cascade-mediated nuclease and ATPase activities of Cas3. A, nuclease activity of Cas3. Reaction mixtures containing 20 nM Cascade, 2 mM ATP,2 nM plasmid DNA, and 50 nM Cas3 were incubated for 30 min at 37 °C. Metal ions, when included, were at the concentrations indicated. If not indicated, Mg2�

was included at 10 mM. B, reactions performed as in A with 10 mM Mg2� and, when present, 10 �M Co2�. The control plasmid lacks a protospacer. C, reactionsperformed as in A with either 9 mM Ca2�, 1 mM Zn2�, 150 �M Cu2�, 150 �M Ni2�, 150 �M Co2�, or 150 �M Mn2�. D, the CasA subunit is necessary for plasmiddegradation. Reaction mixtures containing 20 nM CasA and/or 20 nM CasBCDE with 10 mM Mg2�, 10 �M Co2�, 2 mM ATP, 2 nM plasmid DNA, and 50 nM Cas3 wereincubated for 30 min at 37 °C. E, target cleavage was monitored at increasing concentrations (as indicated) of Cas3 in the absence or the presence of 2 mM ATP.All reactions contained 10 mM Mg2� and 10 �M Co2�. F, target cleavage was monitored as a function of ATP concentration (as indicated). All reactions contained50 nM Cas3, 10 mM Mg2�, and 10 �M Co2�. In A–D, the position of negatively supercoiled (nSC), linear (L), and nicked or open circle (OC) DNA is indicated. G,rates of ATPase hydrolysis. Error bars, S.D. of the rate constant, taken from at least three independent measurements. DNA substrates are plasmid targetcontaining PAM and protospacer (1), single-stranded M13 phage DNA (2), and control plasmid, lacking a protospacer (3). *, plasmid DNA was linearizedbefore the reaction.

Reconstitution of the E. coli CRISPR System

AUGUST 2, 2013 • VOLUME 288 • NUMBER 31 JOURNAL OF BIOLOGICAL CHEMISTRY 22187

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

decreased and spanned a smaller range. These results suggestthat the frequency of cutting by the nuclease domain is coupledto the rate of DNA unwinding by the helicase domain.Cascade Bound to DNA Target Activates the ATPase Activity

of Cas3—The helicase domain of S. thermophilus Cas3 harborsboth ATP-dependent helicase and ssDNA-dependent ATPaseactivities (14). Using an NADH-coupled assay (22), we investi-gated the ATPase activity of E. coliCas3 by testing the effects ofreaction components on the rate of ATP hydrolysis (Fig. 3G).ATPase activity was not stimulated by dsDNA and was stimu-lated only modestly by ssDNA (�3-fold). The addition of Cas-cade alone failed to stimulate the ATPase activity, but with theaddition of plasmid target, the rate of ATP hydrolysis was stim-ulated �44-fold. This stimulation is dependent on base pairingbetween the crRNA and protospacer sequences because targetslacking a protospacer failed to stimulate the ATPase activity.NoATPase activity was detectedwith anATPase-deficient var-iant (D452A) of Cas3. These results suggest that the ATPaseactivity ofCas3 is tightly regulated and relies on the recruitmentof Cas3 by Cascade to a protospacer.Degradation of DNA Targets Requires both PAM and Seed

Sequences—Mutations in the PAM or seed sequences of DNAtargets render cells with an otherwise functional CRISPRsystem sensitive to phage infection (8). Binding studies revealedthat this is a result of the reduced affinity between Cascade andthe mutant DNA targets (8, 11). To determine if the activity ofour reconstituted CRISPR system is also dependent on PAMand seed sequences, we monitored nicking activity on plasmidtargets containing point mutations in either the PAM or theprotospacer. These reactions were performed in the absence ofATP to avoid smearing of the DNA products on the agarosegels, allowing us to quantify the activity through the ratio ofnicked product to negatively supercoiled substrate. Mutationsin the PAMsequence abolished target nicking,mutations in theseed sequence reduced nicking activity (particularly at posi-tions 1 and 4), and mutations outside the seed region generallyhad little to no effect (Fig. 4A).We also tested the ability of thesevariant targets to activate the ATPase activity of Cas3 (Fig. 4B)and found that the mutations had similar effects on ATPaseactivation as they had on nicking activity. Altogether, theseresults establish that the reconstituted assay recapitulates theobserved in vivo dependence for target PAM and seedsequences.Cascade Can Direct Cas3 to Degrade Linear DNA, and Deg-

radation Is Unidirectional—To determine if Cascade andstand-alone Cas3 can degrade linear DNA and if degradationproceeds from the protospacer in one or both directions, plas-mid targets were linearized using either of two restrictionenzymes, KpnI or ScaI. The protospacer is positioned �3 kbfrom the 5�-end of the target strand in theKpnI-treated plasmidand�2 kb away in the ScaI-treated plasmid. After reactionwiththe reconstituted CRISPR system, the linear KpnI- and ScaI-treated targets were clearly degraded, yielding products thatwere resistant to degradation of �3 and �2 kb, respectively(Fig. 5A). This pattern of resistance suggests that degradation isunidirectional, initiating in or near the protospacer and pro-ceeding upstream, leaving the downstream DNA intact (Fig.5A). As observed with negatively supercoiled targets, degrada-

tion of linear DNAwas also found to be ATP- and Cascade-de-pendent, and mutation of either the nuclease (D75A) or heli-case domain (D452A) ofCas3 ablated this degradation (Fig. 5B).To investigate if negative supercoiling affects the rate of tar-

get degradation by Cascade and stand-alone Cas3, we com-pared the rates of degradation of negatively supercoiled withlinearized plasmid targets (Fig. 5C). Fitting the data to a single-exponential decay yielded observed rate constants (kobs) of 2.92and 0.66 min�1 for negatively supercoiled and linear target,respectively (Fig. 5C). This suggests that the E. coli CRISPRsystem prefers negatively supercoiled target to linear targetby �4.5-fold. Consistent with the nuclease assay, both sub-strates stimulated ATPase activity, but activity with super-coiled target was greater than that of the linearized target by�2-fold (Fig. 3G).Mapping Degradation of Target DNA by Cas3—When Cas-

cade binds to foreign DNA, the crRNA base-pairs to the targetstrand and displaces the non-target strand. DNA footprintingexperiments show that the majority of the protospacer DNA isprotected when bound to Cascade except for a 19-base regionof the non-target strand (Fig. 1) (6). To determine if Cas3 nicksthis accessible region, we performed a reconstitution assay inthe absence of ATP, purified the nicked product from an aga-rose gel, and sequenced it using primers that flanked the pro-tospacer region. A clear interruption in the sequence of thenon-target strand was observed, whereas the sequence of thetarget strand was uninterrupted (Fig. 6A), indicating that nick-ing occurs in the accessible region of the non-target strand 11

FIGURE 4. Degradation of target DNA requires both the PAM and seedsequences. A, extent of nicking by Cas3 (100 nM) using negatively super-coiled target (2 nM) containing the indicated point mutations in the PAM andprotospacer. All reactions contained 10 mM Mg2� and 10 �M Co2�. B, rate ofATP hydrolysis by Cas3 (100 nM) in the presence of the mutant DNA targets asin A. In both panels, error bars indicate S.D., taken from at least three inde-pendent measurements. �PAM, DNA target containing a protospacersequence but not a PAM.

Reconstitution of the E. coli CRISPR System

22188 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 31 • AUGUST 2, 2013

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

bases from the 3�-end of the PAM. Next, we performed similarexperiments sequencing the linear product, enriched in assayscontaining low concentrations of ATP (Fig. 6A). Again, a clearinterruption in the sequence of the non-target strand wasobserved, 11 bases from the 3�-end of the PAM (Fig. 6A). How-ever, sequence information from the target strand was unread-able in the region of the protospacer, consistent with the pres-ence of multiple cuts in this strand (Fig. 6A).To map the degradation of target DNA in more detail, we

repeated reconstitution assays on synthetic dsDNA targets, onelabeled with 32P at the 5�-end of the target strand and the otherat the 5�-end of the non-target strand. In the absence ofATP (orin the presence of ATP but using the ATPase-deficient mutantof Cas3, D452A), the target strandwas not cleaved, whereas thenon-target strand was cut weakly within the protospacer, 7 and11 bases from the PAM sequence (Fig. 6, B–D).When ATPwasincluded in the reactions, multiple cuts were observed in bothstrands. In the target strand, cleavage occurred in the region 3�of the protospacer and in the flanking upstream DNA (Fig. 6, Band D). A similar cleavage pattern was observed for the non-target strand (Fig. 6, C and D). These results reaffirm that deg-radation of target DNA is unidirectional because we observe nocleavage downstream of the protospacer sequence. Thenuclease-deficient mutant (D75A) of Cas3 did not cut the syn-thetic DNA target. Targets lacking a PAM sequence also failedto be cut by wild-type Cas3.

DISCUSSION

During the interference stage, the E. coli Type I-E systemproceeds through the identification and degradation of foreignDNA.Cascade recognizes foreignDNAand then recruitsCas3 fortheATP-dependentdegradationof the target. Studiesof theE. colisystem have greatly increased our understanding of target recog-nition (6–8, 11, 12, 17, 24). However, themechanisms underlyingCas3 recruitment and subsequent target degradation are poorlyunderstood. This could be a result of an inability to produce arecombinant form of stand-alone E. coli Cas3 suitable for bio-chemical analysis. Here, we report the production of stand-aloneE. coli Cas3 with which we could reconstitute the E. coli Type I-Esystem in vitro.Using this in vitro system,we investigate themech-anism of Cas3 recruitment and subsequent target degradation.Cascade binding to target DNA is a prerequisite for recruit-

ment of Cas3. For Cascade to bind, DNA targets require a pro-tospacer complementary to the crRNA and a PAM (8). Cascadebinding generates an R-loop structure in the target DNA thatexposes part of the non-target strand (Figs. 1 and 7) (6). Ourresults indicate that this exposed ssDNA serves as the bindingplatform forCas3 and is also the site for the initial nicking of theDNA target (Figs. 6 and 7). Thus, complex formation betweenCascade and target DNA provides Cas3 with the ssDNArequired both for loading the helicase domain and as the sub-strate for nicking by the nuclease domain. Additional protein-protein interactions with Cascade, in particular the CasA sub-

FIGURE 5. Cas3 cleaves linear DNA and proceeds unidirectionally. A, nuclease activity of Cas3 on plasmid target linearized with KpnI or ScaI. Reactionmixtures containing 20 nM Cascade, 2 nM linear plasmid, 10 mM Mg2�, 10 �M Co2�, and 2 mM ATP were incubated for the indicated time at 37 °C. B, nucleaseactivity of Cas3 on plasmid target linearized with ScaI. Except where indicated, the reaction conditions were as in A. Reactions were incubated at 37 °C for 60min. C, comparison of the rate of cleavage of linear (ScaI) and negatively supercoiled plasmid. Reaction conditions were as in A, except that incubation timeswere as indicated. The position of negatively supercoiled (nSC), linear (L), and nicked or open circle (OC) DNA is indicated. In all panels, M denotes the markerlane, and C denotes a control reaction without Cas3.

Reconstitution of the E. coli CRISPR System

AUGUST 2, 2013 • VOLUME 288 • NUMBER 31 JOURNAL OF BIOLOGICAL CHEMISTRY 22189

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

unit, may also play a role in recruitment (17). Nicking of targetdoes not require ATP hydrolysis (17) but is stimulated by thepresence of ATP (Fig. 3, A and E), probably because ATP bind-ing stimulates recruitment of Cas3. Mutations in the PAM andseed sequence, which reduce the binding affinity of Cascade (8),inhibit the cleavage of DNA target (Fig. 4A). Thus, the nucleaseactivity of Cas3 is tightly regulated. Only DNA that has beencorrectly engaged by Cascade and formed an R-loop will bedegraded. Similarly, we also find that the ATPase activity istightly regulated, being significantly activated only in situationswhere Cascade can form an R-loop with DNA target (Fig. 3G).

Tight regulation is presumably necessary to control the delete-rious effects Cas3 could have on the host chromosome or otherbeneficial DNA within the cell.Following nicking, further DNA cleavage requires ATP

hydrolysis by Cas3 (Fig. 3, A and E), presumably to provide theenergy for DNA unwinding, which generates the ssDNA sub-strate for the nuclease domain (Fig. 7). The coupling of dsDNAunwinding to ssDNA degradation is reminiscent of the mech-anism employed by the RecBCD family of enzymes in homolo-gous recombination (25). To further investigate DNA targetdegradation, wemapped the sites of this ATP-dependent cleav-

FIGURE 6. Mapping of the Cas3 cleavage sites. A, sequencing of the target and non-target strand of the nicked plasmid (no ATP) or the linearized plasmid (10�M ATP). B, cleavage of a synthetic dsDNA labeled at the 5�-end of the target strand. The position of the crRNA is marked at the side of the gel. Sequencing lanesare marked dA, dC, dG, and dT. �PAM, DNA target containing a protospacer sequence but not a PAM. C, same as B but labeled at the 5�-end of the non-targetstrand. For both B and C, reactions containing 40 nM Cascade, 100 nM Cas3, 10 mM Mg2�, 10 �M Co2�, and 2 mM ATP were incubated for 30 min at 37 °C, unlessotherwise indicated. D, schematic of the R-loop formed between the DNA target and the crRNA. Arrows or a dotted line indicate the sites of cleavage by Cas3.

FIGURE 7. Schematic representation of Cascade-mediated DNA target degradation by Cas3. Binding of Cascade (green) to DNA target displaces thenon-target strand of the protospacer. The displaced strand then serves as a binding platform for the recruitment of Cas3 (blue) (i). Once bound, Cas3 nicks thenon-target strand in a reaction that is stimulated by the presence of ATP but does not require ATP hydrolysis (ii). ssDNA binding stimulates the ATPase andhelicase activity of Cas3, which subsequently translocates in the 3�–5� direction on the non-target strand, unwinding the DNA target. Unwinding provides thessDNA substrate for the nuclease domain and probably releases Cascade from the protospacer. Thus, the combined actions of the helicase and nucleasedomains of Cas3 degrade the DNA target in a unidirectional manner (iii).

Reconstitution of the E. coli CRISPR System

22190 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 31 • AUGUST 2, 2013

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

age using labeled synthetic DNA. We found that Cas3 exten-sively cuts both strandswithin the protospacer and upstreamofthe PAM (Fig. 6). This, as well as results frommonitoring degra-dation of linear plasmids (Fig. 5), shows that the progression oftarget degradation is unidirectional, proceeding only upstream ofthe protospacer (Fig. 7). Cas3may also have an active role in recy-cling Cascade (14) because we also observe cuts in the targetstrand of the protospacer (Fig. 6), suggesting that the targetstrand has been unwound from the crRNA (Fig. 7). Consis-tently, E. coli Cas3 has been shown to harbor ATP-dependentR-loop unwinding activity (16).The activities of the two domains of Cas3 are coupled

because the helicase domain generates the substrate for thenuclease domain.Wemonitored degradation of plasmid targetas a function of ATP concentration to gain further insight intothis coupling (Fig. 3F). The unwinding activity of the helicasedomain should increase with ATP concentration. Our resultssuggest that, under these conditions, the nuclease domain cutsthe DNA less frequently, giving rise to products with a widerange of sizes. When the helicase rate is low, as observed withlower ATP concentrations, the nuclease domain makes cutsmore frequently, which generates smaller sized products.Genetic screening and expression experiments have shown

that the chaperone HtpG positively modulates E. coli Type I-Eresistance by maintaining functional levels of Cas3 (23). Con-sistent with this, we have shown that R-loop formation by Cas-cade is sufficient to recruit Cas3 toDNA targets, suggesting thatadditional factors, such as HtpG, are not essential at this step.The Cascade-Cas3 fusion has been shown to degrade nega-

tively supercoiled but not relaxed (i.e. nicked or linear) DNA(17). In our reconstituted system, stand-aloneCas3 can degradeboth negatively supercoiled and linear DNA (Fig. 5). However,the rate of degradation of negatively supercoiledDNA is greaterthan that of linear DNA by �4.5-fold. Negatively supercoiledDNA is probably a better substrate because of the increasedenergy required to melt the DNA strands over the length of theprotospacer in relaxed versus negatively supercoiled DNA (17).Indeed, negative supercoiling stimulates other processes thatrely on strand separation, such as RecA-mediated homologousrecombination (26). Because the most likely substrate for theType I CRISPR systems in vivo is negatively supercoiled DNA(17), further analysis of Type I systems, with both fused andstand-alone Cas3, will be needed to understand if there is func-tional significance to targeting relaxed DNA.While this manuscript was in preparation, Sinkunas et al.

(27) reported the in vitro reconstitution of theType I-ECRISPRsystem from S. thermophilus. Like E. coli, this system containsstand-alone Cas3 and Cascade. In agreement with the resultsreported here, they show that the reconstituted S. thermophilussystem is able to cleave linear DNA and that target degradationis unidirectional. They also go on to map the cleavage sites,revealing a pattern similar to that observed in the E. coliCRISPR system. Thus, the molecular mechanisms of the TypeI-E CRISPR systems appear conserved.

Acknowledgments—We thank Brian A. Learn for helpful discussionsand Jennifer M. Kavran for critical reading of the manuscript.

REFERENCES1. Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P.,

Moineau, S., Romero, D. A., and Horvath, P. (2007) CRISPR providesacquired resistance against viruses in prokaryotes. Science 315,1709–1712

2. Bolotin, A., Quinquis, B., Sorokin, A., and Ehrlich, S. D. (2005) Clusteredregularly interspaced short palindrome repeats (CRISPRs) have spacers ofextrachromosomal origin.Microbiology 151, 2551–2561

3. Mojica, F. J., Díez-Villaseñor, C., García-Martínez, J., and Soria, E. (2005)Intervening sequences of regularly spaced prokaryotic repeats derive fromforeign genetic elements. J. Mol. Evol. 60, 174–182

4. Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J., Charpentier, E.,Horvath, P., Moineau, S., Mojica, F. J., Wolf, Y. I., Yakunin, A. F., van derOost, J., and Koonin, E. V. (2011) Evolution and classification of theCRISPR-Cas systems. Nat. Rev. Microbiol. 9, 467–477

5. Brouns, S. J., Jore, M. M., Lundgren, M., Westra, E. R., Slijkhuis, R. J.,Snijders, A. P., Dickman,M. J., Makarova, K. S., Koonin, E. V., and van derOost, J. (2008) Small CRISPRRNAs guide antiviral defense in prokaryotes.Science 321, 960–964

6. Jore, M. M., Lundgren, M., van Duijn, E., Bultema, J. B., Westra, E. R.,Waghmare, S. P., Wiedenheft, B., Pul, U., Wurm, R., Wagner, R., Beijer,M. R., Barendregt, A., Zhou, K., Snijders, A. P., Dickman, M. J., Doudna,J. A., Boekema, E. J., Heck, A. J., van der Oost, J., and Brouns, S. J. (2011)Structural basis for CRISPR RNA-guided DNA recognition by Cascade.Nat. Struct. Mol. Biol. 18, 529–536

7. Wiedenheft, B., Lander, G. C., Zhou, K., Jore, M. M., Brouns, S. J., van derOost, J., Doudna, J. A., and Nogales, E. (2011) Structures of the RNA-guided surveillance complex from a bacterial immune system. Nature477, 486–489

8. Semenova, E., Jore, M. M., Datsenko, K. A., Semenova, A., Westra, E. R.,Wanner, B., van der Oost, J., Brouns, S. J., and Severinov, K. (2011) Inter-ference by clustered regularly interspaced short palindromic repeat(CRISPR) RNA is governed by a seed sequence. Proc. Natl. Acad. Sci.U.S.A. 108, 10098–10103

9. Mojica, F. J., Díez-Villaseñor, C., García-Martínez, J., and Almendros, C.(2009) Short motif sequences determine the targets of the prokaryoticCRISPR defence system.Microbiology 155, 733–740

10. Goren, M. G., Yosef, I., Auster, O., and Qimron, U. (2012) Experimentaldefinition of a clustered regularly interspaced short palindromic dupliconin Escherichia coli. J. Mol. Biol. 423, 14–16

11. Sashital, D. G., Wiedenheft, B., and Doudna, J. A. (2012) Mechanism offoreign DNA selection in a bacterial adaptive immune system. Mol. Cell46, 606–615

12. Mulepati, S., Orr, A., and Bailey, S. (2012) Crystal structure of the largestsubunit of a bacterial RNA-guided immune complex and its role in DNAtarget binding. J. Biol. Chem. 287, 22445–22449

13. Mulepati, S., and Bailey, S. (2011) Structural and biochemical analysis of nu-clease domain of clustered regularly interspaced short palindromic repeat(CRISPR)-associated protein 3 (Cas3). J. Biol. Chem. 286, 31896–31903

14. Sinkunas, T., Gasiunas, G., Fremaux, C., Barrangou, R., Horvath, P., andSiksnys, V. (2011) Cas3 is a single-stranded DNA nuclease and ATP-de-pendent helicase in the CRISPR/Cas immune system. EMBO J. 30,1335–1342

15. Beloglazova, N., Petit, P., Flick, R., Brown, G., Savchenko, A., and Yakunin,A. F. (2011) Structure and activity of the Cas3 HD nuclease MJ0384, aneffector enzyme of the CRISPR interference. EMBO J. 30, 4616–4627

16. Howard, J. A., Delmas, S., Ivancic-Bace, I., and Bolt, E. L. (2011) Helicasedissociation and annealing of RNA-DNA hybrids by Escherichia coliCas3protein. Biochem. J. 439, 85–95

17. Westra, E. R., van Erp, P. B., Künne, T.,Wong, S. P., Staals, R. H. J., Seegers,C. L., Bollen, S., Jore, M. M., Semenova, E., Severinov, K., de Vos, W. M.,Dame, R. T., de Vries, R., Brouns, S. J., and van der Oost, J. (2012) CRISPRimmunity relies on the consecutive binding and degradation of negativelysupercoiled invader DNA by Cascade and Cas3.Mol. Cell 46, 595–605

18. Peränen, J., Rikkonen, M., Hyvönen, M., and Kääriäinen, L. (1996) T7vectors with amodifiedT7lac promoter for expression of proteins inEsch-erichia coli. Anal. Biochem. 236, 371–373

Reconstitution of the E. coli CRISPR System

AUGUST 2, 2013 • VOLUME 288 • NUMBER 31 JOURNAL OF BIOLOGICAL CHEMISTRY 22191

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

19. Graham, A. I., Hunt, S., Stokes, S. L., Bramall, N., Bunch, J., Cox, A. G.,McLeod, C. W., and Poole, R. K. (2009) Severe zinc depletion of Esche-richia coli. Roles for high affinity zinc binding by ZinT, zinc transport andzinc-independent proteins. J. Biol. Chem. 284, 18377–18389

20. Macomber, L., Elsey, S. P., and Hausinger, R. P. (2011) Fructose-1,6-bis-phosphate aldolase (class II) is the primary site of nickel toxicity in Esch-erichia coli.Mol. Microbiol. 82, 1291–1300

21. Anjem, A., Varghese, S., and Imlay, J. A. (2009)Manganese import is a keyelement of the OxyR response to hydrogen peroxide in Escherichia coli.Mol. Microbiol. 72, 844–858

22. Kiianitsa, K., Solinger, J. A., and Heyer, W.-D. (2003) NADH-coupledmicroplate photometric assay for kinetic studies of ATP-hydrolyzing en-zymes with low and high specific activities. Anal. Biochem. 321, 266–271

23. Yosef, I., Goren, M. G., Kiro, R., Edgar, R., and Qimron, U. (2011) High-

temperature protein G is essential for activity of the Escherichia coli clus-tered regularly interspaced short palindromic repeats (CRISPR)/Cas sys-tem. Proc. Natl. Acad. Sci. U.S.A. 108, 20136–20141

24. Westra, E. R., Nilges, B., van Erp, P. B., van der Oost, J., Dame, R. T., andBrouns, S. J. (2012) Cascade-mediated binding and bending of negativelysupercoiled DNA. RNA Biol. 9, 1134–1138

25. Wigley, D. B. (2013) Bacterial DNA repair. Recent insights into the mech-anism of RecBCD, AddAB and AdnAB. Nat. Rev. Microbiol. 11, 9–13

26. Cai, L. (2001) Topological testing of the mechanism of homology searchpromoted by RecA protein. Nucleic Acids Res. 29, 1389–1398

27. Sinkunas, T., Gasiunas, G., Waghmare, S. P., Dickman, M. J., Barrangou,R., Horvath, P., and Siksnys, V. (2013) In vitro reconstitution of cascade-mediated CRISPR immunity in Streptococcus thermophilus. EMBO J. 32,385–394

Reconstitution of the E. coli CRISPR System

22192 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 31 • AUGUST 2, 2013

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Sabin Mulepati and Scott BaileyUnidirectional, ATP-dependent Degradation of DNA Target

RNA-guided Immune System RevealsEscherichia coli Reconstitution of an In Vitro

doi: 10.1074/jbc.M113.472233 originally published online June 11, 20132013, 288:22184-22192.J. Biol. Chem. 

  10.1074/jbc.M113.472233Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/288/31/22184.full.html#ref-list-1

This article cites 27 references, 8 of which can be accessed free at

by guest on October 10, 2020

http://ww

w.jbc.org/

Dow

nloaded from