Journal of the Neurological Sciences 337 (2014) 61–66

Contents lists available at ScienceDirect

Journal of the Neurological Sciences

j ourna l homepage: www.e lsev ie r .com/ locate / jns

Investigations of single nucleotide polymorphisms in folate pathwaygenes in Chinese families with neural tube defects

Jian Liu a,b,1, Jing Qi c,1, Xiao Yu a, Jie Zhu a, Lixia Zhang a, Qin Ning d, Xiaoping Luo a,⁎a Department of Pediatrics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Chinab Department of Pediatrics, Xiangyang Central Hospital, Xiangyang, Chinac Department of Neurology, Xiangyang Central Hospital, Xiangyang, Chinad Department of Infectious Disease, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China

⁎ Corresponding author at: No. 1095 Jiefang Avenue, W+86 27 83662393.

E-mail addresses: drliujian@gmail.com (J. Liu), qijingyyuxiao4249@sina.com (X. Yu), zjoyjay@163.com (J. Zhu),(L. Zhang), qning@tjh.tjmu.edu.cn (Q. Ning), xpluo@tjh.tj

1 Co-first authors.

0022-510X/$ – see front matter © 2013 Elsevier B.V. All rhttp://dx.doi.org/10.1016/j.jns.2013.11.017

a b s t r a c t

a r t i c l e i n f o

Article history:

Received 3 August 2013Received in revised form 10 November 2013Accepted 13 November 2013Available online 19 November 2013

Keywords:FolateGenetic associationNeural tube defectsSpina bifidaSingle nucleotide polymorphismsCase-parental control study

Aims: We investigated the hypothesis that there are interactions between SNPs in folate metabolism pathwaygenes and environmental risk factors to the etiology of neural tube defects (NTDs).Method: In 602 Chinese families, 609 aborted fetus tissues or blood sampleswere collected fromNTD individuals,and 1106 parental blood samples were detected as controls. We analyzed 28 SNPs in 12 folate pathway genes.Folate supplementation, gestational diabetes mellitus (GDM) and medicine administration before and duringpregnancy were investigated. Case–parental control study and transmission/disequilibrium tests were per-formed according to environmental cofactor stratification.Results: Association between 5,10-methylenetetrahydrofolate reductase (MTHFR) 677CNT and NTDs was signifi-cant in all stratifications (all P b .05), and synergistic effects of no folate supplementation and GDMwere shownon NTD occurrence. 5-Methyltetrahydrofolate–homocysteine methyltransferase (MTHM) 501ANG in case ofGDM, and betaine–homocysteinemethyltransferase (BHMT) 716GNA in case of no folate supplementation signif-icantly associatedwithNTDs (both P b .05), whereas the two genotypes alone did not significantly associatewith

NTDs (both P N .05).Conclusions: MTHFR 677CNT genotype, especially in case of no folate supplementation and GDM, promotes NTDoccurrence. MTHM 501ANG only in case of GDM, and BHMT 716GNA only in case of no folate supplementationcontribute to the etiology of NTDs.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

Neural tube defects (NTDs) represent themost common debilitatingbirth defect. Of 1000 live births, the neural tube will fail to close in 1 to13.87 embryos [1,2], which occurs around the 28th day after concep-tion. NTDs are caused by a complex interaction between genetic and en-vironmental risk factors [3]. Familial studies indicate the significantgenetic component to NTD occurrence, with a 40-fold increase in riskin first-degree relatives [4]. Myriad environmental exposures havebeen implicated in the development of NTDs. Maternal diabetes, folicacid deficiency and anti-epileptic drug administration during pregnancyare all teratogens that increase the risk for NTDs [5–7]. Periconceptionalmaternal supplementation with folic acid can notably prevent occur-rence of NTDs by up to 70% in the general population [6]. The

uhan 430030, China. Tel./fax:

s@126.com (J. Qi),zhlx1981508@yahoo.com.cnmu.edu.cn (X. Luo).

ights reserved.

mechanism by which folate supplementation prevents NTDs is poorlyunderstood [8].

Folate and methionine cycles are linked by the conversion from ho-mocysteine to methionine. Low folate level can directly limit its avail-ability to cells or indirectly disrupt methionine metabolism, therebyincreasing homocysteine in thematernal serum [9,10], and homocyste-ine is elevated in some NTDmothers [11]. Genes involved in folate me-tabolismarewidely studied, such as folate receptor (FR1and FR2), solutecarrier family 19 member 1 (SCF19M1), transcobalamin II (TCN2), 5-methyltetrahydrofolate–homocysteine methyltransferase (MTHM),methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), serine hy-droxymethyltranferase 1 (SHMT1), 5,10-methylenetetrahydrofolatereductase (MTHFR), 5-methyltetrahydrofolate–homocysteine meth-yltransferase reductase (MTHMR), betaine–homocysteine methyl-transferase (BHMT), cystathionine-beta-synthase (CBS) and nitricoxide synthase 3 (NOS3) [12–18]. Folate pathway genes are noticeablecandidates for NTDs, from both genetic and environmental perspectives.To date, most association studies in humans have focused on evaluatingfolate related candidate genes themselves. Interactions between genesand influence of environmental risk factors on genes have been ignoredin most studies. We compared SNPs in genes mentioned above betweenNTD individuals and their unaffected parents in different environmental

62 J. Liu et al. / Journal of the Neurological Sciences 337 (2014) 61–66

risk factor stratifications, to reveal which SNP pattern and environmentalfactor contribute to the etiology of NTDs.

2. Materials and methods

2.1. Sample population

NTD individuals were recruited through pediatric out- or inpatientdepartment, neurosurgical, pediatric surgical or obstetric referrals.Most severely affected caseswere identified through routine ultrasoundscanning in the course of pregnancy at an average embryo age aroundfour months, and were confirmed and recruited after birth or legal ter-mination of pregnancy with local ethical approval. Some cases withsuch symptoms as sensory and/or movement disorders beneath thelevel of lesion were diagnosed in clinic in early childhood while partialspina bifida occulta cases, whose spinal cord is intact with no obviousskin defects, hyperpigmented skin, a dermal sinus, or an abnormalpatch of hair were often diagnosed in pediatric department by X-rayphotography in children with enuresis. NTDs recruited comprise anen-cephaly, craniorachischisis, spina bifida cystica, encephalomeningocele,spina bifida occulta with symptoms and/or signs and other phenotypes,including isolated cases such as hydranencephaly, iniencephaly andtethered cord. Liver or blood samples from NTD individuals and theirparents were collected from September 2005 to December 2011 withthe approval of Hospital Ethics Committee and parental informed con-sent. The overwhelmingmajorities of subjectswereHan Chinesemainlyfrom central China. Environmental exposure interviews were conductedin all mothers of enrolled NTD cases, including pre- and postconceptionalfolate supplementation, gestational diabetes mellitus (GDM) andmedicine administration including antiepileptic, antipsychotics, orother drugs without certain safety certification.

2.2. SNP genotyping

DNA was extracted from blood or liver samples using proteinase K,RNase A, cold acetic acid and isopropanol. SNPswere analyzed followingPCR amplification of DNA fragment including SNPs. All PCR amplifica-tion used the T-gradient thermocycler (Biometra, Germany). Calculatedtemperature control, heated lid and rapid thermal ramping betweensteps were enabled in all PCR reactions. Twenty-eight SNPs in 12 folatepathway genes selected from previously published NTD research wereexamined by CEQ SNP-Primer Extension Kit (Beckman Coulter P/N390280, USA). The primer extension assay contains three major stepsbefore loading on the CEQ: template cleanup by Shrimp Alkaline Phos-phatase and Exonuclease I (Fermentas, USA), single base primer exten-sion, and extended product cleanup by SAP. Loading mixture includedsample loading solution 39.0 μl, Size Standard-80 0.5 μl and extensionreaction samples 0.5 μl. We have adopted multiplex SNP analyses, anddesigned SNP primers with Oligo 6. The PCR primers and SNP extensionprimers were synthesized by Shanghai Sangon (China). Primers, an-nealing temperature and grouping see Table 1. The SNP primer exten-sion thermal cycling conditions were 96 °C 10 s, annealing 5 s, 72 °C30 s and hold at 4 °C after 25 cycles. Cover each sample with one dropof light mineral oil and run the plate on the CEQ 8800 Genetic AnalysisSystem (USA) using the SNP-1 separation method. Data were analyzedusing the SNP analysis feature of the CEQ 8800 software.

2.3. Statistical analysis

Case–parental control study [19] was performed in the design andparents were taken as controls to evaluate SNP hereditary effect in thepresence of environmental risk factors, e.g. folic acid supplementation,GDM and medicine administration. Case–parental control study is ro-bust to potential population stratification and particularly useful whensampling over such a wide geographic area, and is usually used toanalyze interactions between genes and environmental risk factors.

We analyzed the interaction between folate metabolism pathwaygene SNPs and environmental risk factors. Transmission/disequilibriumtest (TDT) [20]was then utilized to test the interaction to eliminate spu-rious associations to look for NTD pathogenic genotype and environ-mental risk factors. According to the transmitted and the non-transmitted alleles M1 and M2 at some genetic locus, b refers to parenttransmitted allele M1 cases, and c refers to parent transmitted alleleM2 cases. TDT = (b − c)2 / (b + c). This hypothesis can be testedusing a binomial (asymptotically chi-square) test with one degree offreedom. All SNPs were checked for Hardy–Weinberg equilibrium [21]separately in unrelated affected individuals and unaffected relatives toanalyze the representativeness of sample population.

3. Results

We had enrolled 602 families in our data set, and each family has atleast one NTD individual. 609 aborted fetus tissues or blood sampleswere collected from affected individuals, and 1106 parental blood sam-ples were collected as controls. A total of 1715 samples derived from516 complete trios, 60 families with only one of parents, 7 familieswith 2 affected individuals and 19 cases without parents. About 98.8%NTD mothers had accepted environmental exposure interviews. SeeTable 2.

3.1. Case–parental control study

We investigated SNP hereditary effects under different environmen-tal exposure stratifications. The results (Table 3) show that partial SNPsin FR2, SCF19M1, TCN2, MTHM, MTHFR, BHMT and CBS are significantlyassociated with NTDs (all x2 N 3.84, P b .05).

3.2. Transmission/disequilibrium test

We evaluated the significant association mentioned above withtransmission/disequilibrium tests on the basis of environmentalrisk factor stratifications (Table 4). The linkage disequilibriumbetween MTHFR 677CNT and NTDs was significant in all stratifica-tions (all x2 N 3.84, P b .05). Furthermore, synergistic effects of nofolate supplementation and GDM were shown on the occurrenceof NTDs (RR1 N RR0). Linkage disequilibrium also existed betweenMTHM 501ANG and NTDs in case of GDM (RR1 = 2.61, P b .05),and between BHMT 716GNA and NTDs in case of no folate supple-mentation (RR1 = 2.56, P b .05), whereas the two genotypes alonedid not contribute to the etiology of NTDs (both P N .05). Associationbetween other SNPs and NTDs did not exist (all P N .05).

All SNPs of cases and unaffected relatives were checked and showedconsistency with Hardy–Weinberg equilibrium (all P N .05).

4. Discussion

Wehave investigated the contributions of folate pathway gene SNPsto the etiology of NTDs in different environmental risk factor stratifica-tions. We found that MTHFR 677CNT genotype, especially in case of nofolate supplementation and GDM, promoted NTD occurrence, and thatMTHM 501ANG only in case of GDM, and BHMT 716GNA only in caseof no folate supplementation contributed to the etiology of NTDs,whereas the two genotypes alone did not contribute to the etiology ofNTDs. Other SNPs did not significantly associate with NTDs.

The association of hyperhomocysteinemia and NTD risk implicatesthe significance of enzymes such as MTHFR, BHMT, MTHM and CBSthat degrade homocysteine. MTHFR 677CNT was investigated in NTDswith conflicting results in different populations: the TT allele is a riskfor Dutch and Irish populations [22,23] but is not a major risk factorfor Caucasian American [12], whereas a protective effect is seen in Ital-ians [24] and other populations have no evidence of association [25,26]which is inconsistent with our observed relationship among BHMT,

Table 1The evaluated SNPs, PCR primers, SNP primers, Ta and Grouping.

Gene rs# Up/down PCR-primers (5′ → 3′) SNP-primers (5′ → 3′) Ta Grouping

FR1 rs2071010 GGCCAGAGAATCTTGAAGTGCTCCCCACCAACAATCAT

AAGACCAGAGTGTGGCCTGCTCAAG 64.0 8th

FR2 rs2298444 GGGGAAGTAGGACTCAAAGGTGCTTGGGGTTAGGAAAAAGGAGATT

(A)15GAGGTAGGGTTTGGAAAATC 57.0 1st

SCF19M1 rs1051266 GAGAAGCAGGTGCCCGTGGAATGCGCCATGAAGCCGTAGAAGC

(A)19TAGAAGCAAAGGTAGCACACGAGG 57.0 1st

TCN2 rs1801198 GCCATCAGAACAGTGCGAGAGCCAGCAAAGCAACCCTC

(A)28TGCTGTTCCCAGTTCTGCCCCA 59.7 3rd

MTHM rs10925235 AAGGGCCTCAGTTGCATAGGTGAAAAAGGCGGTCT

(T)12GCATAGGAGTTTTTTATTCAGGC 57.1 2nd

MTHM rs12060570 CCCAAATTAAGGTACTAGAGGCCAGTGTATGACAGACAGCGAGAA

(T)5CCGCCCATTGTCACCTCCAT 59.7 3rd

MTHM rs10925250 TACTTAGGTTTCCGGTTTGAGTCTTTGGTATTCCGTTAGAGC

(A)18GTGGAGAAAACAATAAAGTAATGCA 57.0 1st

MTHM rs1805087 GCCCACTGAGTTTACCTATGATCCAAAGCCTTTTAC

(T)25ACTTACCTTGAGAGACTCATAATGG 57.1 2nd

MTHM rs4659743 TCCCTTAGAGACCGACCTTTGGGGCACAGGACGCTGAG

(T)19GTTTTGCCTGTGGATTGATTCTAA 59.7 4th

MTHFD1 rs2236225 ACACTAACCTACAAACCCTTCTGTTCTTCCTTCCGATTCCA

(A)5TTCCTCCATCATTGCAGACC 59.7 3rd

SHMT1 rs1979277 AATGGCCCGAGTGTCAACCCCCTTTGGTGTGTAGTGTG

(A)10TCAGGCAGGCCAGGCAGAGGGAAGA 59.7 3rd

MTHFR rs1801133 GTGTGGGAGTTTGGAGCAATAAGAAAAGCTGCGTGATGAT

AAGAAGGAGAAGGTGTCTGCGGGAG 59.7 4th

MTHFR rs1801131 GCAACCTGAAGAGCAAGTCCCGTTTCTCCCAACTTACCCT

(A)11GGGGGGAGGAGCTGACCAGTGAAG 59.7 4th

MTRR rs1801394 CAAGCCCAAGTAGTTTCGAAATCCATGTACCACAGC

(A)19TCCATGTACCACAGCTTGCTCACA 59.7 4th

BHMT rs651852 TATGCACGGAAACAAGTTACATGGCAAAGGACTATGGA

(A)18TCATTTAGTACATTTAGGKACTGGC 57.0 1st

BHMT rs7700970 TCCTCTGGGCACATAGTGGAGTATTTGAAGAACACC

(A)10GACAGTTCTTCAAACACACCTCCCA 58.7 5th

BHMT rs3733890 GGCAACAGAGTGAGATTGTGGCTGGGTATAGATTTACTTGAGTT

CTGCCTCATCAGGTGAGCTTTCAGT 58.7 5th

BHMT rs558133 GCGGGGTCCTACATAACAGCAGGTAATGTCCAATGAGT

(A)25TTCCTCTAGCAATGTAATTCCTCTC 58.7 5th

CBS rs234783 TCGGGACTGTTTGGTTGCGCCAGGCTCCTAAGA

(A)19GGCTCCTAAGAGAAAACATGGTCT, 64.4 7th

CBS rs234715 CGACTGGCAAGACAGAGGTAACGCCGCCAAGAACATATCAGC

(A)10CAAAGTGACTCCCCAGCAGATGGAC 65.6 6th

CBS rs2851391 TGTGTGGTGGGGAGGACTCTTTGGAATGCCCGTTTTACAG

(A)3TCGTGACCAACCTGACCCTCGG 65.6 6th

CBS rs1789953 CGTGTGCGGACATCGTCGGGTCCATCCTCGCAGA

(A)23CAGAAGGGCAAGCCCCGCAC 64.0 8th

CBS rs4920037 TGATGACACACGGAATGCAATGCCACTGACTAGCCA

(A)8CCGAGTCCCCAGAGGTCTAGATCAACT 64.0 8th

CBS rs1801181 CCTGGCGCGTCTGACTCGTGAGGAGAGTGGAGGCGGTGCT

(A)30GTGGCGGTGGCCGTGAAGGC 64.4 7th

CBS rs9325622 GCACACAGCCATCGCTCAGCACCATCTCCCCACATACTTG

(T)25CACACACTCACACGCACAGGTACAC 59.7 9th

CBS rs12613 CCTGGCACCGTTATCCCTGCTAAATGCCGCTGATTG

(T)11CTCTTTTGCCTTTAATCCACTCTG 59.7 9th

CBS rs412810 TGCCCTCCCATCATCGTCACCAGAGGCAAGGAACTAGC

(T)18CAAGTATGTAAGGAGAAGGAGCGGG 59.7 9th

NOS3 rs1799983 GGGAGCCTCGGTGAGATAAATCCCACCCAGTCAATCCCT

(T)6GAAGGAAGAGTTCTGGGGG 59.7 9th

Abbreviation: SNP, single nucleotide polymorphism; PCR, polymerase chain reaction; Ta, annealing temperature.

Table 2Environmental exposure interview of mothers of NTDs.

Cases Folate supplementa GMDb Medicinec

Spina bifida occulta 163 64 5 15Anencephaly 157 50 4 7Craniorachischisis 104 19 2 4Spina bifida cystica 95 41 5 4Encephalomeningocele 62 23 1 10Other phenotypesd 28 12 2 5All 609 209 19 45

a Pre- and postconceptional folate supplementation.b GDM, gestational diabetes mellitus.c Pre- and postconceptional medicine administration includes antiepileptic, anti-

psychotics, or other drugs without certain safety certification.d Include isolated cases such as hydranencephaly, iniencephaly, schizencephaly

and tethered cord.

63J. Liu et al. / Journal of the Neurological Sciences 337 (2014) 61–66

MTHFR, folate supplementation and NTDs risk. It possibly resulted frompopulation or environmental stratification bias, such as difference indiet habit or folate supplementation, or NTD phenotype diversity be-tween two studies. Boyles' study enrolled only myelomeningocele andanencephaly cases [12], while encephaloceles, encephalomeningocele,closed spina bifida and other phenotypes with symptoms and/or signswere also enrolled in our study. MTHFR 677CNT is not the only geneticNTD risk factor. Some NTD cases are not preventable by folic acid, andatmost 25% of cases can be solely explained by 677CNT [27,28]. ExcludingTT genotype people, there is still a decrease in folate and increase inhomocysteine levels in patients and their parents [29].

Table 3Contribution of SNPs and environmental risk factors to the etiology of NTDs.

Genes & SNP rs# Yes folatea No folate No GDM Yes GDM No medicine Yes medicineb

OR0 x2 OR1 x2 OR0 x2 OR1 x2 OR0 x2 OR1 x2

FR1rs2071010 1.53 2.10 2.34 3.19 3.08 2.51 2.53 0.98 1.90 3.24 0.14 2.16

FR2rs2298444 2.35 1.32 3.21 2.62 3.13 0.01 0.18 2.87 2.11 2.57 1.89 0.19

SCF19M1rs1051266 2.97 5.63c 2.10 2.19 1.11 0.72 2.38 5.03c 3.02 0.29 3.06 2.09

TCN2rs1801198 1.58 3.87c 2.33 4.61c 0.04 3.61 1.68 1.57 3.22 2.50 4.24 5.19c

MTHMrs12060570 2.26 1.56 2.60 2.04 0.12 2.68 3.00 1.03 1.93 1.46 1.35 3.13rs10925250 1.53 2.37 2.53 6.10c 0.44 2.19 1.35 2.93 2.01 4.69c 1.44 1.48rs1805087 1.24 2.48 0.80 3.08 1.92 1.63 2.30 1.29 1.55 2.15 2.20 1.22

MTHFD1rs2236225 1.05 2.21 3.24 1.88 2.31 1.57 3.10 1.31 1.24 1.81 0.01 1.30

SHMT1rs1979277 2.93 2.88 1.15 3.12 1.11 2.90 1.01 1.62 2.24 3.00 2.56 3.60

MTHFRrs1801133 3.33 5.10c 2.23 4.02c 2.45 7.06 c 1.69 4.07c 1.81 5.33c 2.06 5.01c

rs1801131 1.56 1.47 2.78 1.95 1.35 1.78 2.08 3.01 2.10 2.48 1.01 0.93

MTHMRrs1801394 1.55 2.35 1.99 2.54 1.42 1.06 0.21 0.01 1.90 2.23 1.88 1.82

BHMTrs651852 1.35 2.24 1.84 1.53 1.82 2.55 1.22 2.03 1.01 0.07 2.68 3.22rs7700970 1.99 1.37 1.29 0.49 1.04 2.33 3.04 3.05 1.52 0.51 3.16 2.03rs3733890 1.32 3.29 1.94 8.01c 1.34 3.16 0.88 0.06 2.84 5.03c 1.91 3.20rs558133 1.77 1.64 1.41 2.63 1.29 3.19 1.22 2.33 1.22 2.66 1.83 1.65

CBSrs234715 2.22 1.64 1.53 4.32c 1.56 3.10 3.11 2.75 1.40 2.16 1.41 3.44rs2851391 1.09 2.00 1.21 2.80 0.06 2.01 1.34 1.34 3.22 1.99 1.28 2.55rs4920037 2.20 4.45c 1.47 2.23 3.23 3.41 1.22 1.55 2.43 0.30 1.33 2.91rs12613 1.45 1.77 1.19 1.66 2.39 1.37 1.11 2.06 1.16 2.47 1.70 2.35rs412810 0.97 1.31 4.39 2.26 1.93 3.34 3.20 1.14 0.24 3.29 0.21 2.45

NOS3rrs1799983 1.35 1.24 2.35 1.37 2.63 1.45 2.65 3.82 2.74 3.10 1.56 2.20

Abbreviations: SNP, single nucleotide polymorphism; GDM, gestational diabetes mellitus; OR0 and OR1 refer to odds ratio without or with environmental exposure respectively.a Pre- and postconceptional folate supplementation.b Pre- and postconceptional medicine administration includes antiepileptic, antipsychotics, or other drugs without certain safety certification.c x2 N 3.84, P b .05.

64 J. Liu et al. / Journal of the Neurological Sciences 337 (2014) 61–66

Homocysteine level is alsomaintained by themethyl cycle and playsa role in NTD risk. Large-dose oral betaine therapy, a BHMT cofactor,treats hyperhomocysteinemia by shunting homocysteine through abetaine-dependent remethylation pathway [30]. When folate depen-dent methionine synthesis is impaired, by either genetic or environ-mental factors, BHMT plays a critical role in homocysteine homeostasis

Table 4Results of transmission/disequilibrium tests.

Genes & SNP rs# Yes folatea No folate No GDM

RR0 x2 RR1 x2 RR0

MTHFRrs1801133 2.20 6.72c 3.15 4.23c 2.42

MTHMrs10925250 3.14 1.43 2.85 3.10 2.04

BHMTrs3733890 1.64 2.20 2.56 4.54c 2.24

Abbreviations: SNPs, single nucleotide polymorphisms; GDM, gestational diabetes mellitus; RRa Pre- and postconceptional folate supplementation.b Pre- and postconceptional medicine administration includes antiepileptic, antipsychotics,c x2 N 3.84, P b .05.

[31]. We presume that both folate cycle and methionine cycle areimportant to homocysteine levels, and that hyperhomocysteinemiacaused by BHMT SNPs can be rectified by folate supplementationthrough folate cycle, therefore avoiding NTD occurrence.

NTD is a polygenetic inheritance disease, numerous environmen-tal and genetic influences contribute to the etiology of NTDs, and

Yes GDM No medicine Yes medicineb

x2 RR1 x2 RR0 x2 RR1 x2

3.90c 3.31 4.22c 1.69 3.96c 1.71 6.05c

1.54 2.61 5.01c 2.43 2.12 1.02 2.31

1.78 1.32 2.91 1.00 1.98 2.07 3.45

0 and RR1 refer to risk ratio without or with environmental exposure respectively.

or other drugs without certain safety certification.

65J. Liu et al. / Journal of the Neurological Sciences 337 (2014) 61–66

accumulating evidence from population-based studies has demonstrat-ed that folate status is a significant determinant of NTD risk. Investigationfound the extremely high prevalence of NTDs (13.87/1000 births), andonly 4.2% of women got periconceptional folate supplementation infour counties in Shanxi province, China [2]. Currently many countriesfortify their food supply with folic acid for the prevention of NTDs.Folate supplements should be given to all women of childbearingage and during the first trimester of pregnancy. Unfortunately,some women of childbearing age obtain insufficient folate evenwhen intake from both food and dietary supplements is included [32].Women of childbearing age should obtain 0.4 mg/day of folic acidfrom dietary supplements and/or fortified foods in addition to thefolate present in a varied diet [33]. During pregnancy, demands forfolate increase due to its role in nucleic acid synthesis [34]. To accommo-date this need, the Food and Nutrition Board (US) increased therecommended dietary allowance of folate from 0.4 mg/day fornonpregnant women to 0.6 mg/day during pregnancy [33]. Thislevel of intake may be difficult for many women to achieve throughdiet alone. Experts recommend that women obtain 4 to 5 mgsupplemental folic acid daily starting at least 1 to 3 months prior to con-ception and continuing for 2.5 to 3 months after conception for womenwho had a previous NTD and are planning to become pregnant again[35,36].

Despite the indubitable impact of folate supplementation and GDMon NTD risk, the mechanism remains unknown. The effects of interac-tion between SNPs, folate supplementation and GDM on NTD occur-rence imply possible mechanism and research direction. Identificationof the mechanism by which environmental risk factors affect neuraltube closure may shed light on developing more efficacious preventa-tive measures.

AbbreviationsNTD neural tube defectSNP single nucleotide polymorphismGDM gestational diabetes mellitusFR1 folate receptor 1FR2 folate receptor 2SCF19M1 solute carrier family 19 member 1TCN2 transcobalamin IIMTHM 5-methyltetrahydrofolate–homocysteine methyltransferaseMTHFD1 methylenetetrahydrofolate dehydrogenase 1SHMT1 serine hydroxymethyltranferase 1MTHFR 5,10-methylenetetrahydrofolate reductaseMTHMR 5-methyltetrahydrofolate–homocysteine methyltransferase

reductaseBHMT betaine–homocysteine methyltransferaseCBS cystathionine-beta-synthaseNOS3 nitric oxide synthase 3

Conflict of Interest

There is no any commercial in the study design or manuscriptpreparation or other conflicts of interest by any of the authors.

Acknowledgments

We are grateful to those patients and their families affected by NTDsfor their consent to participate in this study. We also thank those clini-cians, imaging diagnosticians and other experts for their kind support.This work was supported by the Twelfth Five-Year National Key Tech-nology R&D Program (2012BAI09B04), the Professional Fund of Minis-try of Health (China) (2010002006), and the Key Construction Projectof Clinical Specialty of Ministry of Health (China).

References

[1] Detrait ER, George TM, Etchevers HC, Gilbert JR, Vekemans M, Speer MC.Human neural tube defects: developmental biology, epidemiology, and genetics.Neurotoxicol Teratol 2005;27(3):515–24 [PubMed: 15939212].

[2] Li Z, Ren A, Zhang L, Ye R, Li S, Zheng J, et al. Extremely high prevalence of neuraltube defects in a 4-county area in Shanxi Province, China. Birth Defects Res A ClinMol Teratol 2006;76(4):237–40 [PubMed: 16575897].

[3] Ross ME. Gene–environment interactions, folate metabolism and the embryonicnervous system. Wiley Interdiscip Rev Syst Biol Med 2010;2(4):47180 [PubMed:20836042].

[4] Elwood JM, Little J, Elwood JH. Epidemiology and control of neural tube defects.Oxford, UK: Oxford University Press; 1992.

[5] Becerra JE, Khoury MJ, Cordero JF, Erickson JD. Diabetes mellitus during pregnancyand the risks for specific birth defects: a population-based case–control study.Pediatrics 1990;85(1):1–9 [PubMed: 2404255].

[6] Welch AD. Folic acid: discovery and the exciting first decade. Perspect Biol Med1983;27(1):64–75 [PubMed: 6359053].

[7] Kaneko S. Antiepileptic drug therapy and reproductive consequences: functionaland morphologic effects. Reprod Toxicol 1991;5(3):179–98 [PubMed:1807552].

[8] MRC Vitamin Study Research Group. Prevention of neural tube defects: resultsof the Medical Research Council Vitamin Study. Lancet 1991;338(8760):131–7[PubMed:1677062].

[9] Rosenquist TH, Finnell RH. Genes, folate and homocysteine in embryonic develop-ment. Proc Nutr Soc 2001;60(1):53–61 [PubMed:11310424].

[10] Takimoto H, Mito N, Umegaki K, Ishiwaki A, Kusama K, Abe S, et al. Relationshipbetween dietary folate intakes, maternal plasma total homocysteine and B-vitaminsduring pregnancy and fetal growth in Japan. Eur J Nutr 2007;46(5):300–6[PubMed:17623226].

[11] Mills JL, McPartlin JM, Kirke PN, Lee YJ, Conley MR, Weir DG, et al. Homocysteinemetabolism in pregnancies complicated by neural-tube defects. Lancet1995;345(8943):149–51 [PubMed: 7741859].

[12] Boyles AL, Billups AV, Deak KL, Siegel DG, Mehltretter L, Slifer SH, et al. Neural tubedefects and folate pathway genes: family-based association tests of gene–gene andgene–environment interactions. Environ Health Perspect 2006;114(10):1547–52[PubMed: 17035141].

[13] Yan L, Zhao L, Long Y, Zou P, Ji G, Gu A, et al. Association of the maternal MTHFRC677T polymorphism with susceptibility to neural tube defects in offsprings:evidence from 25 case–control studies. PLoS One 2012;7(10):e41689 [PubMed:23056169].

[14] Liu ZZ, Zhang JT, Liu D, Hao YH, Chang BM, Xie J, et al. Interaction between maternal5,10-methylenetetrahydrofolate reductase C677T and methionine synthase A2756Ggene variants to increase the risk of fetal neural tube defects in a Shanxi Han popu-lation. Chin Med J (Engl) 2013;126(5):865–9 [PubMed: 23489792].

[15] Trembath D, Sherbondy AL, Vandyke DC, Shaw GM, Todoroff K, Lammer EJ, et al.Analysis of select folate pathway genes, PAX3, and human T in a midwestern neuraltube defect population. Teratology 1999;59(5):331–41 [PubMed: 10332959].

[16] Morin I, Platt R, Weisberg I, Sabbaghian N, Wu Q, Garrow TA, et al. Common variantin betaine–homocysteine methyltransferase (BHMT) and risk for spina bifida.Am J Med Genet 2003;119A(2):172–6 [PubMed: 12749058].

[17] Morrison K, Papapetrou C, Hol FA, Mariman EC, Lynch SA, Burn J, et al. Susceptibilityto spina bifida; an association study of five candidate genes. Ann Hum Genet1998;62(pt 5):379–96 [PubMed: 10088035].

[18] Brown KS, Cook M, Hoess K, Whitehead AS, Mitchell LE. Evidence that the risk ofspina bifida is influenced by genetic variation at the NOS3 locus. Birth Defects ResA Clin Mol Teratol 2004;70(3):101–6 [PubMed: 15039923].

[19] Sun F, Flanders WD, Yang Q, Khoury MJ. A new method for estimating the risk ratioin studies using case–parental control design. Am J Epidemiol 1998;148(9):902–9[PubMed: 9801021].

[20] van Den Oord EJ, Vermunt JK. Testing for linkage disequilibrium, maternal effects,and imprinting with (in) complete case–parent triads, by use of the computer pro-gram LEM. Am J Hum Genet 2000;66(1):335–8 [PubMed: 10631165].

[21] Weir BS. Genetic data analysis II: methods for discrete population genetic data.Sunderland, MA: Sinaur Associates; 1996.

[22] Shields DC, Kirke PN, Mills JL, Ramsbottom D, Molloy AM, Burke H, et al. The“thermolabile” variant of methylenetetrahydrofolate reductase and neural tube de-fects: an evaluation of the genetic risk and the relative importance of the genotypesof the embryo and the mother. Am J Hum Genet 1999;64(4):1045–55 [PubMed:10090889].

[23] van der Put NM, Steegers-Theunissen RP, Frosst P, Trijbels FJ, Eskes TK, van denHeuvel LP, et al. Mutated methylenetetrahydrofolate reductase as a risk factor forspina bifida. Lancet 1995;346(8982):1070–1 [PubMed: 7564788].

[24] De Marco P, Calevo MG, Moroni A, Arata L, Merello E, Finnell RH, et al. Study ofMTHFR and MS polymorphisms as risk factors for NTD in the Italian population.J Hum Genet 2002;47(6):319–24 [PubMed: 12111380].

[25] González-Herrera L, García-Escalante G, Castillo-Zapata I, Canto-Herrera J,Ceballos-Quintal J, Pinto-Escalante D, et al. Frequency of the thermolabile variantC677T in the MTHFR gene and lack of association with neural tube defects in theState of Yucatan, Mexico. Clin Genet 2002;62(5):394–8 [PubMed: 12431255].

[26] Revilla JIG, Hernandez FN, Martin MTC, Salvador MT, Romero JG. C677T and A1298CMTHFR polymorphisms in the etiology of neural tube defects in Spanish population.Med Clin (Barc) 2003;120(12):441–5 [PubMed: 12689549].

[27] Posey DL, Khoury MJ, Mulinare J, Adams JrMJ, Ou CY. Is mutatedMTHFR a risk factorfor neural tube defects? Lancet 1996;347(9002):686–7 [PubMed: 8596396].

[28] van der Put NM, van den Heuvel LP, Steegers-Theunissen RP, Trijbels FJ, Eskes TK,Mariman EC, et al. Decreased methylene tetrahydrofolate reductase activity due to

66 J. Liu et al. / Journal of the Neurological Sciences 337 (2014) 61–66

the 677C → T mutation in families with spina bifida offspring. J Mol Med (Berl)1996;74(11):691–4 [PubMed: 8956155].

[29] van der Put NM, Thomas CM, Eskes TK, Trijbels FJ, Steegers-Theunissen RP, MarimanEC, et al. Altered folate and vitamin B12 metabolism in families with spina bifida off-spring. QJM 1997;90(8):505–10 [PubMed: 9327028].

[30] Kang SS. Treatment of hyperhomocyst(e)inemia: physiological basis. J Nutr1996;126(4 Suppl.):1273S–5S [PubMed: 8642469].

[31] Weisberg IS, Park E, Ballman KV, Berger P, Nunn M, Suh DS, et al. Investigationsof a common genetic methyltransferase (BHMT) variant in betaine–homocysteinein coronary artery disease. Atherosclerosis 2003;167(2):205–14 [PubMed:12818402].

[32] Bailey RL, Dodd KW, Gahche JJ, Dwyer JT, McDowell MA, Yetley EA, et al. Total folateand folic acid intake from foods and dietary supplements in the United States: 2003–2006. Am J Clin 2010;91(1):231–7 [PubMed: 19923379].

[33] Institute of Medicine (US), Food and Nutrition Board. Dietary reference intakes forthiamin, riboflavin, niacin, vitamin B6, folate, vitamin B12, pantothenic acid, biotin,and choline. Washington, DC: National Academy Press; 1998 [PubMed: 23193625].

[34] Scholl TO, JohnsonWG. Folic acid: influence on the outcome of pregnancy. Am J ClinNutr 2000;71(5 Suppl.):1295S–303S [PubMed: 10799405].

[35] Wilson RD, Johnson JA, Wyatt P, Allen V, Gagnon A, Langlois S, et al. GeneticsCommittee of the Society of Obstetricians and Gynaecologists of Canada and TheMotherrisk Program. Pre-conceptional vitamin/folic acid supplementation 2007:the use of folic acid in combination with a multivitamin supplement for the preven-tion of neural tube defects and other congenital anomalies. J Obstet Gynaecol Can2007;29(12):1003–26.

[36] Centers for Disease Control. Use of folic acid for prevention of spina bifida and otherneural tube defects — 1983–1991. MMWR Morb Mortal Wkly Rep 1991;40(3):513–6[PubMed: 2072886].