Introduction Dyes - Central Leather Research Institute · 2010-01-30 · Classification of Dyes Introduction. 30-Jan-10 NFMC, Bharathidasan University 5 Based on US International

National Facility for Marine Cyanobacteria(Sponsored by Dept. of Biotechnology, Govt. of India)

Department of Marine BiotechnologyBharathidasan University

Tiruchirappalli, Tamil Nadu -24

IntroductionIntroduction

Dyes can be said to be coloured, ionising and aromatic organic compounds which shows an affinity towards the substrate to which it is being applied

Building blocks of these dyes – chromophore.

Chromophores - a group of atoms and electrons forming part of an organic molecule that causes it to be coloured.

30-Jan-10 NFMC, Bharathidasan University 2

DyesDyes

1st Basic Dye Mauveine, after the French name of non-fast colour which was made of natural dyes.

ColourColour IndexIndex

Colour Index is basically a compendium of dyes.



CI Acid Black 1

CI Acid Black 1 (20470)Blue black

Organic/Inorganic

Natural/Synthetic

By area and method of application

Chemical classification - Based on the nature of their respective chromophores.

By nature of the Electronic Excitation (i.e, energy transfer colorants, absorption colorants and fluorescent colorants). According to the dyeing methods

Anionic (for Protein fibre)Direct (Cellulose)Disperse (Polyamide fibres)


IntroductionIntroductionClassification of DyesClassification of Dyes


Based on US International Trade CommissionBased on US International Trade Commission

According to CPCB According to World BankAcid dye Wool, silk, nylon Animal fibreAzo dye Cotton CottonBasic dye Acrylic PaperDirect dyes Cotton, leather, paper &

syntheticCotton-wool, cotton-silk

Disperse dyes PolyesterFood dyes Food, cosmeticsMetal complexes

Cotton

Mordant dyes WoolWhitening agent Plastics, paper soapPigment dyes Paints & plastics Paints & inksReactive dyes Wool & cottonSolvent dyes SyntheticSulphur dyes Cotton & syntheticVat dyes Cotton & synthetic

Types of dyesApplication

Source: Anon. 2002. Effluent toxicity status in water polluting industries. Part I – Dye & dye intermediates, bulk drugs & textile industries. Central pollution Control Board, Ministry of Environment & Forests, Govt. of India. Pg 7.

Pollution prevention and abatement handbook, World Bank, Pg 298.

Azo refers to a chemical compound that contains double nitrogen atoms with a double bond between them (-N=N-). Most azo dyes contain only one azo group, but some contain two (disazo), three (trisazo) or moreWith more than 2000 organic compounds, azo dyes forms the largest group of dyes. Azo compound class accounts for 60-70% of all dyesThey display light-fastness, stability, strongness and respond well to mixing.Azo dyes may be found among the dye classes of direct, acid, basic, reactive and disperse.



AzoAzo DyesDyes

Acid Orange 10 (Orange G, 16230)

Acid black 1 (Amidoblack 10B , 20470)

Indian fabrics in demand - ethnic, earthly colored and many textures –22% of global market.Textile sector - ~14% of the total industrial output and targeted to reach $50 billion by 2010.India’s GDP – increased from 2.94 to 7.85 USD (2004 – 07)For This Huge Economy, What We For This Huge Economy, What We Recompense IsRecompense Is Our Environment Our Environment mainly due to discharge of coloured effluents.

Fibre Dye Type Unfixed dye %

Wool and

Nylon

Acid / Reactive

Pre-metallized

7 – 20

2 – 7

Cotton and

viscoce

Azo

Reactive

Pigment

Vat

Sulphur

Disperse

5 – 10

20 – 50

5 – 20

1

5 – 20

30 - 40

Polyester Disperse 8 – 20

Acrylic Modified Basic 2 – 3Percentage of unfixed dye for various dye types and applications

www.dyespigments.com


Instigating FactorsInstigating Factors……....Environmentalists - concerned with non-availability of treatment methods for coloured effluentsApparel based dye units have been closed - uncertainty in the export market especially in the State of Tamil Nadu - a set back in economy of the country. Annual production of dyes - ~10,000 different dyes - ~ 7 X 105 metric tones world wide available (McMullen et al., 2001) .

N F M C

- a natural habitat

Oxygen evolving, Gram negative, Photosynthetic ProkaryoteIndependence for Independence for

carbon & Nitrogencarbon & Nitrogen

N F M C

a) to survey the entire coast line of India and establish a germplasm collection of marine cyanobacteria;

b) to carry out basic and applied research resulting in both me understanding of basic biology as well as exploitation of these organisms by way of technologies towards human welfare;

c) through National and International level training workshops, conferences etc., develop trained human resource and

d) to provide instrumental and other facilities to needy researchers

Objectives

Cyanobacterial BiotechnologyCyanobacterial BiotechnologyCyanobacterial Biotechnology

Food

Feed

Fertilizer

Food

Feed

Fertilizer

Fuel Fine Chemicals

Pharmaceuticals

Fuel Fine Chemicals

Pharmaceuticals

Waste TreatmentWaste Treatment



AbatementAbatement methodsmethodsConventional physico-chemical treatments have disadvantages of being highly expensive, coupled with the formation of large amount of sludge and the emission of toxic substances (Johnson et al., 1978). The best approach is to opt for the biological decolourization. Aerobic treatment is the safe method for biodegradation of textile azodyes as anaerobic degradation leads to formation of aromatic aminesthat are carcinogenic and mutagenic (Levine, 1991). Previous work in NFMC on treatment of molasses based distillery effluent from cyanobacteria has proved that reactive oxygen species ROS (hydrogen peroxide, H2O2) plays significant role (Kalavathi, 2000).Some of the commercially available cleaning solutions also contain ROS.

Could Active Oxygen Species be extended for treatment of textile dyes?

30-Jan-10NFMC, Bharathidasan University

15

IntroductionIntroductionActive Oxygen SpeciesActive Oxygen Species

Definition: any atom molecule that possesses an unpaired electron viz., singlet Oxygen, Superoxide, Hydroxyl, Perhydroxyl, Hydrogen peroxide, hydroperoxide and alkyl radicals.Characteristics: unstable, highly reactive, can combine with other molecules and oxidize them directly.


IntroductionIntroductionROS - The Paradox of Aerobiosis

Oxygenic Photosynthetic Electron Transport (PET) and aerobic respiration by cyanobacteriaChallenge - develop antioxidant defenses in order to survive from ROS. Opportunity - exploit the ROS

Turning point in

evolution


ObjectivesObjectives

Could ROS be exploited for azo dye decolourization?To identify the key enzymes in ROS production.

Our approaches…

Screening and selection for a problematic stable dye Screening and selection potent, fast growing marine cyanobacterium.Enzymatic studies related to dye decolourizationRole of ROS in dye decolourizationVector construction for engineering marine cyanobacteriaOther biotechnological potentials of the selected marine cyanobacterium.


CI Acid Violet 19 (42685)

Effect of pH (3.0 Effect of pH (3.0 –– 10.0) and light on tested textile dyes after 24 hrs 10.0) and light on tested textile dyes after 24 hrs

LightC T

LightC T Light

C TLight

C T

LightC T

CI Basic Green 4 (42000) CI BasicViolet 14 (42510)

CI Basic Violet 3 (42555) CI Acid Green 5 (42095)

LightC T

CI Basic Red 2 (50240)

Effect of pH (3.0 Effect of pH (3.0 –– 10.0) and light on tested textile dyes after 24 hrs 10.0) and light on tested textile dyes after 24 hrs

Azure A

LightC T Light

C T

CI Acid Red 87 (45380)

LightC T

CI Acid Red 94 (45400)

LightC T

CI Direct blue 14 (23850)

LightC T

CI Acid yellow 23 (19140)

LightC T

CI Acid Orange 10 (16230)

CI Acid Black 1 (20470)

CI No: 20470λ Max = 618 nm

Selected DyesSelected DyesLight

C T

CI CI PonceauPonceau S (27195)S (27195)

CI No: 27195λ Max = 520 nm

LightC T

Organisms screenedOrganisms screenedUnicellular and filamentous non-heterocystous marine forms, was obtained from the germplasm of National Facility for Marine Cyanobacteria, Bharathidasan University, Tiruchirappalli.

Synechococcus elongatus BDU 30312Synechocystis paveleki BDU 35101Phormidium valderianum BDU 20041Phormidium valderianum BDU 140441Oscillatoria boryana BDU 141071Oscillatoria boryana BDU 92181Oscillatoria willei BDU 13051Oscillatoria chlorina BDU 140691Oscillatoria curviceps BDU 92191Spirulina subsalsa BDU 141201

O. chlorina BDU 140641, 25.616 O. willei BDU 130511,

19.277

O. boryana BDU 92181, 37.175

O. boryana BDU 141071 , 32.3

P. valderianum BDU 140441 , 50.569

P. valderianum BDU 20041, 49.299

O. curviceps BDU 92191, 99.53

S. subsalsa BDU 41201, 44.733

S. paveleki BDU 35105, 11.543S. elongatus BDU 30312,

26.457

Rate of Rate of decolouriationdecolouriation in ASN III medium containing in ASN III medium containing PonceauPonceau S (100mg LS (100mg L--11) in 12 days) in 12 days

Biodegradation of studies on Biodegradation of studies on MetanilicMetanilic acid acid

Synonyms : 3-Aminobenzenesulfonic acid, Aniline Meta Sulphonic Acid. Metanilic acid is an isomer of sulfanilic acid with the sulfonic acid group at position 2.Hence, 162μM concentration of Metanilic acid degradation studies was carried out in O.curviceps BDU 92191 to further confirm the biodecolourization potential of the marine cyanobacterium.

Biodegradation of Biodegradation of MetanilicMetanilic acid (162acid (162μμM) by M) by O. O. curvicepscurviceps BDU 92191 BDU 92191 in N amended ASN III mediumin N amended ASN III medium

0

1

2

3

4

5

6

200 300 400 500 600

Wavelength

Abs

MA C ontrol Day 2O.curv iceps + MA Day 2MA C ontrol Day 7O.curv iceps + MA Day 7

a - ASNIII N amended Medium b – ASNIII N amended Medium +

Metanilic acid (MA, 162μM)c – O.curviceps BDU 92191 in ASN III N

amended mediumd - O.curviceps BDU 92191 in ASN III N

amended medium + Metanilic acid (MA, 162μM)

Rate of Degradation in 2 days = Nil

Content of aromatic amines determined by Content of aromatic amines determined by spectrophotometricspectrophotometricmethod method inin--mileumileu on treatment of on treatment of O. O. curvicepscurviceps BDU 92191 in N BDU 92191 in N -- free free

with Acid Black 1 (100 mg mlwith Acid Black 1 (100 mg ml--11) )

0

100

200

300

400

500

600

700

800

900

1000

Arom

atic

am

ines

(μ

g)

Dye control O.curviceps BDU 92191 treated with dye

Organism Selected : Oscillatoria curviceps BDU92191Dye : Acid black 1Dye Concentration : 100mg L-1

Duration : 48 hrs (~50% Decolourization)

0

1

2

3

4

5

200 300 400 500 600 700

Wavelength (nm)OD

Dye control

O curv iceps 92191

Based on the results

0

5

10

15

20

25

30

35

O.curv iceps BDU92191 O.curv iceps BDU92191 + Acid Black 1

Chlorophy ll Protein

Estimation ofEstimation of biomass biomass in in O. O. curvicepscurvicepsBDU 92191 treated with Acid Black 1 BDU 92191 treated with Acid Black 1 (100mg L(100mg L--11) in N free ASNIII medium ) in N free ASNIII medium

after 2 daysafter 2 daysRef: Mac Kinney, 1941; Lowery et al., 1951

Spectral analysisSpectral analysis of of O. O. curvicepscurviceps BDU 92191 BDU 92191 treated with Acid Black 1 (100mg Ltreated with Acid Black 1 (100mg L--11) in N ) in N

free ASNIII medium after 12 days free ASNIII medium after 12 days


Pathway of antioxidant enzyme systems

Rao et al., 1996

SOD activity stainingSOD activity staining

Untreated

Total SOD

2mM H2O2 5mM KCN

< 0.143< 0.172

< 0.343

< 0.528

< 0.143< 0.172

< 0.343

< 0.143< 0.172

< 0.343

Fe SOD CuZn SOD

Rm 0.143, 0.172, 0.343 – MnSOD, Rm 0.343 – FeSOD, No CuZnSOD

Laccase (E.C.1.10.3.2) Polyphenol oxidase(PPO, E.C.1.10.3.1)

Findings from enzymatic studiesFindings from enzymatic studies……....

Significant change in pigment composition of O.curviceps BDU 92191 treated and untreated with dye was observed.

Switch on of antioxidant enzymes of Asada-Halliwell pathway(SOD, Catalase, Peroxidase, MDHAR and DHAR) on dye treated O.curviceps BDU 92191.

Similar effect was seen with detoxifying enzymes (GR and GST).

Degradative enzymes studies showed that there was an increase in AR and induction in laccase but not in PPO.

ContinousContinous Flow Flow PhotobioreactorPhotobioreactor for for biodecolourizationbiodecolourization

Volume : 1L

Immobilized O.curviceps BDU 92191

O.curviceps BDU 92191 with Acid Black 1 in N free

ASN III medium

Acid Black 1 in ASNIII N free medium

Cyanobacteria untreated and treated photobioreactorafter 4 days

T CT C

DecolourizationDecolourization of of O. O. curvicepscurviceps BDU 92191 in N BDU 92191 in N -- free ASN III medium free ASN III medium (100mg L(100mg L--11) in ) in photobiorectorphotobiorector

Flow rate : 0.7 ml/minRetention time : less than 24 hrConditions : Aerated, 1500 lux, 25±2°CC

0

10

20

30

40

50

60

70

80

90

100

0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48

Duration in Hrs

Perc

enta

ge o

f Dec

olou

roza

tion

0

10

20

30

40

50

60

70

80

90

0 12 24 36 48 60 72 84 96 108

Duration in hours

% D

ecol

ouriz

atio

n

Flow rate : 0.7 ml/minRetention time : 24 hrConditions : ASN III medium supplemented with 20 mg L-1

Sodium bicarbonate, 1500 lux, 25±2°CC

DecolourizationDecolourization of of O. O. curvicepscurviceps BDU 92191 in N BDU 92191 in N -- free ASN III free ASN III containing Acid Black1 (100mg Lcontaining Acid Black1 (100mg L--11) medium with sodium ) medium with sodium biocarbonatebiocarbonate

(20mg L(20mg L--11) in ) in photobiorectorphotobiorector


IntroductionIntroductionSuperoxide dismutase

SOD (E.C.1.15.1.1) -metalloenzymes that catalyze the dismutations of superoxide anion to H2O2.

First antioxidant arsenal against nascent oxygen species Central enzyme in the Asada-Halliwell pathway


IntroductionIntroductionActive site metal

Subunits MW (Da) Location

ProkaryotesMnSOD Mn 2 40000 CytosolFeSOD Fe 2 40000 CytosolCuZnSOD CuZn 2 or 4 180000 PeriplasmNiSOD Ni 6 33000 CytosolCambialistic SOD Fe/Mn 2 40000 Cytosol

EukaryotesMnSOD Mn N Mitochondria

FeSOD Fe NMitochondria, Chloroplast

CuZnSOD CuZn 2 or 4 32000 Cytosol, nucleusECSOD CuZn N ExtracellularECMnSOD Mn 2 150000 Extracellular

• Construction of primer for FeSOD gene from available cyanobacterial sequences.

Forward primers

1. CACCCTTGCCCTACG

2. CACCCTTGCCTTACG

3. CACCCTTGCCCTATG

4. CACCCTTGCCTTATG

5. CACCATTGCCCTACG

6. CACCATTGCCTTACG

7. CACCATTGCCCTATG

8. CACCATTGCCTTATG

Reverse primers

1. GAGGTAGTAAGCGTGTTCCCA

2. GAGGTAGTAAGCATGTTCCCA

Organism screened

P. valderianum BDU 20041

O.curviceps BDU 92191

Isolation of SOD gene from Marine Isolation of SOD gene from Marine CyanobacteriaCyanobacteria

PCR reaction Mixture: HotMastermix (Eppendorf, Germany) containing 1U Hot Mater Taq DNA polymerase, 0.10 µM of each primer, and 50 ng of template DNA in a 25.0 µl reaction mixture using a Master gradient thermal cycler (Eppendorf, Germany). Cycling profile: Initial denaturation at 94°C for 3 minutes followed by 29 cycles of 94°C for 1 min, 53°C for 1 min (gradient, G=10°C), 72°C for 1 min, and a final extension at 72°C for 7 minutes.

PCR product of 550 bp was sequenced.

Sequence analysis showed 75% similarity with MnSOD.

Submitted in Genbank, NCBI (AY974247)Agarose gel electrophorogram (1.5%) showing an amplified product of 550 bp. Lane1- 1Kb marker, lane 2-Negative control, lane 3- amplified PCR product (B)

1/30/2010 NFMC, Trichy 49

Gloeobacter violaceus PCC 7421

NP_927273 203 SOD

NP_923628 316 SOD

NP_924927 233 similar to SOD

NP_925116 191 similar to SOD

Anabaena variabilis ATCC 29413 YP_321482 200 Mn/Fe

YP_321963 270 Mn/Fe

Cyanothece sp. CCY0110 ZP_01728505 200 SOD

Thermosyncehococcus elongatus BP-1 NP_682309 200 SOD

NP_680827 240 SOD

Lyngbya sp. PCC8106ZP_0169885 201 SOD

ZP_01619231 201 SOD

YP_723986 254 SOD

Organisms Accession no

Sequence length

Type of SOD in Database


Homodimers exhibit similar active site

Common topology with all α N-terminal (Pfam:PF00081) and α/β C terminal domains (Pfam:PF02777)

His 171

His 26

His 81

Asp 147

HO+

Mn2+

His 171

His 26

His 81

Asp 147

HO+

Fe2+

MnSODFeSOD

50 100 150

Met stop

N-terminal ( α hairpin loop) C-terminal

D-X-[WF]-E-H-[STA]-[FY]-[FY] DVWEHAYY


Y174

H30

H26

Mn

H81 CH D167

H171 E170

Y174

H30

H26

Mn

H81CHD167

H171E170

Subunit A Subunit B

Two aromatic residues E170 and Y174 forms a bridge between the two active sites


Five coordinated Five coordinated trigonaltrigonal geometry of Fe and geometry of Fe and MnSODMnSOD

Important in tuning the redox potential


Based on Four main traits viz.,

Metal specific residuesOuter-sphere hydrogen bonding residuesLysine residues with photosynthetic roleTransmembrane hydrophobic pocket


F184X3A188Q189….…T280……F/Y303 in Fe being replaced by R184X3G188G189….…G280……W303 in MnSOD


MnSOD - glutamine Q262 arising from the end of the β2-strand and H9 in the C-terminal domainFeSOD - tryptophan W243 arising from the middle of the

sequence (within the β1) in the C-terminal domain.

Cambialistic Fe/MnSOD metalloform in archaea(Pyrobaculum aerophilum) – histidine - plays a major role in altering the solvent interaction with the active site metal ion

the absence of this histidine suggest the absence of cambialistic metalloforms in cyanobacteria


Two lysine residues (K201, 255) only in FeSOD and not in MnSOD

Unique and function specific to cyanobacteria among prokaryotes

K201 lines a small pit at the surface of the T. elongatusand of higher plants FeSOD, formed by the loop P202-G203-G204 connecting N and C terminal domains

K255 is restricted only to cyanobacteria, implying its importance in the photosynthetic context


Cyanobacterial MnSOD

is the only SOD to be

membrane anchored by

transmembrane helix

Factor that determines

localization of MnSOD

spans the N terminal

which is a hydrophobic

transmembrane helix

Characteristics FeSOD MnSODMetal specificity Fe MnAminoacid length 199-229 200-316

Theoritical molecular weight 21-25 Kda 22-34 KdaNo. of a helix* 13 14No. of b helix* 3 3Domains N & C terminal N & C terminalMotif DVWEHAYY DVWEHAYYActive site residues*

Structurally highly conserved metal specific residues

Phe (F184), Ala (A188), Gln(Q189), Thr (T280) and Phe/Tyr(F/Y303)

Arg (R184), Gly (G188, 189, 280) and Trp (W303)

Key clues for discrimination Conserved Lys (K87 K139) Transmembranehydrophobic pocket

Discriminatory key to classify indecisive Discriminatory key to classify indecisive CyanobacterialCyanobacterial Fe Fe & & MnMn isoformsisoforms


Theoretical molecular weight - 16-23 KDa with an amino acid length of

174-233 residues

Rich in Gly (11-16%) forming eight β-sheets - conformation and stability in repeated freeze/thaw cycles and prolonged refrigeration

Has copper containing domain (Pfam:PF00080) and two different

signatures

SOD copper domain

G-[GA]-G-G-[AEG]-R-[FIL]-[AG]-C-G

50 100 150

Met stop

200

G-F-H-[ILV]-H-x-[NGT]-[GPDA]-[SQK]-C

Signature 1 Signature 2


Catalytic metal coordination of CuZnSOD


Hexamer found only in cyanobacteria other than Streptomyces sp.

Amino acids ranging from 140-163 and molecular weight between

15-18KDa

Motif with eleven-residues (HCDGPCVYDPA) in N-terminal region of

Ni-hook, along with a nickel containing SOD domain

(Pfam:PF09055)

HCDGPCGVYDPNi Signature

Ni SOD domain

50 100 150

Met stop

200


Catalytic metal coordination Catalytic metal coordination of of NiSODNiSOD


Middle order forms of cyanobacteriaposses a combination of Fe and Ni or Fe and Mn SODsmost evolved filamentous, heterotrichousand heterocystous forms predominantly have only Fe and Mn metalloforms

Unicellular Prochlorococcus forms possess only NiSOD, whereas, multicellular filamentous heterocystous and heterotrichous forms lacks this isoform

primitive photosynthetic machineryits smallest genome size (between 1669-2434 Kb) by gene rearrangement or loss to maximize the energy economy

Mid

dle

Low

erH

ighe

r

NiSOD alone

Fe & Ni/ Fe & Mn

SODs

predominantly only Fe and

MnSOD


Organisms Accession no

Sequence length

Type of SOD in Database

Confirmed isoformfrom our

studyProchlorococcus marinus AS9601 YP_001009883 157 putative Ni NiSOD

Prochlorococcus marinus CCMP1986 NP_893411 156 putative Ni NiSOD

Prochlorococcus marinus CCMP1375 NP_875759 157 Ni NiSOD

Prochlorococcus marinus MIT 9301 YP_001091703 157 putative Ni NiSOD


Prochlorococcus marinus MIT 9211 ZP_01004940 140 Ni NiSOD


Prochlorococcus marinus MIT 9313 NP_894173 157 putative Ni NiSOD


Prochlorococcus marinus NATL1A YP_001015534 163 putative Ni NiSOD

Prochlorococcus marinus NATL2A YP_292055 163 putative Ni NiSOD

Synechococcus sp. WH 8102 NP_897719 157 putative Ni NiSOD

Synechococcus sp. BL107ZP_01469600 157 putative Ni NiSOD

ZP_01468043 198 putative SOD CuZnSOD

Synechococcus sp. CC9605 YP_381196 157 putative Ni NiSOD


Synechococcus sp. CC9311YP_729969 175 CuZn CuZnSOD

YP_730975 155 Ni NiSOD

Synechococcus sp. CC9902 YP_376992 175 putative SOD CuZnSOD

Crocosphaera watsonii WH 8501ZP_00517273 159 Hypothetical protein NiSOD

ZP_00514026 254 SOD MnSOD

Synechococcus elogatus PCC 6301 YP_171447 229 SOD FeSOD

1613421A 202 SOD FeSOD

Synechococcus elogatus PCC 7942

YP_399820 229 SOD FeSOD

CAB57855 201 SOD FeSOD

Synechococcus sp. JA-3-3Ab YP_476221 199 Fe FeSOD

Synechococcus sp. JA-2-3B'a(2-13) YP_478710 199 Fe FeSOD

Synechococcus sp. WH 7805 ZP_01124652 199 SOD FeSOD

ZP_01123794 174 putative SOD CuZnSOD

Synechococcus sp WH 5701 ZP_01084003 199 SOD FeSOD


Synechococcus sp. RS9916 ZP_01470625 199 SOD FeSOD

ZP_01472508 177 SOD precursor (Cu-Zn) CuZnSOD

Gloeobacter violaceus PCC 7421

NP_927273 203 SOD FeSOD

NP_923628 316 SOD MnSOD

NP_924927 233 similar to SOD CuZnSOD

NP_925116 191 similar to SOD CuZnSOD

Synechococcus sp. RS9917 ZP_01081353 199 SOD FeSOD


Cyanothece sp. CCY0110 ZP_01728505 200 SOD FeSOD

Thermosyncehococcus elongatusBP-1

NP_682309 200 SOD FeSOD


Lyngbya sp. PCC8106ZP_0169885 201 SOD CuZnSOD

ZP_01619231 201 SOD FeSOD

Trichodesmium erythraeumIMS101

YP_723986 254 SOD MnSOD


Synechocystis sp. PCC 6803 NP_441347 199 Fe FeSOD

Spirulina platensis AAQ22734 170 Fe FeSOD

Plectonema boryanum UTEX 485

AAA69954 199 Fe FeSOD

AAA69953 239superoxide dismutase[Mn] precursor

MnSOD

AAA69950 248 MnSOD

AAA69952 206 MnSOD

Leptolyngbya valderianaBDU20041 AAX84682 144 Mn MnSOD

Nostoc punctiforme PCC 73102

ZP_00108516 200 SOD FeSODZP_00112125 249 SOD MnSOD


Nostoc sp. PCC 7120

Q8YSZ1 200 Fe FeSODAAD51417 200 Fe FeSOD


Anabaena variabilis ATCC 29413 YP_321482 200 Mn/Fe FeSOD

YP_321963 270 Mn/Fe MnSOD


InsilicoInsilico findings conclude findings conclude ……..

Based on the analysis, the 64 cyanobacterial SOD sequences are clearly categorized into 17 NiSOD, 7 Cu/ZnSOD, 24 FeSOD and 14 MnSOD genes, 2 non assignable as they require further structural data.

ctggaaatccactacaccaaacaccatcagacctatatcaataacttgaatgctgcagtc L E I H Y T K H H Q T Y I N N L N A A V gagggcactgaattctcgggctggccggttgagaagctggtttcaagcgtgcagcaacta E G T E F S G W P V E K L V S S V Q Q L ccggaaaaactgcgcgccgccgtgatcaaccaaggcggggggcatgctaaccactcgcta P E K L R A A V I N Q G G G H A N H S L ttctgggcggtgatgtcgccaaaaggcggaggcaaacccgaaggcgtgctgggcaaagcc F W A V M S P K G G G K P E G V L G K A atcgatgaacagttgggcggcttcgacagtttcaaggaggcctttaccaaggccgcattg I D E Q L G G F D S F K E A F T K A A L acgcgtttcggcagcggctgggcctggttgagcgttaccccgcaaaagaccctggtggtg T R F G S G W A W L S V T P Q K T L V V gaaagcagtggcaaccaggacagcccgctgatgagcggcaacacgccgatcctcggcctg E S S G N Q D S P L M S G N T P I L G L gacgtgtggaca D V W T

Shown below the nucleotide (AY974247) is the translated protein (AAX84682) sequence used for structure

determination.

Nucleotide Sequence for MnSOD of Leptolyngbya valderianaBDU20041.

Superimposed 3D structures ofSuperimposed 3D structures of L. L. valderianavalderiana BDU20041 (red) BDU20041 (red) with with templatetemplate Bacillus Bacillus anthracisanthracis (yellow) (yellow) with 63.8% similaritywith 63.8% similarity

The RMSD value of superposed structure shows that the alpha carbons are at 0.88Å and backbone carbon is at 0.85Å

Overall Structure of Overall Structure of L. L. valderianavalderiana BDU20041 BDU20041 MnSODMnSOD

Schematic presentation of MnSOD with residues involved in active site are shown as a ball and stick representation. The elucidated structure

possesses 6 helices and 3 sheets

Residues linking the active-site region are presented

His 58

His 4

Asp 141

150 clones were sequenced15 contigs of ~20Kb was assembled using CAP3 software.Annotation resulted in 9 protein coding genes (hypotehtical protein, P-loop linked ATPase acetyltransferase, Aldo-keto reductase, Nif Z, Peptide deformylase, Pyrimidine regulatory protein, ATP-depended Clp protease adaptor protein, 2 - tRNA and 1 - rRNA.Whole Genome Sequencing Project ID : AAZ00000000

Significant findingsSignificant findingsImmaculately proved that marine cyanobacterium, O.curviceps BDU 92191 uses Acid Black 1 as nitrogen source.

Study evidently proves the role of AOS in decolourization by the spectroflurometric studies.

In cyanobacteria, to our knowledge we were the first in India to sequence an MnSOD gene and proceeded upto 3D structure.

First study on the presence of aerobic azoreductase in cyanobacteria

Partial WGS of marine cyanobacterial plasmid pBDU02 and this thoroughly rules out that cyanobacterial plasmid are not cryptic.

We have identified a multiple potential organism, O.curviceps BDU 92191 in addition to dye decolourization could be exploited for production of pigment, biodiesel (lipid content – 9%), hydrogen in N deficient medium and also in biofertilizer

LeadsLeads……..

Striving to complete the plasmid sequencing for an efficient vector to aid in expression studies

Another technology transfer for pigment and bioenergy.

CommitmentsCommitments……..

Expression studies with exogenous SOD gene from cyanobacteria.

Attempt to identify, isolate and characterize azo reductase gene from marine cyanobacteria

Potential of bioenergy production and pigment charcterization from the biomass after decolourization of the selected marine cyanobacterium for technology development.

The cyanobacteria is { Always right

Our friend

A sensitive partner

Cyanobacteria are{ smarter

wiser

more energetic} than chemists,

engineers, etc.

Cyanobacteria { can

will } do anything

“Without cyanobacteria there would be no life on earth. The oceans would be sterile and the land uncolonized”

Royal Botanic Garden, Kew, London

Documents

Introduction Dyes - Central Leather Research Institute · 2010-01-30 · Classification of Dyes Introduction. 30-Jan-10 NFMC, Bharathidasan University 5 Based on US International