Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Introduc)on to Molecular Biology and Bioinforma)cs Workshop
May 6-‐17, 2013
Biosciences eastern and central Africa -‐ Interna;onal Livestock Research Ins;tute Hub (BecA-‐ILRI Hub), Nairobi,
Kenya
Rob Skilton Team Leader-‐Capacity Building, BecA-‐ILRI Hub
Introduc;ons • Resource persons
– Val Aloo – Jacqueline Mayira – Njeri Mburu Health and safety trainer – Sylvia Wanjiru Mol Biol Lab trainers – Tina Kyalo – Moses Njahira – Solomon Maina – Dr Laura Purdie – Dr Roger Pelle – Dr Rob Skilton
• Par)cipants: name; posi;on; ins;tute; country; your expecta;ons of the workshop; how you plan to use the acquired skills in your research
BFX trainers – Joyce Nzioki – Dr Mark Wamalwa – Dr Anne Jores – Nelson Ndegwa Segoli – Ben Kiawa – Inosters Nzuki – Lucy Muthui
Nya) (buffalo) Tutor: Moses Njahira 1. Abdelaziz Gesmallah 2. Mary Nanfuka 3. Tamador Elhassan 4. Irene Onyango 5. Japhe`e Kembou Tsofack
Twiga (giraffe) Tutor: Dr Roger Pelle Francophone 1. Augus;n Penda Twizerimana 2. Beatus Lyimo 3. Linda Salekwa 4. Constan;n Nimbona 5. Redeat Alemu
Animal
Mchicha (amaranth) Tutors: Tina Kyalo 1. Alexandre Congera 2. Simeon Yulu Mbembo 3. Valen;ne Nakato 4. Stella Bigirwa Ayesiga 5. George Ochieng Asudi
Ujaka (spinach) Tutor: Solomon Maina 1. Branly Wilfryd Effa Effa 2. Fredah Wanzala Rimberia 3. Irene 4. Dorothy Tchapda Tchatchoua 5. Francisca Kama-‐Kama
Plant
Swara (antelope) Tutor: Dr Laura Purdie 1. Alexander Chirchir 2. Deo Ndumu 3. Lucy Muthui 4. Khalid Salih 5. Cyrus Too
• Please be punctual • Bus leaves Pride Inn at 0745 each day • Strictly observe ;mes for breaks and lunch
• Always wear your badge on campus • Five access cards available for the labs
• Travel/accommoda;on/per diem/health: Val Aloo • Course issues: Rob Skilton or your group tutor
• Wireless internet available throughout campus • Website: h`p://hpc.ilri.cgiar.org/beca/training/IMBB/welcome.html • Download CLC Main Workbench
h`p://www.clcbio.com/products/clc-‐main-‐workbench/
• Security
General Informa;on
• Do not leave laptops or personal effects una`ended • Phones on silent • Avoid taking calls in lab and lectures
• Tea/coffee • Lunch in N’Dama Lounge • Breakfast and dinner at Pride Inn • Bathrooms • Bus leaves from ILRI recep;on
• Cocktail recep;on at ILRI on Tuesday 7th, 1800-‐1930 • Shopping and Dinner on Saturday 11th, 1530-‐2030 • Rest Day on Sunday 12th • BBQ Dinner at ILRI on Friday 17th, 1800-‐2000
General Informa;on
• Make the workshop interac;ve
• Don’t be afraid to ask ques;ons. Asking ques;ons is not a sign of stupidity. Those who ask lots of ques;ons will gain more from the workshop.
• Par;cipants will be expected to ‘present’ their group results and discuss them.
• We will have a QUIZ at end of each day: be prepared to answer ques;ons and to ask ques;ons.
• Keep a laboratory note book: A4 hardback notebook is provided. Keep it up to date. Record everything you do in the lab as you do it, methods, your thoughts and ideas, your results, and interpreta;on of results. We will display examples of par;cipants’ lab books during the workshop.
General Informa;on
Workshop objec;ve For par;cipants to acquire basic molecular biology and bioinforma;cs concepts and prac;cal skills that can be used for the advancement of research at their home ins;tutes
• Prac;cal skills and concepts in basic molecular biology tools
• Prac;cal skills and concepts in BFX, using DNA sequences obtained during the workshop • Experience the discovery process as a team • Establish basic mol biol and BFX at your home ins;tute
• Basic concepts of mol biol and BFX for understanding various contemporary areas of research and their applica;ons • Communicate with other researchers in mol biol • Links between researchers (posters) and with BecA
Muscle Uniden;fied species
Animal
Ribulose-‐1, 5-‐bisphosphate
carboxylase oxygenase large subunit gene
(rubisco; rbcL) from the plas;d genome
DNA
Polymerase Chain Reac)on (PCR)
Mitochondrial cytochrome c oxidase subunit 1 (CO1) gene
Analyse DNA sequence to iden)fy species
Plant
Leaf Uniden;fied species
Learning molecular biology and bioinforma;cs through DNA barcoding
? ?
DNA barcoding is based on a simple concept. DNA barcoding is a taxonomic method that uses a specific short gene;c marker in an organism's DNA to iden;fy it as belonging to a par;cular species. In 2003, Paul D.N. Hebert from the University of Guelph, Canada, proposed the compila;on of a public library of DNA barcodes that would be linked to named specimens. This library would "provide a new master key for iden<fying species, one whose power will rise with increased taxon coverage and with faster, cheaper sequencing".
DNA barcoding
DNA barcoding: a new diagnos;c tool for rapid species recogni;on, iden;fica;on, and discovery. As of February 2013, the Barcode of Life Datasystems database included almost 2,000,000 barcode sequences from over 160,000 species of animals, plants, and fungi. h`p://www.boldsystems.org/
DNA barcoding
ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTACTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACG A T G
Organism is sampled DNA is extracted
Sequenced DNA is compared with sequences in a barcode database to iden;fy the organism
How Barcoding works
The PCR product is sequenced
a small region of DNA (the Barcode DNA) is PCR amplified
Applica;ons of DNA barcoding (1) Facilita;ng iden;fica;on and recogni;on of named (described) species:
• Plant leaves even when flowers or fruit are not available • Linking life history stages, genders • Differen;a;ng cryp;c species • Iden;fying gut contents (e.g. ;cks, mosquitoes, bi;ng insects) • Human and plant disease vectors • Agricultural pests • Biosecurity: detec;ng invasive insect pests at port of entry • Inventory of species in genebanks • Food (market subs;tu;on) • Bushmeat and illegally sold products of endangered species
(2) Surveying biodiversity; e.g., flagging poten;ally new (undescribed) species.
Molecular biology (JVC, Lab 4)
Bioinforma;cs (JVC)
Rest Day
1 2 3 4 5 6 7 8 9 10 11 12
Day
WEEK 1
WEEK 2
Workshop plan
Workshop plan
Tissues Purify DNA
PCR
Purify PCR product
Restric;on
Analyse PCR products (Gel)
Analyse purified PCR product
(Nanodrop/Gel)
Gel
DNA sequencing
Analyse DNA (Nanodrop/Gel)
Bioinforma)cs
PCR Op;misa;on
Workshop plan
Tissues Purify DNA
PCR
Purify PCR product
Restric;on
Analyse PCR products (Gel)
Analyse purified PCR product
(Nanodrop/Gel)
Gel
DNA sequencing
Analyse DNA (Nanodrop/Gel)
Bioinforma)cs
PCR Op;misa;on
Day 1
Workshop plan
Tissues Purify DNA
PCR
Purify PCR product
Restric;on
Analyse PCR products (Gel)
Analyse purified PCR product
(Nanodrop/Gel)
Gel
DNA sequencing
Analyse DNA (Nanodrop/Gel)
Bioinforma)cs
PCR Op;misa;on
Day 2
Day 1
0845-‐0900 Welcome and Workshop Opening
JVC Dr Rob Skilton
0900-‐1000 Introduc;on to the course • Introducing the par;cipants and trainers • Housekeeping issues • Objec;ves and expecta;ons • Overall workshop outline • Outline of Day 1 ac;vi;es
JVC Dr Rob Skilton
1000-‐1015 Tea/coffee JVC 1015-‐1115 Seminar
• Laboratory Health and Safety JVC Sylvia Wanjiru
1115-‐1145 Lab • Laboratory Health and Safety
Lab 4 Sylvia Wanjiru
1145-‐1230 Lab • Pipesng skills • Introduc;on to lab equipment
Lab 4 Tina Kyalo, Moses Njahira, Solomon Maina, Dr Roger Pelle, Dr Laura Purdie, Dr Rob Skilton
1230-‐1330 Lunch N’dama Lounge 1330-‐1430 Seminar
• Molecular biology and DNA structure • Introduc;on to PCR • Genomic DNA purifica;on • Agarose gel electrophoresis
JVC Dr Rob Skilton
1430-‐1530 Lab • Genomic DNA (gDNA) purifica;on
(plant leaf or animal muscle ;ssues)
Lab 4 Tina Kyalo, Moses Njahira, Solomon Maina, Dr Roger Pelle, Dr Laura Purdie, Dr Rob Skilton
1530-‐1545 Tea/coffee 1545-‐1730 Lab
• gDNA purifica;on con;nued • Prepare agarose gels
Lab 4 Tina Kyalo, Moses Njahira, Solomon Maina, Dr Roger Pelle, Dr Laura Purdie, Dr Rob Skilton
1730-‐1800 Seminar • Spectrophotometry of DNA
Lab 4 Tina Kyalo
1800-‐1830 Review of Day 1 ac;vi;es and Quiz Lab 4 All 1830 Bus leaves ILRI for Pride Inn ILRI Recep;on