Intracellular localization and isoform expression of the voltage-dependent anionchannel (VDAC) in normal and dystrophic skeletal muscle

ROBERTOMASSA1,3,*, LIONEL NJL MARLIER2,4, ALESSANDROMARTORANA1, SIMONA CICCONI2,DANIELA PIERUCCI2, PATRIZIA GIACOMINI5, VITO DE PINTO6 and LORIANA CASTELLANI1,71Dipartimento di Neuroscienze and 2Dipartimento di Medicina Interna, Laboratorio di Medicina Molecolare,UniversitaÁ di Roma Tor Vergata, Roma, Italy; 3I.R.C.C.S. Ospedale S. Lucia, Roma, Italy; 4Istituto di MedicinaSperimentale, Consiglio Nazionale delle Ricerche (IMS-CNR) Roma, Italy; 5Clinica Neurologica II, UniversitaÁ diRoma La Sapienza, Roma, Italy; 6Dipartimento di Scienze Chimiche, Laboratorio di Biochimica e BiologiaMolecolare, UniversitaÁ di Catania, Catania, Italy; 7INFM, Sez.B, Tor Vergata, Roma, Italy

Received 12 December 1999; accepted in revised form 18 June 2000

Abstract

Voltage-dependent anion channels (VDACs) are a family of pore-forming proteins encoded by di�erent genes, withat least three protein products expressed in mammalian tissues. The major recognized functional role of VDACs is topermit the almost free permeability of the outer mitochondrial membrane (OMM). Although VDAC1 is the bestknown among VDAC isoforms, its exclusively mitochondrial location is still debated. Therefore, we have measuredits co-localization with markers of cellular organelles or compartments in skeletal muscle ®bers by single or doubleimmuno¯uorescence and traditional as well as confocal microscopy. Our results show that VDAC1 immunore-activity corresponds to mitochondria and sarcoplasmic reticulum, while sarcolemmal reactivity, previously reported,was not observed. Since VDAC1 has been suggested to be involved in the control of oxidative phosphorylation, wesought for possible gene regulation of VDAC1, VDAC2 and VDAC3 in skeletal muscle of the dystrophin-de®cientmdx mouse, which su�ers of an impaired control of energy metabolism. Our results show that, while VDAC1mRNA and protein and VDAC2 mRNA are normally expressed, VDAC3 mRNA is markedly down-regulated inmdx mouse muscle at di�erent ages (before, during and after the outburst of myo®ber necrosis). This ®ndingsuggests a possible involvement of VDAC3 expression in the early pathogenic events of themdxmuscular dystrophy.

Introduction

Voltage-dependent anion channels (VDACs) or porinsare pore-forming proteins originally found in the outermitochondrial membrane (OMM) of all eukaryotes. Thefunctional features of these proteins are evaluated uponreconstitution in planar lipid bilayers. In such anarti®cial system, it has been established that VDACcan exist in multiple conductance states. In the highly-conductive open state, the channel is anion selective,allowing the di�usion of adenine nucleotides and othermetabolites through the OMM, the permeability barrierbetween the cytosol and the energy-transducing innermitochondrial membrane. By switching to a low con-ductance state, VDAC channel becomes cation-selective,changing the selectivity properties of the OMM andpreventing adenine nucleotides permeability (Colombini,1980; Benz et al., 1990; Mannella, 1990). In addition,VDAC can act as the binding site for enzymes, such ashexokinase, glycerol kinase, and mitochondrial creatine

kinase, thus participating in multiple, ATP-dependent,phosphorylation events (Adams et al., 1991; Brdiczkaet al., 1994; Kemp et al., 1998). Finally, VDAC bindsthe microtubule-associated protein 2, a ®nding thatimplies its participation in the interactions betweenmitochondria and the cytoskeleton (Leterrier et al.,1994; Linden and Karlsson, 1996).The involvement of VDACs in cell pathology has

recently been demonstrated. Indeed, these channels, byinteracting with proteins of the Bcl-2 family, regulate therelease of death-promoting factors such as cytochrome cfrom the mitochondrion into the cytosol. This mecha-nism directly implicates VDACs in the apoptotic cas-cade (Shimizu et al., 1999).Molecular biology studies have recently shown that

VDACs are a family of proteins encoded by di�erentgenes, with four cDNA isoforms identi®ed in humanand six in the mouse (Blachly-Dyson et al., 1993, 1994;Sampson et al., 1996a, b; Rahmani et al., 1998). At leastthree protein products, namely VDAC1, 2 and 3 areexpressed in mammalian tissues, and splice variants ofVDAC2 and 3 have been described (Yu and Forte, 1996;An¯ous et al., 1998; Sampson et al., 1998).Since most functional data regarding VDAC were

obtained prior to the detection of multiple isoforms, it

*To whom correspondence should be addressed: Tel.: +39 06

72596004 or 5914436; Fax: +39 06 5922086

E-mail: massa@uniroma2.it

Journal of Muscle Research and Cell Motility 21: 433±442, 2000. 433Ó 2000 Kluwer Academic Publishers. Printed in the Netherlands.

remains to be clari®ed whether speci®c isoforms accom-plish di�erent functions in the OMM or they arefunctionally similar but localize to distinct cellularcompartments. The latter hypothesis is supported byrecent data demonstrating the existence of di�erentialtargeting of VDAC1 to mitochondria and cell mem-brane (Buettner et al., 2000).The subcellular distribution of VDAC isoforms is still

a matter of debate. Indeed, some authors reported theexclusive localization of VDAC in mitochondria, whereit seems concentrated in discrete patches correspondingto contact sites between the inner and outer membrane(Yu et al., 1995; Yu and Forte, 1996; Sampson et al.,1998). Other investigators found VDAC immunoreac-tivity, beside mitochondria, also in the plasmalemma ofB-lymphocytes (Thinnes et al., 1989) and brain astro-cytes (Dermietzel et al., 1994), and in the post-synapticmembrane fraction from brain (Moon et al., 1999). Inskeletal muscle VDAC1 has been located, in addition tomitochondria, in the sarcoplasmic reticulum (SR) (Lewiset al., 1994; Jurgens et al., 1995; Shoshan-Barmatzet al., 1996; Sha®r et al., 1998) and in the sarcolemma(Babel et al., 1991; Junankar et al., 1995).Interestingly, de®ciency of VDAC1 protein in skeletal

muscle has been observed in human patients a�ected bya severe encephalomyopathy. They presented variousdysmorphisms, hydrocephalus, psychomotor retarda-tion, muscle hypotonia and lactic acidosis; biochemicalstudies on skeletal muscle biopsies showed an impairedsubstrate oxidation and reduced production of highenergetic compounds (Huizing et al., 1996). Mutationswere searched, but not found, in the human VDAC1sequence, taking in account a previously reported mapposition of the gene onto the X chromosome. A recentscreening of a human chromosome X cosmid libraryhowever, lead only to the isolation of a processedpseudogene, while genuine VDAC1 was mapped tochromosome 5q31 (Messina et al., 1999).Analogously to human patients with VDAC1 de®-

ciency, the mdx mouse, a model for Duchenne musculardystrophy, exhibits an impaired control of energymetabolism in skeletal muscle (Glesby et al., 1988; Evenet al., 1994; Kuznetsov et al., 1998). This change couldbe mediated by perturbations in VDAC modulation, amechanism suspected to control mitochondrial respira-tion in physiological conditions (Liu and Colombini,1992).From these considerations it derives that a better

understanding of VDAC sub-cellular localization andisoform expression in skeletal muscle is needed in order toshed light on the role that VDAC de®ciency or regulationmay play in neuromuscular pathological processes. Withthis aim in mind we have analyzed VDAC1 immunore-activity and its co-localization with speci®c markers ofcellular compartments in skeletal muscle of human andmouse. Moreover, we have sought for possible generegulation of VDAC isoforms in mdx mice at di�erentages, corresponding to distinct stages in the evolution ofthis murine muscular dystrophy (Massa et al., 1997).

Materials and methods

Animals

Stocks of mutant mdx mice and of their correspondingwild type strain C57BL/10ScSn were bred in our animalhouse and maintained under routine conditions on astandard commercial diet. Control and mdx mice werekilled by cervical dislocation, and the gastrocnemius andquadriceps muscles were dissected from both hindlimbsand either immediately frozen in liquid nitrogen-cooledisopentane for immunocytochemical and biochemicalstudies or used fresh for RNA studies.

Immunocytochemistry

Human muscle biopsies obtained for diagnostic purposethat failed to show histological or histochemical alter-ations and muscles from groups (n = 4) of normal andmdx mice (90-day old) were used.For VDAC1 immunodetection, two di�erent anti-

bodies (Ab) were used: a rabbit polyclonal Ab (T8)raised against a polypeptide mimicking the ®rst 19residues of the N-terminal end of the human VDAC1; amouse monoclonal Ab (mAb2) which recognizes theN-terminal 35 amino acids (a.a.) of human VDAC1but not the homologous region of VDAC2 (Winkelbachet al., 1994). Preparation and characterization of T8 andmAb2 have been previously described (Thinnes et al.,1989; Babel et al., 1991).Transverse and longitudinal cryostat sections (6 lm)

were processed for indirect immuno¯uorescence as previ-ouslydescribed (Massa et al., 1994). Inbrief, after ®xationin acetone for 10 min at 4°C, sections were incubated for60 min with the primary Ab (1:200), rinsed in phosphatebu�ered saline (PBS) and incubated for 30 min with abiotinylated horse anti-rabbit, or goat anti-mouse Ab(Vector, Burlingame, CA, USA), diluted 1:200, rinsedagain and reacted with avidin-¯uorescein isothiocyanate(FITC) (Sigma; 1:200 for 40 min). For double-labelingexperiments, primary Abs were detected by FITC-con-jugated goat anti-rabbit (Sigma, Milano, Italy, 1:50)and tetramethylrhodamine isothiocyanate (TRITC)-conjugated goat anti-mouse (Chemicon, Temecula,CA, USA, 1:50) Abs. Negative control sections wereincubatedwithnon-immune serum insteadofprimaryAb.To detect localization of VDAC1 to the plasma

membrane, serial cross sections were stained with eitherthe anti-VDAC1 mAb2 or an anti-dystrophin mAb(Dys-2, Novocastra, Newcastle upon Tyne, UK, undi-luted). Double labeling of transverse and longitudinalsections with the anti-VDAC1 (T8) Ab and an anti-Ca/Mg-dependent ATPase (SERCA1) mAb (Biomol, Ply-mouth meeting, PA, USA, 1:200) was performed tovisualize VDAC1 in the SR. Moreover, the presence ofVDAC1 in SR and mitochondria was investigated bylabeling of sections with anti-VDAC1 mAb2 and twodi�erent organelle-selective ¯uorescent dyes. Therefore,after secondary Ab incubation, sections were incubated

434

either with the carbocyanine DiOC6(3) dye (MolecularProbes Eugene, OR, USA.) at a concentration of 1 lg/ml for 5 s, a protocol which enables to stain bothendoplasmic reticulum and mitochondria (Terasakiet al., 1984), or with 100 nM Mitotracker Green FM(Molecular Probes) for 45 min, a marker speci®c formitochondria (Nakae et al., 1999).All sections were mounted with anti-fading medium

and routinely examined and photographed with a LeitzOrthoplan microscope by epi¯uorescent excitation.Confocal analysis was carried out with a Leica TCSNT system, equipped with 40 ´ 1.00±0.5 and 100 ´ 1.3±0.6 oil immersion lenses. Serial optical sections, 0.5 lmapart, of all double-labeled samples were recorded withsimultaneous excitation and detection of both dyes toensure their proper alignment and with an Acousto-Optical-Tunable Filter on the laser beam path tomeasure and correct for possible cross-talk resultingfrom overlapping excitation and emission of the dyes.

Gel electrophoresis and western blot analysis

Muscle tissue from control and mdx mice (90-day old)was homogenized using a Polytron grinder in: 40 mMNaCl, 2 mM EGTA, 2 mM MgCl2, 2 mM ATP,10 mM TES, pH 7.4, also containing protease inhibitors(1 mM PMSF, 20 lg/ml leupeptin, 20 lg/ml aprotinin,20 lg/ml soybean trypsin inhibitor). Protein concentra-tion was determined using the BCA colorimetric kit byPierce (Rockford, IL, USA), and total extracts wereprepared for SDS±PAGE by dilution (1:1) with dena-turing bu�er (20% glycerol, 3% 2-mercaptoethanol,4% SDS, 25 mM Tris-Cl, pH 7.4) and boiling for5 min. Homogenates (10 lg/well) were separated on a10% polyacrylamide gel and transferred to nitrocellu-lose (Hybond-C super, Amersham, Milano, Italy).Western blots were carried out as previously described(Castellani et al., 1995), using both the anti-VDAC Absemployed also for immuno¯uorescence. Primary Abbinding was revealed using horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse Abs (Bio-rad, Hercules, CA, USA) and the ECL chemilumines-cence detection system (Pierce, Rockford, IL, USA).

Reverse transcriptase-polymerase chain reaction(RT-PCR) analysis

Total RNA was extracted from freshly dissected musclesusing the guanidiniummethod (Chomczynski and Sacchi,1987). The obtained RNA, re-suspended in diethylpyro-carbonate-treated water, was quanti®ed by spectropho-tometry and its purity assessed by gel electrophoresis.The RT-PCR was performed on muscle total RNA to

determine the presence of VDAC1, VDAC2 andVDAC3 transcripts. Reverse transcription was per-formed using 1 lg of total RNA, in the presence of200 U of M-MLV (Gibco, Milano, Italy) using randomhexameres (Pharmacia, Milano, Italy) for 1 h at 37°C.After inactivation of the enzyme, cDNA was PCR-

ampli®ed using speci®c primers for the three VDACisoforms. Primers were designed in the 3¢ end part ofVDAC sequences, where the homology betweenVDAC1, 2 and 3 is only about 16%, in order to amplifyDNA fragments speci®c of a given VDAC isoform forsuccessive Northern blot application.Oligonucleotides primers were: VDAC1, 5¢-

GCTAAGGATGACTCGGCTTTAAGG and 5¢-AG-GTTAAGTGATGGGCTAGGATGG, which give a335 bp ampli®cation product (Genebank accessionnumber #U30840); VDAC2, 5¢-TCACTGTTGGCTG-GTTCCTAGTTG and 5¢-AAGACCTCGTGGATT-ATGCTAGGG, which give a 457 bp ampli®cationproduct (#U30838); VDAC3, 5¢-CACTTGTCCC-TGGAAATGAAGAG and 5¢-CATGACACTACGTT-GTTGCTGAGG, which give a 255 bp ampli®cationproduct (#U30839).The PCR ampli®cation was performed in a ®nal

volume of 100 ll in a Perkin-Elmer thermal cycler, using2.5 U Taq polymerase (Promega, Milano, Italy) for 28or 33 cycles (94°C, 1¢-60°C, 1¢-72°C, 1¢ with 5¢ ®nalextension). Polymerase chain reaction products werecloned into a pGemÒ-T plasmid (Promega, Milano,Italy) for successive probe preparation.

Northern blot analysis

Total RNA from both control and mdx mice 18, 90 or180-day old were separated on agarose±formaldehydegel, and blotted onto nylon membrane (Amersham,Milano, Italy) using a positive pressure system (Posi-Blot, Stratagene, La Jolla, CA, USA). Membranes werethen cross-linked (Stratagene) and pre-hybridized in 6XSSC, 50% formamide, 0.5% SDS, 2X Denhart's and100 mg/ml denatured ssDNA, for 2 h at 42°C. Probeswere prepared by Random Priming (Boehringer, Mila-no, Italy) of agarose gel-puri®ed (Qiaquick, Qiagen,Hilden, Germany) DNA fragments cloned as describedabove. Inserts were excised from the pGEM-T vector byHind III digestion.Hybridization of the membranes was performed

overnight in the same conditions as of pre-hybridization,using 1±2 ´ 106 cpm/ml of heat-denatured probe. Blots,repeated three times, were subsequently exposed toKodak ®lms at )80°C with intensifying screens.Densitometric analysis was performed using a Fluor-S

image analyzer (Biorad, Hercules, CA, USA) and datanormalized by scanning of the 18S rRNA ethidiumbromide signal present onto the membrane. Values wereexpressed as the percent decrease (mean � SEM ofthree measures) in mdx vs. control muscle preparations.

Results

VDAC1 is present in both SR and mitochondria

The immunolocalization of VDAC1 was similarin murine and human skeletal muscle. In transverse

435

sections at low magni®cation, VDAC1 signal was local-ized internally to the myo®bers, with a lace-like reticularpattern, while the sarcolemma was unstained(Figure 1A). On the contrary, in neighboring sectionsimmunostained for dystrophin, the signal was limited toa rim outlining the ®ber borders, indicative of sarcolem-mal localization as expected (Figure 1B). In transversesections at higher magni®cation, VDAC1 stainingshowed a ®ne reticular intermyo®brillar distribution,compatible with mitochondrial and SR/T-tubule local-ization (Figure 1C). Discrete patches of sub-sarcolem-mal staining, probably due to clusters of mitochondria,were also seen (Figure 1C). In longitudinal sections atthe same magni®cation, a strong signal with a regulartransverse banding pattern was observed spanningthroughout the ®ber width (Figure 1D). These transverseelements appeared as having a `beaded' structure andcorresponding to the I-band of sarcomeres, as shown byphase contrast observation (not shown). Consistentlywith the staining distribution in cross-sections, nolabeling of the sarcolemma was detected. In mdxmuscles, VDAC1 intracellular distribution was consis-tent with that observed in normal muscle (not shown).

By confocal microscopy, longitudinal sections double-stained for VDAC1 and SERCA1, revealed a similarbeaded transverse banding pattern for the two proteins(Figure 2A and B). In transverse sections, the signalrelative to SERCA1, detected only in fast myo®bers,showed a reticular pattern of distribution depicting thelocalization of the SR (Figure 2E). The staining forVDAC1, observed in all muscle ®bers, was also locatedaround myo®brils but with a less regular appearancethan that of SERCA1, probably due to the concomitantstaining of SR and mitochondria (Figure 2C). Indeed,when merged in a single image, the two signals showed apartial superimposition (Figure 2G). In order to assesswhether VDAC1 immunoreactivity is consistent withstaining of both SR and mitochondria, sections werealso stained with DiOC6(3), a ¯uorescent dye known tolabel both these organelles (Terasaki et al., 1984).Longitudinal sections double-labeled with Ab toVDAC1 and DiOC6(3) showed identical signals relativeto a regular banding pattern which, in merged images,fully overlapped (Figure 2D±H). In transverse sections,the distribution of staining for VDAC1 and DiOC6(3)also showed a high degree of superimposition (not

Fig. 1. Localization of VDAC1 in mouse skeletal muscle. In contiguous transverse sections stained for VDAC1 and dystrophin, VDAC1

immunoreaction is characterized by a lace-like reticular pattern within the myo®bers, while the sarcolemma is unstained (A); on the contrary,

dystrophin immunostaining decorates exclusively the sarcolemma (B). At higher magni®cation, VDAC1 ¯uorescence in transverse sections has a

clear intermyo®brillar distribution, indicative of a triadic and/or mitochondrial localization (C). Patches of sub-sarcolemmal staining may

represent mitochondrial clusters (C). In longitudinal sections, VDAC1 signal shows a regular, transverse banding pattern, with a beaded

appearance, spanning the myo®ber width (D). Bar: (A, B) 10 lm (C, D) 5 lm.

436

Fig. 2. Co-localization of VDAC1 with markers of sarcoplasmic reticulum and mitochondria in human skeletal muscle. Confocal micrographs of

longitudinal (A, B, D, F) and transverse (C, E) sections double-labeled with: polyclonal Ab to VDAC1 visualized with a TRITC-conjugated

secondary Ab (A, C, D), and monoclonal Ab to SERCA1 visualized with a FITC-conjugated secondary Ab (B, E) or the DiOC6(3) green dye (F).

Panels A, C and D are displayed in glow-over scale. Panels G and H highlight the co-localization (yellow) of VDAC1 with SERCA1 in a subset of

fast myo®bers (G) and with membranous structures labeled by DiOC6(3) (H). Bar: 10 lm.

437

shown). To further investigate to what extent VDAC1staining is located in mitochondria, we examined its co-localization with the mitochondrial speci®c markerMitotracker Green FM. In longitudinal sections ofmouse muscle, this dye and VDAC1 showed a verysimilar distribution, with a regular transverse bandingpattern in all muscle ®bers (Figure 3A and B). Detailedanalysis of the banding pattern showed that the trans-verse bands due to VDAC1 staining appeared slightlybroader than those due to Mitotracker, probably owingto the additional labeling of SR by VDAC1 (Figure 3Aand B). Indeed, when these two signals were merged, afair superimposition was observed, with a moderateprevalence of the VDAC1 signal (Figure 3C). On thecontrary, in myo®ber regions highly enriched in mito-chondria, such as the peri-myonuclear and sub-sarco-lemmal mitochondrial masses, particularly evident inmouse oxidative ®bers, the two signals were virtuallyidentical and completely superimposed in the mergedimage (arrow and arrowhead in Figure 3A±C). Inaddition, in double-labeled transverse sections, thepresence of mitochondrial masses allowed to recognizeoxidative ®bers which displayed a more intense signalfor both VDAC1 and Mitotracker, as compared toneighboring glycolytic ®bers (not shown).Taken together, these data plainly indicate that, in

skeletal muscle ®bers, VDAC1 is present both in SR andmitochondria.

The gene transcript of VDAC3, but not of VDAC1 andVDAC2, is down-regulated in muscle from mdx mouse

Analysis of muscle homogenates from control and mdxmice showed comparable levels of expression ofVDAC1, consistent with the similar distribution of thisprotein detected by immuno¯uorescence. Figure 4Ashows SDS±PAGE of muscle extracts from 90-day oldcontrol and mdx mice and the corresponding Westernblots probed with the rabbit serum T8 and the mAb2 toVDAC, also used for immuno¯uorescence, which havebeen reported to speci®cally recognize the N-terminalportion of VDAC1, showing no cross-reactivity for thehomologous N-terminal region of VDAC2 (Winkelbachet al., 1994). Both Abs labeled a band of equal intensityand of 31 kDa apparent molecular weight (MW),consistent with the reported MW of VDAC1 (Babelet al., 1991; Yu et al., 1995) in extracts of both controland mdx mice. A cross-reactivity of these Abs with therecently described VDAC3 isoform cannot be ruled outat present. It should be noted, however, that both inhuman and mouse the N-terminal 19 a.a. of VDAC3show a 63% identity with those of VDAC1, less than the68% identity displayed by the corresponding homolo-gous region of VDAC2, and that the identical a.a. areconserved in these two species (Sampson et al., 1996b;Rahmani et al., 1998).To examine whether di�erences in the expression of

the three isoforms of VDAC occur in mdx mice, a RT-PCR analysis was ®rst carried out in normal mouse

muscle using speci®c primers. mRNA for the VDAC1,VDAC2 and VDAC3 isoforms were all found to betranscribed (Figure 4B). Northern blot analysis of totalRNA prepared from muscle of 18, 90 and 180-day oldnormal and mdxmice was then performed, using speci®cprobes as described in the Methods section (Figure 4C).Transcripts for VDAC1 and VDAC2 showed an intensesignal after 24 h exposure at the expected size of about1.5 Kb and of 1.67 Kb, respectively. The signal forVDAC3 transcript was nicely visible only after 72 h atthe expected size of 1.34 Kb. For both VDAC1 andVDAC2 no signi®cant changes were observed betweencontrol and mdxmice at any age. At most, both VDAC1and VDAC2 messengers were slightly reduced in 90-dayold mdx animals with respect to matched controls. Onthe contrary, VDAC3 messengers were markedly re-duced in all groups of mdx mice when compared torelated healthy animals. In particular, densitometricanalysis of the autoradiograms revealed that VDAC3mRNA was reduced by 56% (�11% SEM), 39%(�9% SEM) and 49% (�7% SEM) in 18, 60 and 180-day old mdx muscles, respectively, as compared to age-matched controls.

Discussion

Localization of VDAC1 in normal humanand mouse muscle

Immunolocalization of VDAC1 in quickly frozen skel-etal muscle ®bers clearly showed a ®ne intermyo®brillarnetwork in cross sections and a regular transversebanding pattern, matching the I bands, in longitudinalsections, consistent with the presence of VDAC1 both inmitochondria and SR membranes. The assignment ofVDAC1 to these organelles is supported by the partialco-localization of VDAC1 staining with MitotrackerGreen FM and with SERCA1, respectively. Moreover,the complete co-localization of VDAC1 immunoreac-tivity with structures stained by DioC6(3), a dye speci®cfor SR and mitochondrial membranes (Terasaki et al.,1984), con®rms the localization of VDAC1 to both theseorganelles. The presence of VDAC1 in the T-tubules isless likely, since these structures are not stained byDioC6(3) (Krolenko et al., 1995). Furthermore, whileVDAC1 immunoreactivity was observed in all ®bertypes, the more pronounced staining detected in

Fig. 3. Co-localization of VDAC1with a mitochondria-speci®c marker

in mouse skeletal muscle. Confocal micrographs of a longitudinal

section double-labeled with: monoclonal Ab to VDAC1 visualized

with a TRITC-conjugated secondary Ab (A), and Mitotracker Green

FM dye (B). A regular transverse banding pattern and peri-myonu-

clear (arrow) and sub-sarcolemmal (arrowhead) masses of mitochon-

dria are evidenced by both stains. Panel C shows the co-localization

(yellow) of VDAC1 with Mitotracker, which is partial in the transverse

bands and complete in the mitochondrial masses (arrow and arrow-

head). Bar: 20 lm.

c

438

439

oxidative ®bers con®rms the prevalence of VDAC1 inthe mitochondria of skeletal muscle ®bers.Localization of VDAC1 to SR and mitochondria is

consistent with previous reports based on di�erenttechniques. Indeed, beside the presence of VDACs inthe OMM, which has been thoroughly documented(Mannella, 1986, 1992; De Pinto et al., 1987, 1991; Yuet al., 1995), there are recent reports on the presence ofVDAC in the SR and mitochondria of amphibian andmammalian myo®bers and in isolated preparations(Lewis et al., 1994; Junankar et al., 1995; Shoshan-Barmatz et al., 1996; Sha®r et al., 1998). The role ofVDAC1 in the SR membranes may be that of minimiz-ing osmotic and potential changes during Ca2+ uptakeand release, and of permitting an exchange of metabolicintermediates such as ATP/ADP between the SR lumenand the cytoplasm, as previously suggested (Shoshan-Barmatz et al., 1996).At variance with previous reports (Babel et al., 1991;

Junankar et al., 1995), we did not observe substantialVDAC1 immunoreactivity in the sarcolemma, possiblydue to the very low expression of VDAC1 in this cellulardistrict. It has also been reported that alternativesplicing of the VDAC1 gene leads to expression of twoporins, one targeted to mitochondria, and the other tothe cell membrane (Buettner et al., 2000). The latter,being characterized by an additional hydrophobic leader

peptide at the N-terminus, may present a three-dimen-sional diversity that could justify low reactivity of theAbs.

VDAC mRNA isoforms in mdx mice

Since VDAC has been suggested to play a role inmitochondrial permeability and in the transport of ATPand ADP across the OMM (Liu and Colombini, 1992),one would expect VDAC defects to a�ect mitochondrialenergy production. Indeed, in human patients withVDAC1 de®ciency, impaired substrate oxidation andreduced production of high energetic compounds havebeen demonstrated (Huizing et al., 1996).Impairment of energy metabolism has also been

reported in skeletal muscles of the mdx dystrophicmouse (Glesby et al., 1988; Even et al., 1994; Kuznetsovet al., 1998), but no data are available on the expressionof VDAC isoforms in this model of DMD. Given theunavailability of speci®c antibodies except for VDAC1,we analyzed the levels of accumulation of mRNAs forVDAC1, VDAC2 and VDAC3 in normal and mdx miceat various ages.The RT-PCR analysis on control mouse muscle was

performed to show that mRNAs for the VDAC1, 2 and3 isoforms are all transcribed and to prepare speci®cprobes. It is worth noting that, although two splice

Fig. 4. Expression of VDAC isoforms in normal and mdx mouse. (A) Coomassie blue-stained SDS±PAGE (10%) (upper panel) of muscle

extracts from control (ctr) and mdx mice and corresponding Western blots (lower panels) immunostained with polyclonal T8 and monoclonal

mAb2 antibodies to the VDAC1 protein isoform. Arrowhead in (A) indicates the location of the band immunostained by the antibodies to

VDAC1. The position and the apparent weight of pre-stained markers expressed in kDa are indicated. (B) RT-PCR analysis of VDAC1, VDAC2

and VDAC3 isoforms in normal mouse muscle; `M' indicates molecular weight markers. (C) Northern blot analysis of VDAC1, 2 and 3 isoforms

in muscles of control and mdx mice. A representative autoradiogram is shown. No signi®cant changes between control and mdx are observed for

VDAC1 and VDAC2, while VDAC3 mRNA is markedly reduced in all groups of mdx mice as compared to age-matched controls.

440

variants of VDAC3 mRNA, di�ering by one additionalcodon are known, only one of them is abundant inskeletal muscle (Sampson et al., 1998). Northern blotanalysis clearly showed that accumulation of VDAC1and VDAC2 transcripts is similar between control andmdx mice at all ages. In addition, Western blots usingtwo distinct Abs to VDAC1 con®rmed that this proteinis also equally expressed in muscles from control andmdx mice. Accumulation of VDAC3 mRNA, on theother hand, was clearly diminished at all ages in mdxanimals with respect to controls.The substantial reduction in VDAC3 mRNA in mdx

mouse muscle at di�erent ages can not be explained bychanges in ®ber type composition for several reasons: (1)a great di�erence between control and mdx muscle wasdetected in 18-day old mice, an age when no modi®ca-tion in ®ber type prevalence between mdx and controls isobserved (Massa et al., 1997); (2) no changes in theabundance of VDAC1 mRNA or protein product wereobserved. Since VDAC1 and VDAC3 are more abun-dant in slow than in fast muscle (An¯ous et al., 1998),changes in the relative presence of di�erent ®ber typesshould result in variation of both isoforms; (3) adecreased expression of VDAC3 was also observed inmdx brain (L.N.J.L. Marlier, unpub.), suggesting thatVDAC3 gene regulation in these mice may be promotedby factors that are not muscle-speci®c.Altogether, these considerations suggest that the early

and systemic regulation of VDAC3 in mdxmice is rathera result of dystrophin de®ciency than that of degener-ative events in muscle ®bers. The possible signi®cance ofthis datum for mdx patho-physiology is not clear since,in vivo, the subcellular localization and the functionalrole of VDAC3 are still largely unknown (Sampsonet al., 1998; Wu et al., 1999; Xu et al., 1999). The®nding that VDAC3 expressed in mammalian cellsin vitro localizes exclusively to mitochondria (Sampsonet al., 1998), however, lend support to the hypothesisthat the down-regulation of VDAC3 in mdx muscle maycontribute to the reported low energy turnover of thesemuscles by interfering with mitochondrial matrix osmo-larity or with adenine nucleotides transport (Wu et al.,1999).Other factors, on the other hand, may participate in

causing energy depletion. It is accepted that mitoc-hondrial calcium overload can substantially impairoxidative phosphorylation in dystrophic muscles(Wrogemann and Pena, 1976). Interestingly, this mech-anism may be aggravated by a lack of exogenousnucleotides within the mitochondria (Crompton, 1999).In addition, reduced levels of mitochondrial mRNAsand a decrease in the content of the respiratory chain-associated proteins have been described in skeletalmuscle of mdx mice (Gannoun-Zaki et al., 1995;Kuznetsov et al., 1998). A complex regulation ofmitochondrial transcripts and proteins, includingVDAC3, therefore takes place in mdx mouse muscle.The meaning of this phenomenon is still to be clari®ed.More information about the physiological role of

VDAC3 and new experimental tools, like anti-VDAC3Abs, are now required in order to de®ne the sub-cellular location of this isoform in di�erent tissues, andto ascertain VDAC3 protein regulation in normal anddefective cells.

Acknowledgements

We thank F. Thinnes (Gottingen, Germany) for thekind gift of the mAb2 and the T8 antibodies andM. Colombini (College Park, MD, USA) for helpfuldiscussion. The ®nancial support of Telethon-Italy toR.M. (grant no. 936) and to V.D.P. (grant no. 711) isgratefully acknowledged.

References

Adams V, Gri�n L, Towbin J, Gelb B, Worley K and McCabe ER

(1991) Porin interaction with hexokinase and glycerol kinase:

metabolic microcompartmentation at the outer mitochondrial

membrane. Biochem Med Metab Biol 45: 271±291.

An¯ous K, Blondel O, Bernard A, Khrestchatisky M and Ventura-

Clapier R (1998) Characterization of rat porin isoforms: cloning of

a cardiac type-3 variant encoding an additional methionine at its

putative N-terminal region. Biochim Biophys Acta 1399: 47±50.

Babel D, Walter G, Gotz H, Thinnes FP, Jurgens L, Konig U and

Hilschmann N (1991) Studies on human porin. VI. Production and

characterization of eight monoclonal mouse antibodies against the

human VDAC ``Porin 31HL'' and their application for histoto-

pological studies in human skeletal muscle. Biol Chem Hoppe

Seyler 372: 1027±1034.

Benz R, Kottke M and Brdiczka D (1990) The cationically selective

state of the mitochondrial outer membrane pore: a study with

intact mitochondria and reconstituted mitochondrial porin. Bio-

chim Biophys Acta 1022: 311±318.

Blachly-Dyson E, Zambronicz EB, Yu WH, Adams V, McCabe ER,

Adelman J, Colombini M and Forte M (1993) Cloning and

functional expression in yeast of two human isoforms of the outer

mitochondrial membrane channel, the voltage-dependent anion

channel. J Biol Chem 268: 1835±1841.

Blachly-Dyson E, Baldini A, Litt M, McCabe ER and Forte M (1994)

Human genes encoding the voltage-dependent anion channel

(VDAC) of the outer mitochondrial membrane: mapping and

identi®cation of two new isoforms. Genomics 20: 62±67.

Brdiczka D, Kaldis P and Wallimann T (1994) In vitro complex

formation between the octamer of mitochondrial creatine kinase

and porin. J Biol Chem 269: 27640±27644.

Buettner R, Papoutsoglou G, Scemes E, Spray DC and Dermietzel R

(2000) Evidence for secretory pathway localization of a voltage-

dependent anion channel isoform. Proc Natl Acad Sci USA 97:

3201±3206.

Castellani L, Reedy MC, Gauzzi MC, Provenzano C, Alema S and

Falcone G (1995) Maintenance of the di�erentiated state in

skeletal muscle: activation of v-Src disrupts sarcomeres in quail

myotubes. J Cell Biol 130: 871±885.

Chomczynski P and Sacchi N (1987) Single-step method of RNA

isolation by acid guanidinium thiocyanate-phenol-chloroform

extraction. Anal Biochem 162: 156±159.

Colombini M (1980) Structure and mode of action of a voltage

dependent anion-selective channel (VDAC) located in the outer

mitochondrial membrane. Ann NY Acad Sci 341: 552±563.

Crompton M (1999) The mitochondrial permeability transition pore

and its role in cell death. Biochem J 341: 233±249.

De Pinto V, Ludwig O, Krause J, Benz R and Palmieri F (1987) Porin

pores of mitochondrial outer membranes from high and low

441

eukaryotic cells: biochemical and biophysical characterization.

Biochim Biophys Acta 894: 109±119.

De Pinto V, Prezioso G, Thinnes F, Link TA and Palmieri F (1991)

Peptide-speci®c antibodies and proteases as probes of the trans-

membrane topology of the bovine heart mitochondrial porin.

Biochemistry 30: 10191±10200.

Dermietzel R, Hwang TK, Buettner R, Hofer A, Dotzler E, Kremer

M, Deutzmann R, Thinnes FP, Fishman GI and Spray DC (1994)

Cloning and in situ localization of a brain-derived porin that

constitutes a large-conductance anion channel in astrocytic plasma

membranes. Proc Natl Acad Sci USA 91: 499±503.

Even PC, Decrouy A and Chinet A (1994) Defective regulation of

energy metabolism in mdx-mouse skeletal muscles. Biochem J 304:

649±654.

Gannoun-Zaki L, Fournier-Bidoz S, Le Cam G, Chambon C,

Millasseau P, Leger JJ and Dechesne CA (1995) Down-regulation

of mitochondrial mRNAs in the mdx mouse model for Duchenne

muscular dystrophy. FEBS Lett 375: 268±272.

Glesby MJ, Rosenmann E, Nylen EG and Wrogemann K (1988)

Serum CK, calcium, magnesium, and oxidative phosphorylation in

mdx mouse muscular dystrophy. Muscle Nerve 11: 852±856.

Huizing M, Ruitenbeek W, Thinnes FP, DePinto V, Wendel U,

Trijbels FJ, Smit LM, ter Laak HJ and van den Heuvel LP (1996)

De®ciency of the voltage-dependent anion channel: a novel cause

of mitochondriopathy. Pediatr Res 39: 760±765.

Junankar PR, Dulhunty AF, Curtis SM, Pace SM and Thinnes FP

(1995) Porin-type 1 proteins in sarcoplasmic reticulum and

plasmalemma of striated muscle ®bres. J Muscle Res Cell Motil

16: 595±610.

Jurgens L, Kleineke J, Brdiczka D, Thinnes FP and Hilschmann N

(1995) Localization of type-1 porin channel (VDAC) in the

sarcoplasmatic reticulum. Biol Chem Hoppe Seyler 376: 685±689.

Kemp GJ, Manners DN, Clark JF, Bastin ME and Radda GK (1998)

Theoretical modelling of some spatial and temporal aspects of the

mitochondrion/creatine kinase/myo®bril system in muscle. Mol

Cell Biochem 184: 249±289.

Krolenko SA, AmosWB and Lucy JA (1995) Reversible vacuolation of

the transverse tubules of frog skeletal muscle: a confocal ¯uores-

cence microscopy study. J Muscle Res Cell Motil 16: 401±411.

Kuznetsov AV, Winkler K, Wiedemann FR, von Bossanyi P,

Dietzmann K and Kunz WS (1998) Impaired mitochondrial

oxidative phosphorylation in skeletal muscle of the dystrophin-

de®cient mdx mouse. Mol Cell Biochem 183: 87±96.

Leterrier JF, Rusakov DA, Nelson BD and Linden M (1994)

Interactions between brain mitochondria and cytoskeleton: evi-

dence for specialized outer membrane domains involved in the

association of cytoskeleton-associated proteins to mitochondria

in situ and in vitro. Microsc Res Tech 27: 233±261.

Lewis TM, Roberts ML and Bretag AH (1994) Immunolabelling for

VDAC, the mitochondrial voltage-dependent anion channel, on

sarcoplasmic reticulum from amphibian skeletal muscle. Neurosci

Lett 181: 83±86.

Linden M and Karlsson G (1996) Identi®cation of porin as a binding

site for MAP2. Biochem Biophys Res Commun 218: 833±836.

Liu MY and Colombini M (1992) Regulation of mitochondrial

respiration by controlling the permeability of the outer membrane

through the mitochondrial channel, VDAC. Biochim Biophys Acta

1098: 255±260.

Mannella CA (1986) Mitochondrial outer membrane channel (VDAC,

porin) two-dimensional crystals from Neurospora. Methods Enzy-

mol 125: 595±610.

Mannella CA (1990) Structural analysis of mitochondrial pores.

Experientia 46: 137±145.

Mannella CA (1992) The `ins' and `outs' of mitochondrial membrane

channels. Trends Biochem Sci 17: 315±320.

Massa R, Castellani L, Silvestri G, Sancesario G and Bernardi G

(1994) Dystrophin is not essential for the integrity of the

cytoskeleton. Acta Neuropathol (Berl ) 87: 377±384.

Massa R, Silvestri G, Zeng YC, Martorana A, Sancesario G and

Bernardi G (1997) Muscle regeneration in mdx mice: resistance to

repeated necrosis is compatible with myo®ber maturity. Basic Appl

Myol 7: 387±394.

Messina A, Oliva M, Rosato C, Huizing M, Ruitenbeek W, van den

Heuvel LP, Forte M, Rocchi M and De Pinto V (1999) Mapping of

the human Voltage-Dependent Anion Channel isoforms 1 and 2

reconsidered. Biochem Biophys Res Commun 255: 707±710.

Moon JI, Jung YW, Ko BH, De Pinto V, Jin I and Moon IS (1999)

Presence of a voltage-dependent anion channel 1 in the rat

postsynaptic density fraction. Neuroreport 10: 443±447.

Nakae Y, Stoward PJ, Shono M and Matsuzaki T (1999) Localisation

and quanti®cation of dehydrogenase activities in single muscle

®bers of mdx gastrocnemius. Histochem Cell Biol 112: 427±436.

Rahmani Z, Maunoury C and Siddiqui A (1998) Isolation of a novel

human voltage-dependent anion channel gene. Eur J Hum Genet 6:

337±340.

Sampson MJ, Lovell RS and Craigen WJ (1996a) Isolation, charac-

terization, and mapping of two mouse mitochondrial voltage-

dependent anion channel isoforms. Genomics 33: 283±288.

Sampson MJ, Lovell RS, Davison DB and Craigen WJ (1996b) A

novel mouse mitochondrial voltage-dependent anion channel gene

localizes to chromosome 8. Genomics 36: 192±196.

Sampson MJ, Ross L, Decker WK and Craigen WJ (1998) A novel

isoform of the mitochondrial outer membrane protein VDAC3 via

alternative splicing of a 3-base exon. Functional characteristics and

subcellular localization. J Biol Chem 273: 30482±30486.

Sha®r I, Feng W and Shoshan-Barmatz V (1998) Dicyclohexylcarbo-

diimide interaction with the voltage-dependent anion channel from

sarcoplasmic reticulum. Eur J Biochem 253: 627±636.

Shimizu S, Narita M and Tsujimoto Y (1999) Bcl-2 family proteins

regulate the release of apoptogenic cytochrome c by the mitoc-

hondrial channel VDAC. Nature 399: 483±487.

Shoshan-Barmatz V, Hadad N, Feng W, Sha®r I, Orr I, Varsanyi M

and Heilmeyer LM (1996) VDAC/porin is present in sarcoplasmic

reticulum from skeletal muscle. FEBS Lett 386: 205±210.

Terasaki M, Song J, Wong JR, Weiss MJ and Chen LB (1984)

Localization of endoplasmic reticulum in living and glutaralde-

hyde-®xed cells with ¯uorescent dyes. Cell 38: 101±108.

Thinnes FP, Gotz H, Kayser H, Benz R, Schmidt WE, Kratzin HD

and Hilschmann N (1989) Zur Kenntnis der Porine des Mens-

chen. I. Reinigung eines Porins aus menschlichen B-Lymphozyten

(Porin 31HL) und sein topochemischer Nachweis auf dem

Plasmalemm der Herkunftszelle. Biol Chem Hoppe Seyler 370:

1253±1264.

Winkelbach H, Walter G, Morys-Wortmann C, Paetzold G, Hesse D,

Zimmermann B, Florke H, Reymann S, Stadtmuller U and

Thinnes FP (1994) Studies on human porin. XII. Eight monoclonal

mouse anti-``porin 31HL'' antibodies discriminate type 1 and type

2 mammalian porin channels/VDACs in Western blotting and

enzyme-linked immunosorbent assays. Biochem Med Metab Biol

52: 120±127.

Wrogemann K and Pena SDJ (1976) Mitochondrial calcium overload:

a general mechanism for cell-necrosis in muscle diseases. Lancet 1:

672±674.

Wu S, Sampson MJ, Decker WK and Craigen WJ (1999) Each

mammalian mitochondrial outer membrane porin protein is

dispensable: e�ects on cellular respiration. Biochim Biophys Acta

1452: 68±78.

Xu X, Decker W, Sampson MJ, Craigen WJ and Colombini M (1999)

Mouse VDAC isoforms expressed in yeast: channel properties and

their roles in mitochondrial outer membrane permeability.

J Membr Biol 170: 89±102.

Yu WH, Wolfgang W and Forte M (1995) Subcellular localization of

human voltage-dependent anion channel isoforms. J Biol Chem

270: 13998±14006.

Yu WH and Forte M (1996) Is there VDAC in cell compartments

other than the mitochondria? J Bioenerg Biomembr 28: 93±100.

442