Intimate Partner ViolenceIntimate Partner Violenceand the Childand the Child--bearing Cycle:bearing Cycle:

Issues in Prevention and InterventionIssues in Prevention and Intervention

Patricia Janssen, PhDUBC School of Population and Public Health

Director, MPH programCo-lead Maternal Child Health Theme

Child and Family Research InstituteWomen’s Health Research Institute

BC Injury Prevention Conference 2010

Intimate Partner Violence

Any act of violence that results in or is likely to result in physical, sexual or psychological harm or suffering, including threats of such acts, coercion or arbitrary deprivation of liberty, whether occurring in public or in private life.

United Nations 1993 Declaration on the Elimination of Violence

Janssen et al, 2003

Adjusted RRs

Lipskey et al, 2003

Adj Odds Ratio

Kady et al,2005

Adj Odds RatioAntepartum Hemorrhage 3.79 (1.38-10.4)

1.8 (1.4-2.5)

Preterm Delivery 1.35 (0.67-2.56)

1.27 (0.48-3.37) 2.4 (1.8-3.3)

< 32 weeks 2.83 (0.94-8.50) IUGR 3.06 (1.02-9.14) Low birth weight

3.51 (1.27-9.72) 1.7 (1.5-1.9)

Perinatal Death 8.06 (1.42-45.63)

8.0 (4.6-14.3)

Neonatal Death

7.28 (1.28-42.3)

Physical Abuse and Adverse Fetal/Neonatal OutcomesPhysical Abuse and Adverse Fetal/Neonatal Outcomes

Vancouver Sun, March 12

In 2006-07, three pregnant or newly mothering women in the Lower Mainland of BC, were murdered by their husbands and a fourth was shot and critically injured.

Prevalence Prevalence

Maternity Experiences Survey

• Population-based survey• 6,421 women• Canadian birth mothers >15 years of age• Eight months postpartum • Living with their babies

Maternity Experiences Survey

Questions on abuse adapted form the Canadian National Violence Against Women Survey (2003).

In the last two years has anyone ever….– Slapped, kicked, bit, hit, beaten, choked, used or

threatened a gun, knife, forced unwanted sexual activity ?

– Hit with anything, thrown anything, pushed, grabbed or shoved in a way that could have hurt you?

• Overall, 10.9% of the sample reported experiencing any one of these abuses by partners (5.7%), family (1.8%), friends (1.4%), or strangers/other (2.3%)

• Only 3.3% were exposed during pregnancy.

Maternity Experiences Survey

Children as Witness

The 2004 Canadian General Social Survey reports that 394,000 spousal violence victims reported that children saw or heard the violence. One third of all incidents of spousal violence involve children

Impact Impact

Physical Abuse During PregnancyStewart and Cecutti, CMAJ, 1993

•6.6% of 548 women abused during pregnancy

•Abuse associated with:•Unwanted/unplanned pregnancy•Increased parity•Loss of control over health of pregnancy/fetus•“Chance” played the most important role in the

outcome of pregnancy•Postpartum depression – 69%

The impact of domestic violence on the bonding process between mother and child

Zeitlin et al. 1999 Arch Women’s Mental Health

0

10

20

30

40

50

60

70

M-Fetal* M-Infant** PP Depression**

AbusedControl

* = p<.05 ** = p<.0001

Hig

her s

core

= n

egat

ive

bond

ing

Infant Development and Developmental Risk,Zeahnah et al, J Am Acad Child and Adolesc Psychiat, 1997

MaternalDepression

Insecure attachment

Social Competence

Language and Cognitive Problems

Depression in offspring

Children who Witness

• 20% meet criteria for PTSD ( Mertin et al, 2002)

• 60-75% are physically abused (Osofsky, review)

• Clinical behavioral problems more common in

26- 75% ( 8 studies)

Infants

• Disrupted sleeping and feeding routines with poor weight gain

• Excessive screaming

• Developmentally delayed

• Separation anxiety

Preschoolers

• Withdrawn, subdued or mute behaviour

• Exhibit anxiety and clinging behaviour

• Nightmares

• Regressive behaviour such as bed-wetting and thumb-sucking

• Attention deficit and hyperactivity disorders

School Age

• Poor school performance

• Aggressive behaviour

• Moodiness

• Vague somatic complaints

• Obsessive compulsive disorders

Adolescents

• School dropout or absenteeism

• Poor impulse control

• Use of substances

• Leaving home

• Feelings of guilt

Risk of Crime Victimization among Youth Exposed to Domestic Violence

Mitchell et al., J Interpers Viol 2001

0

2

4

6

8

10

12

14

DomesticViolence

Non-domesticViolence

No Crime

Any victimizationViolent victimization

Risk of victimization 115% higher for boys and 229% higher for girls

%

Longitudinal Effect of Intimate Partner Abuse on High-Risk Behavior Among Adolescents (11-22 yrs)

Roberts et al.Arch Pediatr Adolesc Med 2003

• IPV – 273/2236 males (12.2%)- 302/2206 females (13.7%)

• Abuse by an intimate partner precedes involvement in:– illicit substance use– antisocial behavior– violent behavior– suicidal behavior – depression

• Controlled for SES, # partners, baseline risk behavior, prior abuse.

What causes violent behaviour?

• Learned by witnessing violence

• Cultural belief in a status that is central and deserving.

• Effective means of maintaining control

• Failure of the criminal justice system to make the perpetrator accountable by charging and prosecuting

• Genetics: Nr2e1, MaoA.

Genetics of Aggressive Behaviour: Monoamine System Analyses

James L. Kennedy MD FRCPCHead, Neurogenetics Section,

Centre for Addiction and Mental Health;I’Anson Professor of Psychiatry and Medical Science, University of Toronto

& J Beitchman, S Ehtesham, H Mik, D Bender, G Subramanian

Serotonin Transporter Gene Structure

5

VNTR

3AP1

SP1 AP1

SP1

AP2

TATA

Exon I XIV

44 bp

ins / del

aaaaaaagaataaaacatgcagcccccccagcatataaatgca

II

5HTTLPR

NB 5HTTLPR is functional: l/l assoc. with 2x ↑ expression than l/s or s/s

Level of Callous-Unemotional Traits in aggressive children vs 5HTT VNTR genotype

12/12 10/12 10/10

A.R. Hariri, V.S. Mattay, A. Tessitore, B. Kolachana, F. Fera, D. Goldman, M.F. Egan, D.R. Weinberger. Science, 297: 400-403 (2002).

Serotonin Transporter Genetic Variation and the Response of the Human Amygdala

Individuals carrying the s variant of the 5HTTLPR exhibit an increased amygdala response to fearful stimuli when compared to those carrying the lvariant.

Sheard M, et al. 1976

Effect of Lithium on Aggressionin Prison Inmates

DrugFree

DrugFree

Medication

Months

Mean

I nfra

c tio

n s P

e r M

o nth

1 2 3 4 50.0

0.1

0.2

0.3

0.4

0.5

0.6

Assessment Assessment

For patient's nurse to complete prior to discharge. Please ask to spend a few minutes alone with your patient. If you need a translator, please do not use a family member.

Please see reverse for Chinese translation, Punjabi and Vietnamese versions are in the domestic violence binders in the modules.

Introduction:As health care providers we know that family violence affects women’s health.

Because of the widespread problem of family violence, it is routine in this hospital to ask everyone these questions.

Question:Since you've been pregnant, have you been hit, slapped, kicked or otherwise

physically hurt by an intimate partner? Yes ____ No ____

Have you been afraid of a current or former intimate partner during your pregnancy?

Yes ____ No ____

Prior to your pregnancy, was your partner hurting you ?Yes ____ No ____ making you afraid?Yes ____ No ____

*************************************************************1. Provide safety planning if any answer is "yes". 2. Refer to a social worker if women would like one. (Guidelines for referral to

social workers are located in the Domestic Violence Binder in every module.)3. Offer her a community resources card. (in patient bathrooms, Chinese cards in

Domestic Violence Binders). 4. Document above interventions(1- 3) in progress notes.

Are people willing to be asked?Are people willing to be asked?

Bacchus, BJOG 2002• Yes, if safe, confidential, health professional is trained,

empathic, and non-judgmental. (Qualitative design)

Rodriguez, J Fam Pract 2001• Yes, if direct (qualitative)

Friedman, Arch Intern Med 1992• Routine inquiry favoured by 78% of primary care patients;

90% believed physician could help (Survey)

McNutt, L. JAMWA, 1999• 88% of shelter residents advocated routine screening

Will they act on offers of help?Will they act on offers of help?

Kresnoff, M. Injury Prevention, 2002• Among 528 women identified as intimate partner victims in emergency

departments, 84% agreed to see an advocate and 54% of those accepted case management. Among these, 50% remained free after 6weeks.

A Little Contact Makes A Big Difference

One night at a shelter significantly decreased abuse with or without 10-wk advocacy program.

Sullivan et al, 1999

Safety Planning

Help her make a plan for the next time:

•Who will she call?•Where can she go?•Emergency bag outside the house

• Cash, credit card, driver’s license, passports, birth certificate, immigration papers, care card, phone numbers, care keys and gas

• Copy of protective orders, custody papers

• Take the children•Stay between him and the door•Hide weapons

McFarlane et al. An Intervention to Increase Safety Behaviors of Abused Women Nurs Res 2002;51:347-345

DesignRCT

SettingTexas, n = 150, women seeking protection orders

ProtocolSix 10 min phone sessions on safety planning vs.usual care. Menu of 15 safety behaviors discussed

Safety Behavior Adoption Over 8-wks

10.4

11.5

12.6

13.2

13.6 13.713.9

10

11

12

13

14

INTAKE

48HR

1WK

2WK

3WK

5WK

8WK

SAFETY BEHAVIORS OVER 18-MONTHS

10.4

12.5

12 11.9 12

9.69.9

10.410.6 10.5

9

10

11

12

13

INTAKE

3-MOS

6-MOS

12-M

OS

18-M

OS

NU

MB

ER

OF

BE

HA

VIO

RS

RX

NORX

McFarlane et al. JAMA

DesignRCT

SettingTexas, N = 360, English and Spanish-speaking women attending primary care clinics

ProtocolNurse case manager: 20 minute session on safety behaviors, support, and listeningResource card

vs. Screening and resource card

Results at six months

Safety behaviors Sig. more safety behaviors for case management group, p =.03

Threats and assault Lower for both groups, p<.001(10 threats less, 12 assaults less)

Danger for lethal assault Lower for both groups p<.001

A successful assessment means you have

•Acknowledged the problem•Validated the victim’s experience•Stated that they are not to blame•Assessed safety needs•Asked about safety of children•Offered help•Documented

Prediction of Repeat Visits by Victims of Intimate Partner Violence to Emergency

Departments in Vancouver, BC

Patricia A Janssen, PhD1,3,4 Kathleen Mackay, MSW 2,5,6

School of Population and Public Health1 and Surgery2, Faculty of Medicine, School of Nursing3 University of British Columbia, B.C.,

Child and Family Research Institute 4, Vancouver Coastal Health,5Providence Health Care,6 Vancouver, B.C.,

Repeaters (VGH, n = 317)50 patients (5-10 visits each) 250 visits in total

Drug overdose 13 (26%)Alcohol intoxication 7 (14%)Psychological problems 6 (12%)Suicide attempt/ideation 5 (10%)Infections 16 (32%)Lacerations/contusions 20 (40%)Fractures 12 (24%)Pain 11 (22%)Burns 1 (2%)Trauma 4 (8%)

Repeaters (VGH)50 patients (11-20 visits each) 450 visits in total

Drug overdose 8 (17.7%)Alcohol intoxication 12 (26.6%)Psychological problems 12 (26.6%)Suicide attempt/ideation 4 (9%)Infections 20 (44.4%)Lacerations/contusions 25 (55.5%)Fractures 10 (22.2%)Pain 15 (33.3%)Burns 1 (2%)Trauma 4 (9%)

Repeaters (VGH)25 patients (>20 visits each) 500 visits in total

Disclosed violence on 1.5 visits

Drug overdose 16 (64%)Alcohol intoxication 12 (25%)Psychological problems 8 (32%)Suicide attempt/ideation 3 (12%)Infections 14 (56%)Lacerations/contusions 9 (36%)Fractures 4 (16%)Pain 5 (20%)Burns 1 (4%)

Treatment and InterventionTreatment and Intervention

Parent-Child Therapy

• Teaching attachment – warmth mutuality, empathy.

• Avoid role reversal, enmeshment, overprotectiveness, and attributing negative qualities of the spouse to the child.

Key Message Key Message

The problem belongs to the parents – it is not the child’s fault.

Absolution from blame.

The Worry Jar

The 4th R – Reading, “Riting,” “Rithmatic”and RelationshipsRelationships

• School-based program aimed at bullying, peer and dating violence.

• Emphasizes knowledge, positive relationship skills and decision-making.

• Use role play to develop solutions, trying responses, responding in the presence of others, responding in the face of resistance.

• Staff and teacher awareness education and involvement by peer-led groups

• Evaluated in a randomized controlled trial.- skill acquisition with actors and blinded raters.

Community Interventions:

• Can bring people together

• Make changes more quickly

• Measure the problem and evaluate change

• Address social norms• Build cultural identity• Share information• Target resources

Who can help with prevention ?The teacherThe veterinarianThe local newspaperThe dentistThe community centreThe churchThe neighbourThe taxi driverThe bus driverThe landlordThe social assistance worker

In addition to the nurse, doctor and police officer,,,,

The Way Forward

1. Public awareness and leadership2. Education (especially youth):

• Conflict resolution• Substance abuse• Identity• Skill training

3. Health care• Assessment • Safety Planning and Referral• Ongoing Surveillance

4. Municipal• Emergency/transition housing• Emergency transportation• Emergency funds

The Way Forward

• Develop methods for local surveillance

– Routine screening at well woman/maternity/pediatric care– Understand risk factors and assess risk– Maternal mortality review

• Study and evaluate interventions

– Information for new immigrants– Consistent interactive action-oriented training for adolescent– Emergency housing– Emergency rooms as public health agencies

Keep mothers safe, babies safe, children, safe

On release from ACCW, women are met at the bus stop and invited to learn about the study, and, if interested sign a consent form.

They then have a baseline interview with a community-based researcher, that is, a women trained in interviewing who herself has had experience with incarceration.

Methods

Women are asked about their health, education, job skills, family, support, housing and other issues in accordance with the nine health goals.

The community-based researcher will contact the participants for follow-up interviews at 3, 6, 9 and 12 months.

Evaluation of the Mobile Access Project (MAP)P Janssen,PhD, UBC Health Care & Epidemiology and Child and Family Research Institute,

P Spittal, UBC Health Care & Epidemiology and Centre of Excellence, HIV/AIDS

K. Gibson, WISH, R. Bowen, PACE

Safety

• 16% of women interviewed could recall a specific incident when the van had prevented them from being injured.

• 10% of women could remember a specific time when the van had prevented them from being sexually assaulted.

Low Threshold Interventions

• Add stuff from Surrey• Add stuff from coroner’s grant • Get report on severe morbidity and

mortality• Richmond – not during preg, pp• New prison findings

Health and Use of Health Services of Children Exposed to Violence in their Families

Onyskiw, J. 2002, Can J Public Health

0

5

10

15

20

25

30

GP Peds OtherMD

PHN Dentist Childwelfare

Px

WitnessNon-Witness%

Behaviors of Children exposed to IPV Before and1 Year After a Treatment Program for Their Mother –

McFarlane et al, 2005.

What is “treatment”? - Mother-centered

• Reinforcing consistent mothering to minimize aggression and oppositional behaviour

• Authoritative parenting – high levels of both warmth and structure

• Reinforcing perception of maternal efficacy – acts as a buffer against the development of poor self esteem.

What is “treatment”? - Child-centered

• Teaching child coping behaviours increases appraisals of self-efficacy – Need affirmations, not being told what not to do.

• Child safety planning – calling 911, having a safe hiding place, running to a trusted person for help

• Calming behavours (emotion-focused coping) can buffer children from conflict – listening to music, writing in a diary, spending time with friends.

Relationship violence

Dating violence

Emotional/ Psychological Violence

http://www.nwac-hg.org

Risk Risk Outcome Change process

Protective Outcome

Self blame, stigma, hopelessness

Depression Boundary maintenance, absolution from blame, Identification of family strengths

Affirmation of family

Emotional insecurity, perceived threat, maternal distress

Anxiety Maternal social support, maternal empowerment

Perceived ability of mother to cope, maternal efficacy, well-being

Unregulated distress, denial and numbing

PTSD Affect regulation skills, therapeutic re-exposure

Mastery of affect expression,emotional regulation

Maternal blame, spill over

Aggression, intergenerational transmission of violence

Positive appraisals of mother, positive maternal-child relations

Empathic mutuality,,boundary maintenance

Protective Processes Kerig, 2003

Incidence Rate in Non-

injured/1000

Incidence Rate for Prenatal

Assault/1000 Preterm Delivery 96.9 152 Low birth weight 57.9 133.5 Fetal Death 5.0 8.9 Neonatal Death 6.8 12.8 Infant Death 9.0 19.6

Physical Abuse and Rates of Adverse Physical Abuse and Rates of Adverse Fetal/Neonatal OutcomesFetal/Neonatal OutcomesKady et al.Kady et al.

Prevalence Prevalence