International Journal of Entomology

24/4/2018 Editorial Board | International Journal of Entomology Research

http://www.entomologyjournals.com/board 1/9

Search SEARCH

ISSN:2455-4758

InternationalJournalofEntomologyResearch

HOME EDITORIAL BOARD ARCHIVES INSTRUCTIONS MEMBERSHIP INDEXING CONTACT US

SIDEBAR

Home

Editorial Board

Archives

Instructions

Indexing andAbstracting

Contact Us

Publication Ethics

CERTIFICATE

UGCApprovedJournal

EditorialBoard

EDITOR-IN-CHIEF

Dr. B. S. Chandel (M.Sc., Ph.D., D.Sc. (Zoology-Entomology) FESI,FSLSc., FSESc., IAES, FANSF, SPPS. FAEB) Associate Professor & Head Biopesticides and Toxicological Laboratory, Department of Zoology,D.B.S. College, A�liated to CSJM University, Kanpur, India

ASSOCIATE EDITORS

Dr. Surya Prakash Mishra (Ph.D., .Z.S.I., F.A.I.R., F.I.A.E.S., F.S.L.Sc.) Associate Professor and Head, P.G. Department of Zoology, Ganpat Sahai P.G. College, Sultanpur,Uttar Pradesh, India

Rouhollah Radjabi (Ph.D.) Researcher Plant Protection Department, Agricultural Faculty, Islamic AzadUniversity, Dezful Branch, Dezful, Iran

Dr. Saroj Kumar Ghosh (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Bejoy Narayan Mahavidyalaya, Itachuna,Hooghly, West Bengal, India

Dr. Abhishek Shukla (Ph.D.) Senior Acarologist and Associate Professor Department of Entomology Navsari Agricultural University, Navsari,Gujarat, India

Neeraj Kumar Sharma (Ph. D.) Department of Zoology, H.N.B Garhwal University, Tehri GarhwalUttarakhand, India

Dr. (Mrs.) Ranjana Saxena (M. Sc., Ph.D.) Associate Professor Dyal Singh College, University of Delhi, Delhi, India

Dr. Hany M. R. Abdel-Latif ((DVM, MVSc, PhD) Lecturer of Fish diseases Department of Poultry and Fish diseases, Faculty of Veterinarymedicine, Alexandria University Ed�na, Behera province, Egypt

Syed Ishtiaq Anjum (Ph.D.) Lecturer Department of Zoology, Kohat University of Science and Technology,Kohat-26000, Khyber Pakhtunkhwa, Pakistan

Dr. Nayan Roy (M. Sc., Ph.D.) Assistant Professor MUC Women’s College, Department of Zoology, West Bengal, India

Instructions to Reviewer Click Here

Online and PrintJournal

Indexed Journal

Refereed Journal

Peer Reviewed Journal

SUBMIT YOURARTICLE AT

[email protected]

INDEXED IN

JOIN EDITORIALBOARD

Journals List

Research Journals

http://www.entomologyjournals.com/


http://www.entomologyjournals.com/board

http://www.entomologyjournals.com/archives/

http://www.entomologyjournals.com/instructions

http://www.entomologyjournals.com/membership

http://www.entomologyjournals.com/indexing

http://www.entomologyjournals.com/contact







http://www.entomologyjournals.com/Publication_Ethics_Malpractice_Statement

http://www.ugc.ac.in/journallist/ugc_admin_journal_report.aspx?eid=NDU5ODM=

http://www.entomologyjournals.com/instructions-to-reviewer

https://journals.indexcopernicus.com/search/details?id=47263

http://www.entomologyjournals.com/ApplyforBoardMember

http://www.indianjournal.in/



Dr. Semra BENZER Assistant Professor Education Faculty, Gazi University, Ankara, Turkey

Dr. Deepak Sumbria (Ph.D.) Teaching Associate Department of Veterinary Parasitology Post-Graduate Institute ofVeterinary Education and Research jaipur, Rajasthan, India

Prof. Dr. Muhammad Faheem Malik (M. Sc., Ph.D.) Dean (Director) of Faculty of Sciences University of Gujrat, Ha�z Hayat Campus, Gujrat, Pakistan

Dr. R. Raveen (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Madras Christian College, Chennai, TamilNadu, India

Hameed Ur Rehman Researcher Department of Chemistry, Kohat University of Science andTechnology, Khyber Pakhtunkhwa, Pakistan

Dr. Selçuk Altınsaçlı (M. Sc., Ph.D.) Faculty of Fisheries, İstanbul University, Istanbul, Turkey

Dr. Amit Tomar (M.Sc. Botany, Ph.D., F.L.S. London, D.Sc.) Assistant Professor Department of Botany Meerut College, Meerut, Uttar Pradesh, India

Dr. Buddhadeb Manna (M. Sc., Ph.D.) Professor, Department of Zoology, University of Calcutta, India

Mandakini Singla (Ph.D.) Lecturer Govt Science College, Jagraon, Punjab, India

Dr. Meera Srivastava (M. Sc., Ph.D.) Head, PG Department of Zoology Govt. Dungar College, Bikaner, Rajasthan,India

Dr.abid Farid (M. Sc., Ph.D.) Associate Professor/Head, Department of Agriculture, University of Haripur, Haripur, Pakistan

Dr. Alexander V. Ilyinykh (Ph.D., D.Sc.,) Institute of Systematics and Ecology of Animals SB PAS, Novosibirsk,Russia

Prof. Dr. Naim Saglam (M. Sc., M.A., Ph.D.) Department of Aquaculture and Fish Diseases, Faculty of Fisheries,Firat University, Turkey

Prof. Dr. Ahmad-Ur-Rahman Saljoqi (M. Sc., Ph.D.) Professor, Department of Plant Protection, The University of Agriculture,Peshawar, Pakistan

Prof. Dr. Emel Ergun (Ph.D.) Department of Histology and Embryology, Faculty of VeterinaryMedicine, Ankara University, Turkey

Journals List

Research Journals




Dr. R.a. Tripathi Professor (Retd.), Division of Entomology, C.S. Azad University of Agriculture andTechenology, Kanpur, Uttar Pradesh, India

Prof. Dr. Bilal Dik (D.M.V., Ph.D.) Department of Parasitology, Selcuk University, Turkey

Prof. Bhaweshwar Singh (M. Sc., Ph.D.) Prof-in-Charge, Gerontology, University Department of Zoology, L.N. Mithila University,Darbhanga, India

Prof. C.p.m Tripathi Head, Department of Zoology, D.D.U. University of Gorakhpur, Gorakhpur,India

Prof. Abdurasulov Yrysbek (Ph.D.) Consultant, FAO National Farm Animal Genetic Resources of Kyrgyzstan,Kyrgyzstan

Assoc. Prof. Dr. Mustafa Garip (D.V.M., Ph.D.) Division of Animal Nutrition and Zootechnics, Faculty of VeterinaryMedicine, Selcuk University, Turkey

Prof. Dr. Svetlana G. Nesterova (Ph.D.) Department of Biodiversity and Bioresources, Faculty of Biology andBiotechnology, Al-Farabi Kazakh National University, Kazakhstan

Dr. J.p. Shukla Head, Department of Zoology, Shiv Harsh Kisan P.G. College, Basti, India

Dr. Ravneet Kaur Division of Entomology, Punjabi University, Patiala, Punjab, India

Prof. S.c. Joshi Department of Zoology, Rajasthan University Jaipur, Jaipur, Rajasthan,India

Prof. Nogoybayev Mukambetov Daiyrovich Head, Head of the Department of Internal Medicine Animals, Kyrgyz NationalAgrarian University, Kyrgyzstan

Dr. Oguzhan Avci Department of Virology, Faculty of Veterinary, Medicine, University ofSelcuk, Turkey

Dr. Ashish Tripathi (M.Sc., Ph.D., F.I.S.C.A.) P.G. Department of Zoology and Entomology, Janta College Bakewar,Etawah, Uttar Pradesh, India

Dr. Varuna Verma (M.Sc., Ph.D.) Environmental Engineering, Geetanjali Institute of Technical Studies,Dabok, Udaipur, India

Dr. Matiyar Rahaman Khan (M.Sc., Ph.D.) Associate Professor AICRP (Nematode), Directorate of Research/Department of AgrilEntomology, Bidhan Chandra Krishi Viswavidyalaya, Kalyani, Nadia,

Journals List

Research Journals




West Bengal, India

Dr. Samuel Tennyson (M.Sc., Ph.D.) Assistant Professor, Department of Zoology, Madras Christian College, Chennai, TamilNadu, India

Dr. S. Arivoli (M.Sc., M.Phil, Ph.D.) Assistant Professor, Department of Zoology, Thiruvalluvar University, Vellore, Tamil Nadu,India

Assoc. Prof. Dr. Ali Satar (M.Sc., Ph.D.) Dicle University Department of Biology, Diyarbakır, Turkey

Dr. Md. Abdur Rashid (M.Sc., Ph.D.) Genetics and Molecular Biology Lab. Department of Zoology,University of Dhaka, Bangladesh

Dr. Jainder Singh Chhilar (M.Sc., Ph.D., P.G.D.B.I.) Assistant Professor, Department of Zoology, Pt CLS Government PG College, Karnal,Haryana, India

Asist. Prof. Dr. M. Yeşim çelik (M.Sc., Ph.D.) Department of Aquaculture, Sinop University, Turkey

Dr. Melek Zeybek (Ph.D.) Department of Biology. Süleyman Demirel University, Turkey

Dr. Shivaji Bhagwan Ubarhande (M.Sc., Ph.D.) Head, Department of Zoology, Rajarshi Shahu Arts, Commerce and ScienceCollege, Pathri Phulambri, Aurangabad, India

Dr. Meral Apaydın Yağcı (Ph.D.) Fisheries Engineer Fisheries Research Station, Eğirdir-Isparta, Turkey

Dr. B. N. Pandey (M.Sc., Ph.D.) P.G.Department of Zoology. Purnea College, Purnia, Bihar, India

Dr. Sanjay Shamrao Nanware (M.Sc., Ph.D., F.H.S.I.,F.S.L.Sc.,F.Z.S.I.,F.I.A.S.N.) Assistant Professor, Post Graduate Department of Zoology, Yeshwant Mahavidyalaya,Nanded, Maharashtra, India

Dr. Dhanraj Balbhim Bhure (M.Sc., Ph.D.) Assistant Professor, Post Graduate Department of Zoology, Yeshwant Mahavidyalaya,Nanded, Maharashtra, India

Dr. Sebastian C. D. (M.Sc., Ph.D.) Associate Professor, Department of Zoology Director, School of Health Sciences Universityof Calicut, Kerala, India

Dr. Omer Kucuk (M.Sc., Ph.D.) Chamber of forest Engineer, Society of Kastamonu University, Turkey

Journals List

Research Journals




Dr. P.k. Mittal (M. Sc., Ph.D.) Scientist National Institute of Malaria Research, New Delhi, India

Prof. Tinatin Doolotkeldieva (M. Sc., Ph.D.) Head and Prof. of Plant Protection Department, Agriculture Faculty, Kyrgyz-Turkish Manas University,Kyrgyzstan

Dr. Sarwan Kumar (M.Sc., Ph.D.) Assistant Entomologist (Oilseeds), Department of Plant Breeding and Genetics, Punjab AgriculturalUniversity, Ludhiana, Punjab, India

Dr. Mamata Kumari (M.Sc., Ph.D.) Ramdayalusingh College, B.R.A. Bihar University, Muzaffarpur, Bihar,Indian

Dr. M. Serajuddin (M.Sc., Ph.D.) Associate Professor, Department of Zoology, University of Lucknow, Lucknow, India

Associate. Prof. Dr. Hasan Kalyoncu (M.Sc., Ph.D.) Faculty of Art and Science, Departmant of Biology, University of Süleyman Demirel, Isparta,Turkey

Dr. S. Rajashekara (M.Sc., Ph.D.) Centre for Applied Genetics, Department of Zoology, Jnana BharathiCampus, Bangalore University, Bengaluru, Karnataka, India

Dr. Muhammad Zubair (M.Sc., Ph.D.) Lecturer (currently on study leave), Faculty of Veterinary and Animal Science,The Univeristy of Poonch, Rawalakot, Azad Jammu & Kashmir,Pakistan

Dr. Hassan Nasirian (M.Sc., Ph.D.) Department of Medical Entomology and Vector Control, School ofPublic Health, Tehran University of Medical Sciences, Tehran, Iran

Prof. Poduri Nagaraja Rao (M.Sc., Ph.D., FPPAI., FSPPS.,FAEB.,FAZRA,) Professor of Zoology, Department of Zoology, Osmania University, India

Dr. Youssef Dewer (M.Sc., Ph.D.) Department of Biological Chemistry and Crop Protection, RothamstedResearch, Harpenden, United Kingdom

Dr.El-Sayed Abdel-Malek El-Sheikh (M.Sc., Ph.D.) Associate Prof. Associate Prof. of Pesticides Biotechnology and Toxicology, Facultyof Agriculture, Zagazig University, Egypt

Dr. Soad I. Abd El-Razak Ramadan (M.Sc., Ph.D.) Plant Protection Research Institute, Agricultural Research Center,Sabahia, Baccous, Alexandria, Egypt

Dr. Pratibha Menon (M.Sc., Ph.D.) Division of Entomology, Indian Agricultural Research Institute, Delhi,India

Prof. Dr Mou�d Yassine (Ph.D.) Tishreen university, Latakia, Syria

Journals List

Research Journals




Dr. Muhammad Saeed Assistant Professor Department of Agriculture, University of Haripur, Khyber Pakhtunkhwa,Pakistan

Dr. Ali Darvishzadeh (M. Sc., Ph.D.) Department of Plant Protection, College of Agriculture and NaturalResources, University of Tehran, Karaj, Alborz, Iran

Prof. Dr. Uğur Uslu (M. Sc., Ph.D.) Vice Dean Selcuk Universite, Veterinary Medicine Parasitology Department,Kampus-Konya, Turkey

Dr. Y. Norma-Rashid (Ph.D.) Professor, Ecology & Biodiversity Programme, Institute of Biological Sciences,Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia

Dr. Dushyant Mishra (Ph.D.) Research Associate, Department of Molecular and Cellular Medicine, Reynolds MedicalBldg. Texas A&M Health Science Center, College Station, Texas, USA

Dr. Jayaprada Rao Chunduri (M.Sc., M.Phil., Ph.D., PGDB) Assistant Professor, Biotechnology Department, Mithibai College of Arts, Chauhan Instituteof Science and AJ college of commerce and economics (A�td. toMUMBAI university), Vile Parle(W), Mumbai, India

Dr. Showket Ahmad Dar (Ph.D.) Sher e Kashmir University of Agricultural Sciences and TechnologyKashmir, Shalimar, Srinager, India

Mukesh Kumar Chaubey (Ph.D) Assistant Professor Department of Zoology, Mahatma Gandhi Post Graduate College,Gorakhpur, Uttar Pradesh, India

Luis Carlos Martínez (Ph.D) Researcher Department of Entomology, Universidade Federal De Viçosa, MinasGerais, Brazil

Bolormaa Ganbaatar (Master) P.o.b 53/15. Institute of Plant Protection, Ub. Khan-uul, Zaisan, Ulaanbaatar,Mongolia

Dr. Kalim Shaikh (M.Sc, B.Ed, Ph.D(Zoology)) Assistant Professor Poona College of Arts, Science & Commerce New, Modikhana Camp,Pune, Maharashtra, India

Grace Beena Paul (M.sc, B.Ed, Ph.D) Editorial Board Member Department of Zoology, St.pious X Degree & Pg College Fr Women,Hyderabad, Telangana, India

Dr. Nitin Kulkarni (Ph.D) Scientist G

Journals List

Research Journals




Forest Entomology Division, Tropical Forest Research Institute,Jabalpur, Madhya Pradesh, India

Dr. Rajendra Kumar Kalyan (M.Sc.(Ag. Ento.), Ph.D.(Ento)) Assistant Professor(entomology) Agricultural Research Station-borwat Farm, Maharan Pratap Universityof Agriculture & Technology-udaipur, Banswara, Rajasthan, India

Dr. G. Ramkumar (M.Sc., Ph.D) Research Scientist Department of Biotechnology, Periyar University, Salem, Tamil Nadu,India

Dr. Lingathurai (M.Sc., M.Phil., Ph.D) Assistant Professor Department of Biotechnology, Madura College, Madurai, Tamil Nadu,India

Dr. A. Prakasam (M.Sc., M.Phil., M.B.A., Ph.D) Assistant Professor Department of Physics, Thiruvalluvar Government Arts College,Namakkal, Tamil Nadu, India

Dr. Fazil Hasan (Ph.D., Post Doc.) Post Doctoral Division of Entomology, icar-indian Agricultural Research Institute,New Delhi, Delhi, India

Dr. Prabhakar ramchandra pawar (M.Sc. Ph.D) Vice-principal & Head Department of Zoology, Veer Wajekar Arts Science and CommerceCollege, Navi Mumbai, Maharashtra, India

Dr. A. Najitha Banu (Ph.D) Assistant Professor Department of Zoology, School of Bioengineering and Biosciences,Lovely Professional University, Punjab, India

Dr. Snehangsu Sinha (BVSc, MVSc, NET, D.Tech, PD.Tech) Teaching Associate Department of Anatomy, College of Veterinary Science, Guwahati,Assam, India

Dr. C. V. Sreeranjitkumar (MSc., MPhil, PhD, PDF) Associate Professor Head of Department, P. G and Research Department of Zoology, Govt.Victoria College, Palakkad, Kerala, India

Dr. Partha Pratim Chakravorty (M.Sc., PhD, FZS) Associate Professor & Head Post Graduate Department of Zoology, Raja N. L. Khan Women &College, Gope Palace, Vidyasagar University, Midnapore, West Bengal,India

Dr. Manish Sharma (MSc, MPhil, PhD) Assistant Professor in Zoology PG Department of Agriculture, General Shivdev Singh DiwanGurbachan Singh Khalsa College, Patiala, Punjab, Patiala, Punjab,India

Dr. Angsuman Chanda (M. Sc., Ph. D.) Associate Professor

Journals List

Research Journals




PG Department of Zoology, Raja N. L. Khan Women & College,Medinipur, Paschim Medinipur, West Bengal, India

Dr. Kathirvelu Baskar (Ph.D Entomology) Senior Scientist Optimurz Biotechnology Internships Training Chennai, Shenoy NagarWest, Chennai, Tamil Nadu, India

Dr. Ankush M. Raut (Ph.D) Assistant Professor Department of Plant Protection, School of Agriculture, LovelyProfessional University, Jalandhar, Punjab, India

ASSISTANT EDITORS

Tamizhazhagan (M.Sc., B.Ed., M.Phil., Ph.D.,) Researcher Department of Zoology, Annamalai University, Chidambaram, TamilNadu, India

ASSISTANT EDITOR

Haseeb Jan (M.Sc(Hons) Entomology) Researcher in Acarology Laboratory Department of Entomology University of Agriculture, Faisalabad,Pakistan

Dr. Sameera Siraj (Ph.D) Assistant Professor Department of zoology, S. P. college Srinagar, Cluster universitysrinagar, Srinagar, Jammu and Kashmir, India

Dr Priyankar Sanphui (M.Sc, Ph.D) Assistant Professor Department of Zoology, Sree Chaitanya College, West Bengal, India

Shivashankara (M.Sc., Ph.D) Department of Entomology, Colleage of Agriculture, G. B. PantUniversity of Agriculture and Technology, Pantnagar, Uttarakhand,India

Ramesh Singh Yadav (M.Sc. NET) Assistant Teacher Govt School Dehariya, Zamaniya, Ghazipur, Uttar, Pradesh, India

Mainak Bhattacharyya (M.Sc., B.Ed, Ph.D) Department of Agricultural Entomology, Bidhan Chandra KrishiViswavidyalaya, Mohanpur, Nadia, West Bengal, India

Dr. Jitendar Kumar Sharma (Ph.D) Assistant Professor Department of Plant Pathology, School of Agriculture, Rai University,Ahmedabad, Gujarat, India

G. Dineshkumar (M.Sc.,M.Phil.,(Ph.D)) Department of Zoology, Biotechnologya V. Vm Sri Pushpam College(Autonomous) Poondi, Thanjavur, Tamilnadu, India

Dr. Shabir Ahmad Bhat (Ph.d) Assistant Professor

Journals List

Research Journals




Junior Scientist (SS), Temperate Sericulture Reserach Institute,Mirgund SKUAST, Jammu and Kashmir, India Email: [email protected] Phone: 08803343509

ASSOCIATE EDITOR

Dr. Sudhakar Gupta (M.Sc. Ph.D.) Associate Professor Department of Zoology, Suraj Degree (PG) College, Mahendergarh,Haryana, India

Dr. Abdul Rasheed War (Ph.D) Scientist World Vegetable Centre-South Asia, ICRISAT Campus, Hyderabad,Telangana, India

Dr. Bhanvi Wadhawan (M.Sc, Ph.D) Assistant Professor Department of Zoology, M. M. Modi College, Patiala, Punjab, India

Dr. Aditya Prasad Acharya (PhD) Assistant Professor Department of Veterinary Pathology, College of Veterinary Science &Animal Husbandry, OUAT, Bhubaneswar, Odisha, India

Dr. Mrs. Rajendramani Gnaneswaran (Ph.D) Department of Zoology University of Jaffna, Jaffna, Sri Lanka

Dr. Palem Harinath (Ph.D) Department of Zoology, Yogi Vemana University, Vemana Puram, YogiVemana University Road, Ganganapalle, Andhra Pradesh, India

Dr. Rajendramani Gnaneswaran (Ph.D) Department of Zoology, University of Jaffna, Jaffna, Sri Lanka

Chinnaperumal Kamaraj (M.Sc.,M.Phil.,Ph.D.,) Department of Biotechnology, School of Biosciences, PeriyarUniversity, Salem, Tamil Nadu, India

Dr. Deepak Rawal (M. Sc., SET, CSIR-NET, Ph. D.) Assistant Professor Department of Zoology, UCOS, Mohanlal Sukhadia University, Udaipur,Ganesh Nagar, Udaipur, Rajasthan, India

Dr. Sushil Kumar Saxena (M.Sc.(Agril), Ph.D. (Forest Ento.), Ph.D.(Agril. Ento.)) Professor and Head Department of Entomology, ASPEE College of Horticulture andForestry, Navsari Agricultural University, Navsari, Gujarat, India

Apply for Editorial Board Member Click Here

HOME EDITORIAL BOARD ARCHIVES INSTRUCTIONS MEMBERSHIP INDEXING CONTACT US

COPYRIGHT © 2016 - 2018. ALL RIGHTS RESERVED.

Journals List

Research Journals

http://www.entomologyjournals.com/ApplyforBoardMember





http://www.entomologyjournals.com/membership




Vol. 3, Issue 2 (2018)

S. No. Title and Authors Name Country

21 Incidence and diversity of lepidopterous insect pests and their parasitoids (natural enemies) on cole crops at danderkhah location in Srinagar District (J&K, India)

Deen Mohd Bhat

[ABSTRACT][DOWNLOAD]

PAGES: 107-113 | 69 VIEWS 29 DOWNLOADS

India

22 The moths (Lepidoptera: Heterocera) of vagamon hills (Western Ghats), Idukki district, Kerala, India

Pratheesh Mathew, Sekar Anand, Kuppusamy Sivasankaran, Savarimuthu Ignacimuthu



India

23 Histopathological effects of chlorpyrifos on the midgut of 3rd larval instar of oriental latrine fly, Chrysomya megacephala(Fabricius) (Diptera:

Calliphoridae)

Shagufta Yasmeen, Mohammad Amir



India

24 Location specific morphological peculiarity of honey bee Apis indica in Amethi, region Uttar Pradesh, India: Revealization from an identification and characterization studied

Saleem Ahamad, Rajneesh Tripathi



India

25 Oviposition deterrent, repellent and ovicidal activity of Pterolobium hexapetalum (Fab.) against the stored grain pest, Callosobruchus maculatus (Coleoptera: Chrysomelidae)

Saranya J, Elumalai Kuppusamy



India

26 Larvicidal activity of selected essential oils against Aedes aegypti (Insecta: Diptera: Culicidae)

Christina Pauline M, Mary Fabiola, Johnson Amala Justin, JMV Kalaiarasi



India

27 Expression patterns of epsilon glutathione S – transferases genes in developmental stages of susceptible and DDT resistant lines of Anopheles arabiensis strains

Yayo AM, Ado A, Habibu UA, Mohammed BR, Ebere N, Hemingway J



Nigeria

28 Population dynamics study for triple-e sustainable management of a major pest, Leptocorisa oratorius fabricius (Hemiptera: Alydidae)

Nayan Roy



India

29 Evaluation of toxicity of biopesticides against okra moth, Earias vittella (Fabricius) (Noctuidae: Lepidoptera) India

http://www.entomologyjournals.com/archives/2018/vol3/issue2/3-2-15
















Pratibha, Rajendra Singh



30 Field efficacy of emamectin benzoate 1.9 EC against shoot and fruit borer of okra

Karthikeyan Rajuponnu, Ayysamy Regupathy



India

31 Molecular identification of house fly, Musca domestica L. (Diptera :

Muscudae), using mitochondrial DNA partial genes cytochrome oxidase sub unit 1 (CO1) in Manado city

Ivonne E Rotty, Odi Pinontoan, Max Tulung, Inneke Rumengan, Mokosuli Yermia Semuel



Indonesia

32 Physico-chemical characteristics of larval hatritat waters of mosquitoes in and around Bangalore, Karnataka, India

BM Sreedhara Nayaka



India

33 Insect faunal diversity of chintamani kar bird sanctuary and other protected areas of West Bengal

Bulganin Mitra, Arjan Basu Roy, Apurva Das, Suresh Kumar Shah, Sarika Baidya, Devsena Roy Chaudhury, Debapriya Mukherjee, Balaram Panja



India

34 Taxonomic studies on subfamily Phaneropterinae (Orthoptera: Tettigoniidae) from Uttar Pradesh, India

Mohd. Kaleemullah Farooqi, Mohd. Kamil Usmani



India

35 Diversity and abundance of the myrmicofauna in Chalisgaon, North Maharashtra region, India

Arun Sawarkar



India

36 Leafhoppers and their morphology, biology, ecology and contribution in ecosystem: A review paper

Bismillah Shah, Yating Zhang



China

















Editorial Board

EDITOR-IN-CHIEF

Dr. B. S. Chandel (M.Sc., Ph.D., D.Sc. (Zoology-Entomology) FESI, FSLSc., FSESc., IAES, FANSF, SPPS. FAEB) Associate Professor & Head Biopesticides and Toxicological Laboratory, Department of Zoology, D.B.S. College, Affiliated to CSJM University, Kanpur, India

ASSOCIATE EDITORS

Dr. Surya Prakash Mishra (Ph.D., .Z.S.I., F.A.I.R., F.I.A.E.S., F.S.L.Sc.) Associate Professor and Head, P.G. Department of Zoology, Ganpat Sahai P.G. College, Sultanpur, Uttar Pradesh, India

Rouhollah Radjabi (Ph.D.) Researcher Plant Protection Department, Agricultural Faculty, Islamic Azad University, Dezful Branch, Dezful, Iran

Dr. Saroj Kumar Ghosh (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Bejoy Narayan Mahavidyalaya, Itachuna, Hooghly, West Bengal, India

Dr. Abhishek Shukla (Ph.D.) Senior Acarologist and Associate Professor Department of Entomology Navsari Agricultural University, Navsari, Gujarat, India

Neeraj Kumar Sharma (Ph. D.) Department of Zoology, H.N.B Garhwal University, Tehri Garhwal Uttarakhand, India

Dr. (Mrs.) Ranjana Saxena (M. Sc., Ph.D.) Associate Professor Dyal Singh College, University of Delhi, Delhi, India

Dr. Hany M. R. Abdel-Latif ((DVM, MVSc, PhD) Lecturer of Fish diseases Department of Poultry and Fish diseases, Faculty of Veterinary medicine, Alexandria University Edfina, Behera province, Egypt

Syed Ishtiaq Anjum (Ph.D.) Lecturer Department of Zoology, Kohat University of Science and Technology, Kohat-26000, Khyber Pakhtunkhwa, Pakistan

Dr. Nayan Roy (M. Sc., Ph.D.) Assistant Professor MUC Women’s College, Department of Zoology, West Bengal, India

Dr. Semra BENZER Assistant Professor Education Faculty, Gazi University, Ankara, Turkey

Dr. Deepak Sumbria (Ph.D.)

Teaching Associate Department of Veterinary Parasitology Post-Graduate Institute of Veterinary Education and Research jaipur, Rajasthan, India

Prof. Dr. Muhammad Faheem Malik (M. Sc., Ph.D.) Dean (Director) of Faculty of Sciences University of Gujrat, Hafiz Hayat Campus, Gujrat, Pakistan

Dr. R. Raveen (M.Sc., M.Phil., Ph.D.) Assistant Professor, Department of Zoology, Madras Christian College, Chennai, Tamil Nadu, India

Hameed Ur Rehman Researcher Department of Chemistry, Kohat University of Science and Technology, Khyber Pakhtunkhwa, Pakistan

Dr. Selçuk Altınsaçlı (M. Sc., Ph.D.) Faculty of Fisheries, İstanbul University, Istanbul, Turkey

Dr. Amit Tomar (M.Sc. Botany, Ph.D., F.L.S. London, D.Sc.) Assistant Professor Department of Botany Meerut College, Meerut, Uttar Pradesh, India

Dr. Buddhadeb Manna (M. Sc., Ph.D.) Professor, Department of Zoology, University of Calcutta, India

Mandakini Singla (Ph.D.) Lecturer Govt Science College, Jagraon, Punjab, India

Dr. Meera Srivastava (M. Sc., Ph.D.) Head, PG Department of Zoology Govt. Dungar College, Bikaner, Rajasthan, India

Dr.abid Farid (M. Sc., Ph.D.) Associate Professor/Head, Department of Agriculture, University of Haripur, Haripur, Pakistan

Dr. Alexander V. Ilyinykh (Ph.D., D.Sc.,) Institute of Systematics and Ecology of Animals SB PAS, Novosibirsk, Russia

Prof. Dr. Naim Saglam (M. Sc., M.A., Ph.D.) Department of Aquaculture and Fish Diseases, Faculty of Fisheries, Firat University, Turkey

Prof. Dr. Ahmad-Ur-Rahman Saljoqi (M. Sc., Ph.D.) Professor, Department of Plant Protection, The University of Agriculture, Peshawar, Pakistan

Prof. Dr. Emel Ergun (Ph.D.) Department of Histology and Embryology, Faculty of Veterinary Medicine, Ankara University, Turkey

Dr. R.a. Tripathi Professor (Retd.), Division of Entomology, C.S. Azad University of Agriculture and Techenology, Kanpur, Uttar Pradesh, India

Prof. Dr. Bilal Dik (D.M.V., Ph.D.) Department of Parasitology, Selcuk University, Turkey

Prof. Abdurasulov Yrysbek (Ph.D.) Consultant, FAO National Farm Animal Genetic Resources of Kyrgyzstan, Kyrgyzstan

Assoc. Prof. Dr. Mustafa Garip (D.V.M., Ph.D.) Division of Animal Nutrition and Zootechnics, Faculty of Veterinary Medicine, Selcuk University, Turkey

Prof. Dr. Svetlana G. Nesterova (Ph.D.) Department of Biodiversity and Bioresources, Faculty of Biology and Biotechnology, Al-Farabi Kazakh National University, Kazakhstan

Prof. Nogoybayev Mukambetov Daiyrovich Head, Head of the Department of Internal Medicine Animals, Kyrgyz National Agrarian University, Kyrgyzstan

Dr. Oguzhan Avci Department of Virology, Faculty of Veterinary, Medicine, University of Selcuk, Turkey

Dr. Varuna Verma (M.Sc., Ph.D.) Environmental Engineering, Geetanjali Institute of Technical Studies, Dabok, Udaipur, India

Dr. Omer Kucuk (M.Sc., Ph.D.) Chamber of forest Engineer, Society of Kastamonu University, Turkey

Associate. Prof. Dr. Hasan Kalyoncu (M.Sc., Ph.D.) Faculty of Art and Science, Departmant of Biology, University of Süleyman Demirel, Isparta, Turkey

Dr. Hassan Nasirian (M.Sc., Ph.D.) Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran

Dr. Youssef Dewer (M.Sc., Ph.D.) Department of Biological Chemistry and Crop Protection, Rothamsted Research, Harpenden, United Kingdom

Dr.El-Sayed Abdel-Malek El-Sheikh (M.Sc., Ph.D.) Associate Prof. Associate Prof. of Pesticides Biotechnology and Toxicology, Faculty of Agriculture, Zagazig University, Egypt

Dr. Soad I. Abd El-Razak Ramadan (M.Sc., Ph.D.)

Plant Protection Research Institute, Agricultural Research Center, Sabahia, Baccous, Alexandria, Egypt

Prof. Dr Moufid Yassine (Ph.D.) Tishreen university, Latakia, Syria

Dr. Muhammad Saeed Assistant Professor Department of Agriculture, University of Haripur, Khyber Pakhtunkhwa, Pakistan

Dr. Ali Darvishzadeh (M. Sc., Ph.D.) Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Alborz, Iran

Prof. Dr. Uğur Uslu (M. Sc., Ph.D.) Vice Dean Selcuk Universite, Veterinary Medicine Parasitology Department, Kampus-Konya, Turkey

Dr. Y. Norma-Rashid (Ph.D.) Professor, Ecology & Biodiversity Programme, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia

Dr. Dushyant Mishra (Ph.D.) Research Associate, Department of Molecular and Cellular Medicine, Reynolds Medical Bldg. Texas A&M Health Science Center, College Station, Texas, USA

Luis Carlos Martínez (Ph.D) Researcher Department of Entomology, Universidade Federal De Viçosa, Minas Gerais, Brazil

Bolormaa Ganbaatar (Master) P.o.b 53/15. Institute of Plant Protection, Ub. Khan-uul, Zaisan, Ulaanbaatar, Mongolia

Instructions to Author

Submit Manuscript: Manuscript can be submitted through email attachment at [email protected]

Download Copyright form. Click Here

Download Sample Paper. Click Here

These articles should clearly describe new and carefully confirmed results and experimental procedure which

should be given in required details for others to verify the work.

The manuscript should be prepared in English using "MS Word". "Times New Roman" font should be used. The

font size should be of 12pt but main subheadings may be of 14pt. All research articles should have the following

sections: Title page, Abstract, Key words, Introduction, Materials and methods, Results, Discussion, Conclusion,

Acknowledgement (if any) and References.

Title: The title should then followed by the author name and the institution name and address by indicating

suitable superscripts. Title page should contain title of the paper in bold face, title case, names of the authors in

normal face, upper case (font size 12) followed by the address(es) in normal face lower case. An asterisk (*)

must be placed after the corresponding authors name as superscript whose email id, fax, telephone number can

be given. Corresponding author has the responsibility to ensure that all co-authors are aware and approve the

contents of the submitted manuscript.

Abstract: This section should detail the problems, experimental approach, major findings and conclusion in one

paragraph and should appear on the second page. Avoid abbreviation, diagram and references in the abstract.

Keywords: Author(s) must give key words which can identify the most important subjects covered by the paper.

They must be placed at the end of the abstract.

Introduction: The manuscript should include the purpose of the investigation and relating the manuscript to similar

previous research. Only information essential to the arguments should be presented.

Materials and Methods: This section must contain specific details about the materials studied, instruments used,

specialized chemicals source and related experimental details which allows other research worker to reproduce

the results. Obtain permission for all fully borrowed, adapted, and modified tables and provide a credit line in the

footnote. Results and Discussions The results should be concisely presented. Results and discussion may be

separate or combined based on the author’s requirement. Tables and figures should be designed to maximize

the comprehension of the experimental data. The interpreted results should be explained clearly in discussions

and should relate them to the existing knowledge in the field as clearly as possible. Tables, Graphs and figures

(Illustrations) should be inserted in to the main text at respective place they should appear when published and

should have appropriate numbers and titles with an explanatory heading. Labels of the table, graph and figures

MUST be in the text form and should not form part of the image. Colour photographs and illustrations (line

drawings, halftones, photos, photomicrographs etc) must be clean originals or digital files would be charged that

may be intimated along with the acceptance letter. Those photographs must be clear and sharp. Digital files are

recommended for highest quality reproduction.

Acknowledgement (if any): This section can be kept at the end of the manuscript before reference section. This

section can be used to acknowledge the help of those who do not qualify for authorship or to acknowledge

funding, donated resources or significant contribution to the research.

http://www.entomologyjournals.com/authorship_responsibility_form.doc

http://www.entomologyjournals.com/sample.doc

References: References to the literature cited for the manuscript should be numbered in order of appearance in

the manuscript and cited in the text with superscript numbers. The reference number should follow the following

format.

For Journals Format: Author(s) of article (surname initials). Title of the manuscript. Journal title abbreviated Year

of publication; volume number (issue number): page numbers.

Standard journal article (If more than six authors, the first six shall be listed followed by et al. )

Hornung H, Woolley K, Kori M L, Bennani L K, Bundgaard R K, Charles C S

et al. Anti-Inflammatory and analgesic activity of Jatropha gossypifolia in experimental animal models. Global

Journal of Pharmacology 2009; 3(1):1-5.

For Books and other monograph Format: Author AB, Author BB, Author CC. Title of Book. Ed, Vol, Publisher,

City, year, page numbers.

Faycal K M, Indian Materia Medica. Edn 3, Vol. I, London, 2000, 242-246.

For Patent Reference: H. Aviv, D. Friedman, A. Bar-Ilan and M. Vered. Submicron emulsions as ocular drug

delivery vehicles, U.S. Patent US 5496811; 1996.

For Website Reference: Quick dissolving tablets. http://www.biospace.com. 27 may, 2001.

Ethical Matters: Authors involving in the usage of experimental animals and human subjects in their research

article should seek approval from the appropriate Ethical committee in accordance with "Principles of Laboratory

Animal Care". The Method section of the manuscript should include a statement to prove that the investigation

was approved and that informed consent was obtained.

Indexing and Abstracting

International Journal of Entomology Research is indexed in following database.

Index Copernicus

Google Scholar

International Journal of Entomology Research

168


ISSN: 2455-4758

Impact Factor: RJIF 5.24

www.entomologyjournals.com

Volume 3; Issue 2; March 2018; Page No. 168-176

Molecular identification of house fly, Musca domestica L. (Diptera : Muscudae), using mitochondrial

DNA partial genes cytochrome oxidase sub unit 1 (CO1) in Manado city

Ivonne E Rotty1, Odi Pinontoan2, Max Tulung3, Inneke Rumengan4*, Mokosuli Yermia Semuel5 1 Ph.D Student, Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia

2, 3 Professor in Entomology, Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia 4 Department of Entomology, Graduate Program, Sam Ratulangi University, Manado, Indonesia.

5 Laboratory of Bioactivity and Molecular Biology, Department of Biology, State University of Manado, Indonesia

Abstract

Musca domestica L. becomes a serious problem in tropical country. Its role as a vector of many pathogenic microbes has caused

many health problems for humans. A study was conducted to identify house fly in Manado City, using partial gene cytochrome

oxidase sub unit 1 (CO1). House fly is obtained from nine different habitats in Manado City. Isolation of DNA were used DNA

extraction and purification Kit. Amplification of CO1 gene by PCR method. Sequence analysis using Geneous and MEGA 6.0.

The result of this research showed, the sequence of house fly CO1 gene : IBP, IBS, IBT, IKT, IMT and IPB have the highest

similarity level with Musca domestica cytochrome oxidase subunit I (COI) gene [MG557665.1], while the CO1 gene of IKP and

IKT has the highest similarity level with Musca domestica ISOLATE CSU 140601CBJI A $ cytochrome oxidase subunit I (COI)

gene [KY001857.1]. CO1 gene of IKS showed similarity with Musca domestica ISOLATE CSU 140601CBJI A$ cytochrome

oxidase subunit I (COI) gene. Intraspecies genetic variation of house flies in Manado city based on partial CO1 gene, are high.

Keywords: Musca domestica L., cytochrome oxidase sub unit 1 gene, Manado, Indonesia

Introduction

The house fly (Musca domestica L.) is the most frequent

house fly species transmitting pathogenic bacteria in humans

(Sembel, 2008; Kassiri et al. 2012) [8]. House flies can act as

vectors of transmission of gastrointestinal diseases, such as

cholera, dysentery, typhoid and also carry protozoa, eggs and

worm larvae (Santi, 2001; Chandra, 2005). Furthermore,

house flies are considered as annoying insects because it is a

mechanical vector of several diseases including

gastrointestinal infections (Hastutiek, 2007). Transmission of

the disease mechanically, i.e. through all parts of the body

flies. Disease germs from animal feces, humans and trash can

stick to body hair, hairs on legs and probosis. House fly, can

spread Helicobacter pylori, Escherichia coli, Cryptosporidium

parvum, even H5N1 virus (Hastutiek, 2007.

Manado city has 16 working areas of Community Health

Center (Loacal Name : Puskesmas). In 2015, the total

population of Manado City amounted to 425,633 inhabitants.

Diarrhea disease in Manado City 2014 reportedly amounted to

3174 patients; in 2015 increased to 4967 sufferers. For the

work area of Puskesmas Minanga, 2015 was 180 patients,

Puskesmas Bahu was 260 patients, Puskesmas Ranotana was

284 patients and Puskesmas Wenang was 182 patients.

Government General Hospital, Prof. Dr. R.D. Kandou, in

2015 reportedly handles 480 diarrhea sufferers. Diarrhea is

one of the 10 largest infectious diseases in North Sulawesi. In

many reports, the highest cases of diarrhea in areas with poor

sanitation in Manado City (BPS Sulawesi Utara, 2015) [2].

Based on previous research, population of house fly, at

various location in Manado city, founded mixed population of

flies with other flies species. Morphological studies have

found variations in morphological characteristics such as wing

length, body length, head structure, compound eye color, limb

structure and abdominal structure of houseflies originating

from various locations in Manado City (Rotty, 2017).

However, morphological characteristics have not been

sufficient to distinguish the species of house fly, which exist

in Manado city. Answering the problem was a genotypic

analysis using mitochondrial DNA of CO1 gene as a

molecular barcode used universally for animal identification.

The structure and composition of the genetic information

contained in mitochondrial DNA has been extensively

researched, can characterize a population, phylogenetic and

make it possible to reconstruct evolutionary history (Hebert et

al. 2003; Lessinger et al., 2000; Mokosuli, 2013) [6, 10].

Mitochondrial DNA is maternalistic, so there is no

recombination with parental male mitochondrial DNA

(Nelson and Cox, 2005; Alberts et al. 2005) [15, 1]. In

mitochondrial DNA, there is a conservative region that can be

used to construct an animal evolutionist relationship (Bruce et

al. 2006; Hebert et al. 2003) [6]. Since, Cytochrome c oxidase

subunit 1 (CO1) gene is considered as one of the widely used

markers in the studies of population genetics and evolution

(Hebert et al. 2003; Shao et al., 2007) [6] because it is among

the most conservative protein-coding genes found in the

mitochondrial genomes of animals (Bruce et al. 2006). The

cytochrome oxidase sub unit 1 (CO1) is one of the genes

present in the mitochondrial genome and is widely used for


169

animal molecular identification. The application of a universal

CO1 gene for molecular identification of insects in North

Sulawesi has been done on Apis dorsata Binghami (Mokosuli,

2013) [14], Aedes sp. (Kaunang et al. 2015), Anopheles sp.

(Manuahe et al. 2016) [12]; (Timah and Mokosuli, 2017) [20],

and bed bugs (Kalangi et al. 2016) [9], marine gerridae

(Warouw et al. 2015) [23], frehwater gerridae (Waha et al.

2016) [22] and demselfly (Rantung et al. 2015).

Materials and Methods

Samples

Adult home fly is obtained by direct capture technique. The

location of catching house flies, done in some places in

Manado, among others, traditional markets, residential areas

and bus terminals. Flies captured, preserved in 70% ethanol.

Subsequently used as a sample for DNA analysis. Body parts

of flies used as tissue sources for DNA extraction are thorax

and legs. This research was conducted in Laboratory

Bioactivity and Biology Molecular, Department of Biology,

Manado State University. DNA sequencing using ABI PRISM

3730xl sequence Genetic Analyzer engine developed by

Applied Biosystems, USA, at First BASE Laboratories Sdn

Bhd, Singapore.

Tools and Materials

The tools used in this research were : tissue ruptor (Qiagen),

vortex V-1 plus (Biosain), orbitals shaker OS-20 (Biosain),

micropipette (eppendorf), mini personal centrifuge Tommy

Digital Biology, P-class Nanofotometer, centrifuse 5430R

(eppendorf), master cycles pro s (eppendorf), gel

documentation system fire reader UVitec, Qiaxel automatic

electrophoresis (Qiagen), sequence ABI PRISM 3730xl

Genetic Analyzer develop by Applied Biosystems, USA. The

materials used are: ethanol p.a. (merck), chloroform p.a.

(merck), Genomic DNA Mini KIT (Tissue) Geneaid, 2x

MyTaq HS Red Bioline Mix (USA), Qiaxel DNA Screening

gel kit and 2 μl tips - 100 μl Qiagen, CO1 Universal primer:

LCO1490: GGTCAACAAATCATAAAGATATTGG

HCO2198: AACTTCAGGGTGACCAAAAAATCA (Folmer

et al. 1994),

DNA extraction and purification

a. Extraction of house fly DNA

DNA extraction and purification using the Geneaid Mini KIT

(Tissue) Genomic DNA procedure. Initial stage before

entering on extraction is tissue dissociation consisting of

taking 30 mg tissue legs and thorax of house fly, then inserted

in vial eppendof 1,5 ml. In the vial, 200 μl of GT Buffer is

added. Furthermore, 20 μl Proteinase K was added. The

incubation was modified from 30 minutes to 24 hours. The

next step follows the Kit protocol. The result of DNA

extraction of house fly, then analyzed the concentration and

purity by using Implant nanophotometer. DNA purity can be

seen with an A260 / A280 ratio of between 1.8 - 2.0 nm. If

<1.8 is contaminated with protein and or protein derivate

contaminant components that affect DNA molecules, and if>

2.0 means contaminated with RNA (Protocol Kit).

b. Amplification of house fly CO1 gene, by PCR method

The PCR process used 2x MyTaq HS Red Mix Bioline (USA)

and CO1 primer is Forward LCO 1490:

5'GGTCAACAAATCATAAAGATATTGG3' and Reverse

HCO 2198: 5'TAAACTTCAGGGTGACCAAAAAATCA3'.

The PCR component and PCR conditions applied are shown

in Table 1 and Table 2.

Table 1: PCR Component

PCR Component Volume (µL)

2x MyTaq HS Red Mix Bioline 25

Primer Forward 1

Primer Reverse 1

DNA of house fly* 2

ddH2O 21

Total 50

Table 2: PCR Condition

Cycle Time (Seconds) Temperatur (°C) Phase

35 x

60 94 Denaturasi

30 50 Annealing

30 72 Ekstension

60 72 Final Ekstension

Visualization of PCR products

Amplicons of CO1 gene of house flies, produced at the PCR

stage, were visualized using automatic electrophoresis

(Qiaxel), by applying a Qiaxel DNA Screning gel (Qiagen)

kit. Visualization of PCR results was also performed using

conventional electrophoresis.

Sequences analyses and phylogeny trees reconstruction

Obtained sequences were aligned using MEGA 6.0 and

Geneous 6.0 software. Sequences were subjected to Basic

Local Alignment Search Tool (BLAST) in order to perform

sequence similarity searches (www.ncbi.nih.gov.com).

Nucleotide frequencies were calculated using MEGA 6.0

software (Tamura et. al. 2013) [19]. The genetic distances

(number of nucleotide substitutions per site) among sequences

were calculated using the Maximum Composite Likelihood

model in Geneous 6.0 software. Phylogenetic trees were

reconstructed using two different reconstruction methods: (1)

neighbor joining (NJ) and (2) Minimum Evolution (ME). The

NJ tree was reconstructed using the Maximum Composite

Likelihood method. Phylogenetic analyses were conducted in

MEGA 6.0 software. Bootstrap support values were obtained

by 1,000 replications using both methods (Tamura et. al.

2013) [19].

Results and Discussion

DNA extraction of house flies (Musca sp.) from Manado

city

The highest DNA purity of nine house flies samples was 1,75

(sample IKP). While the lowest DNA purity was 1,55 (IKT

Samples). In the other hand, the highest DNA concentration

was 53.2 µg/ml (IMT sample) while the lowest total DNA

concentration was 40.25 µg/ml (IBP sample). DNA purity is

not linear, with the DNA concentration of house flies obtained

(Figure 1).


170

Fig 1: Concentration and Purity dsDNA of house fly from Manado City

Based on the concentration and purity of the extracted DNA, it

showed that the Genomic DNA Mini KIT (Tissue) Geneaid,

which is used to extract house fly DNA, has effective in

extracting total DNA from legs and thorax flies. The difficulty

in extracting insect DNA, compared with other animal

samples is the number of complex biomolecule contaminants

from the exoskeleton. Common contaminants found in insect

DNA extraction are chitin, complex proteins and peptides

from exoskeleton. This contaminant may decrease the

effectiveness of buffers and proteinase enzymes in the kit

(Timah and Mokosuli, 2017; Manuahe et al. 2015; Mokosuli,

2013) [20, 14]. In this research, modification of protocol kit is

done by the destruction of thorax and legs, using tissue ruptor

and tissue immersion time with protenase K according to

protocol kit, 30 minute has modified to 24 hours. This

modification proved to increase the concentration and purity

of the house fly DNA extraction results. The total DNA

concentration distribution based on the Kit protocol used was

30 μg / ml up to 70 μg / ml. Thus the total DNA concentration

obtained in this study is quite good. While total DNA purity is

at the distribution of 1,7 - 2,0 (A260 / A280). Total DNA

purity of the results of this study is still quite good. However,

the mitochondrial DNA content present in extracted DNA is

known after amplification of the target gene, using a universal

CO 1 primer.

PCR and Visualization of Amplikon Gen CO1 Home Flies

(Musca sp.) From Manado

Extracted DNA, amplified by PCR method. Of the 4 stages of

PCR, the annealing is the most important stage, so

temperature and time modification greatly affect the

optimization of CO1 gene amplification. In this study,

modified annealing temperatures are proven to produce

amplicons as targeted. Visualization of amplicons content of

CO1 gene is done by electrophoresis technique.

Electrophoresis condition was 0.8% agarose gel, the number

of ladder DNA that is applied to each well 0.2 μg with the

volume of samples per well 1 μl. The band on the electrogram

shows the amplicon content of the flies CO1 gene successfully

amplified by the PCR method. The PCR results show that

sample amplicons are 6. (IKP), 7. (IKT), 8. (IKS), 9. (IMT),

10. (IPB). was formed optimally while sample 3. (IBS), 4.

(IBP), the band is very thin (Figure 2).

Fig 2: Visualization of CO1 gene amplicons, house flies from

Manado City. Description :1. (control) 2. (IBT), 3. (IBS), 4. (IBP), 5.

(IMS), 6. (IKP), 7.(IKT), 8. (IKS), 9. (IMT), 10. (IPB).

Sequensing

Output sequencing from First BASE Singapore, read with

Geneous 10.1. and MEGA 6.0. Based on the chromatogram of

sequenced results, the sequencing showed well. This is

evidenced by chromatogram bands representing different

types of nucleotides perfectly or not coincident (Appendix 1.).

After the contig analysis, the length of the CO1 gene sequence

of flies from Manado was between 558bp - 691 bp and HQ

(68.5% - 92.8%). Characteristics of the CO1 fly gene

sequence from Manado were then shown in Table 2. The

sequence of CO1 gene lies at length 600 - 700 bp (Herbert,

2003). Thus, the nine sequences of the fly fly CO1 gene from

Manado were on the long-range CO1 gene, according to the

characteristics of the CO1 gene as molecular barcodes for

animal identification.


171

Table 2: Characteristics of CO1 gene house fly sequences, from Manado City

No Sample Lenght of Sequens (bp) MW dsDNA (kDa) HQ (%) Nucleotide Composition

A C G T % GC

1 IBP 682 421,29 92,7 259 (38%) 111(16,3%) 108 (15,8%) 204(29,9%) 219(32,1%)

2 IBS 558 344,69 68,5 160(28,7%) 82(14,7%) 90(16,1%) 214(38,4%) 171(31,5%)

3 IBT 695 429,32 84,3 195(28,1%) 109(15,7%) 117(16,8%) 274(39,4%) 226(32,5%)

4 IKP 691 426,85 92,8 204(29,5%) 113(16,4%) 114(16,5%) 260(37,6%) 227(32,9%)

5 IKT 694 428,71 91,2 201(29,0%0 110(15,9%) 119(17,1%) 264(38,0%) 229(33,0%)

6 IKS 690 426,23 92,8 200(29,9%) 108(15,7%) 112(16,2%0 270(39,1%) 220(31,9%)

7 IMS 686 423,76 92,3 201(29,3%) 109(15,9%) 111(16,2%) 265(38,6%) 220(32,1%)

8 IMT 683 421,91 93,1 258(37,8%) 111(16,3%) 108(15,8%) 207(30,2%) 219(32,1%)

9 IPB 682 421,28 92,7 259(38%0 111(16,3%) 109(15,0%) 203(29,8%) 220(32,2%)

Alignment analysis with the NCBI BLAST Method

(https://blast.ncbi.nlm.nih.gov/Blast.cgi)

The consensus area of the house fly CO1 gene sequence from

Manado City, each used for alignment analysis with the

BLAST method on the NCBI website. The BLAST results

indicate that nine CO1 gene sequences of flies in Manado City

have the highest percentage of similarities with the three

Musca domestica CO1 gene sequences that have been

recorded in the gene bank NCBI. The sequence of CO1 gene

IBP, IBS, IBT, IKT, IMT and IPB have the highest similarity

level with Musca domestica cytochrome oxidase subunit I

(COI) gene [MG557665.1], while the CO1 IKP gene sequence

has the highest similarity level with Musca domestica

ISOLATE CSU 140601CBJI A $ cytochrome oxidase subunit

I (COI) gene [KY001857.1] (table 3). The nucleotide

difference between flies from nine sites in Manado is shown

in Table 4. The nucleotide difference is indicated by the dot,

on the output of the alignment analysis.

Table 3: Similarity level of house fly in Manado City, based on alignment analysis on NCBI website

No Samp

les

Percentage

Similarity Similarity Species

Assesion

Number Author and Country Origins

1 IBP 99%

Musca domestica

cytochrome oxidase subunit

I (COI) gene

MG557665.1

Aslam,A.F.M., Rain,F.F. and Howlader,A.J.

Submitted (22-NOV-2017) Zoology, DNA Barcoding Laboratory,

Department of Zoology, Jahangirnagar University, Dhaka, Savar 1342,

Bangladesh

2 IBS 99%

Musca domestica


I (COI) gene

MG557665.1




Banglades

3 IBT 99%

Musca domestica


I (COI) gene

MG557665.1




Bangladesh

4 IKP 99%

Musca domestica


I (COI) gene

MG557665.1

Alkhedir,H., Mashaly,A.M.A. and Karlovsky,P.

Submitted (22-JAN-2016) Agricultural Entomology and Molecular

Phytopathology and Mycotoxin Research, Georg-August-University

Goettingen,Grisebachstrasse 6, Goettingen 37077, Germany

5 IKT 99%

Musca domestica


I (COI) gene

MG557665.1

Alkhedir,H., Mashaly,A.M.A. and Karlovsky,P.

Submitted (22-JAN-2016) Agricultural Entomology and Molecular

Phytopathology and Mycotoxin Research, Georg-August-University

Goettingen,Grisebachstrasse 6, Goettingen 37077, Germany

6 IKS 99%

Musca domestica ISOLATE

CSU 140601CBJI A$


I (COI) gene

KY001857.1

Guo,Y.-D., Cai,J.-F. and Ren,L.-P.

Submitted (17-OCT-2016) Department of Forensic Medicine, Central South

University, Tongzipo Road No. 172, Changsha, Hunan 410013, China

7 IMS 99%

Musca domestica


I (COI) gene

MG557665.1




Bangladesh

8 IMT 99%

Musca domestica


I (COI) gene

MG557665.1




Bangladesh

9 IPB 99%

Musca domestica


I (COI) gene

MG557665.1



Bangladesh


172

Table 4: Analysis of alignment, the CO1 gene of house flies in Manado

Table 5: Genetic distance of house flies from Manado and similarity sequence of BLAST result on NCBI webs

Description

1. (IBT), 2. (IBS), 3. (IBP), 4. (IMS), 5. (IKP), 6.(IKT), 7.

(IKS), 8. (IMT), 9. (IPB), 10. Musca domestica

[KY001857.1], 11 Musca domestica [KY001856.1], 12.

Musca domestica [KY001855.1], 13. Musca domestica

[KY001854.1], 14. Musca domestica [KT272839.1], 15.

Musca domestica [KT272838.1], 16. Musca domestica

[KT272837.1], 17. Musca domestica [KT272836.1], 18.


[KT272833.1], 20. Musca domestica [KT272831.1], 21.


[KT272829.1], 23. Musca domestica [KR921687.1], 24.


[KP713680.1], 26. Musca domestica [KJ496775.1], 27. Musca

domestica [JX861432.1], 28. Musca domestica [JX861431.1],

29. Musca domestica [KF562113.1],

Subtitution Matrix

The analysis of the substitution matrix, nine gene sequences of

house flyflies from Manado with BLAST sequenced


173

sequences, was performed using the MEGA 6.0 program,

using the Maximum Likelihood model. Adenine nucleotide

frequency (32.8%), Timin (38.30%), Cytosin (14.24% and

Guanin (14.58%)) The average transition substitution was

printed with bold numbers while the average transversion

substitution was printed with italics in table 4.

Table 6: Substitution matrix with maximum likelihood model

A T/U C G

A - 11.72 4.36 3.63

T/U 10.07 - 7.31 4.46

C 10.07 19.67 - 4.46

G 8.18 11.72 4.36 -

Discussion

Modified Genomic DNA Mini KIT (Tissue) Geneaid, can

optimize the concentration and purity DNA of house flies.

Insect DNA extraction has its own difficultie, compared with

mammals (Mege and Mokosuli, 2017) [13]. This is caused,

among others, by exoskeleton in adult insects. The exosketon

is often mixed in the tissue to be extracted because the insect

tissue is in the exoskeleton. This affects the purity and

concentration of targeted DNA. Because this study uses genes

present in mitochondrial DNA, mitochondrial DNA must be

extracted and purified optimally, in order to become templete

in the process of CO1 gene amplification. On the other hand,

the use of thoracic and legs, in which there were many muscle

tissues, has successfully isolated mitochondrial DNA on

insects optimally. Extraction and purification of insect DNA

using legs and thorax have been performed on Aedes sp.

(Timah and Mokosuli, 2017; Anopheles sp. (Manuahe et al.

2016) [12], Droshophila sp. (Sumampouw and Mokosuli, 2017) [17] and bed bugs (Kalangi et. 2017) [9], Apis dorsata Binghami

(Mokosuli et al. 2013). Thus thorax and legs were best used

for the isolation of mitochondrial DNA in insects.

The results of the alignment analysis with the BLAST method

on the NCBI site showed that house fly in Manado City had

the closest similarity, with 3 species of house fly in three

different countries (Table 3). This reinforces, that the variation

intraspecies, house fly in Manado City is high. Alignment

between the CO1 gene sequence of flies in Manado City, has

found many polymorphic sites or sites where nucleotide

differences occur (Table 4). Furthermore, genetic distance

analysis also showed differences in genetic distance between

house flies from nine sites in Manado City had more than one

(Table 5). This showed the proportion of nucleotides of the

CO1 gene, the nine house flies in Manado City have shown

high genetic variation. Previous morphological analysis has

also found morphological variations, especially in the thorax,

legs and body length. Although morphology in general still

shows the characteristics of house fly (Figure 3). Variations of

CO1 gene, commonly found in insects. Aedes sp. in North

Sulawesi, which lives in different habitat characteristics, has

shown a high variation of CO1 gene (Timah and Mokosuli,

2016) [12].

Fig 3: House fly from different habitat in Manado City

The reconstruction of phylogeny trees was carried out using

two models. Neither Neighbor Joining nor Minimum

Evolution models was showed the same phylogenetic tree

topography. The phylogeny tree was built with 500x bootsrap.

The phylogeny tree was built, consisting of 2 monophyletic

clades. IBS, IBP and ITS were on the first monophyletic

clade, however IBT, IKP, IKS, IMT, IPB and IKT were in

other monophyletic clades. Thus the species of house fly in

Manado City has varied based on the evolutionary

relationship.


174

Fig 4: Reconstruction of the house fly phylogeny tree in Manado, Neighbor Joining model (Bootsrap 500x).

Fig 5: Reconstruction of the house fly phylogeny tree in Manado, Minimum Evolution model (Bootsrap 500x).


175

Reconstruction of phylogeny trees based on partial gene CO1,

house fly from Manado obtained two monophyletic clade. The

first clade consists of IKT, IPB, IMS (one node) and IBT, IBS

(one node). While the second clade consists of IPB and IMT

(one node). IKP and IKS form their own nodes. From the

phylogenetic tree formed on the CO1 gene, it was found that

the genetic variation of flies in manado based on the CO1

gene was high. Based on the phylogeny tree formed, then

house fly IKP and IKS,the oldest by evolution (Figure 6).

Fig 6A

Fig 6B

Fig 6: Reconstruction of phylogeny trees, house flies in Manado

originating from nine locations. (a). Model Neighbor Joining

(Bootsrap 500x). (b). Model Minimum Evolution (Bootsrap 500x).

Conclusion

The sequence of CO1 gene IBP, IBS, IBT, IKT, IMT and IPB

have the highest similarity level with Musca domestica

cytochrome oxidase subunit I (COI) gene [MG557665.1],

while the CO1 gene of IKP and IKT has the highest similarity

level with Musca domestica ISOLATE CSU 140601CBJI A $

cytochrome oxidase subunit I (COI) gene [KY001857.1]. CO1

of IKS showed similarity with Musca domestica ISOLATE

CSU 140601CBJI A$ cytochrome oxidase subunit I (COI)

gene. Genetic variation intraspecies, house fly in Manado city

based on CO1 gene, was high.

References

1. Alberts B, Johnson A, Lewis J, Raff M, Roberts K,

Walter P. Molecular Biology of the Cell, 4th edition. New

York: Garland Science, 2005.

2. BPS [Badan Pusat Statistik], Provinsi Sulawesi Utara,

Indonesia. https://sulut.bps.go.id/

3. Boonchu NS. Piangjai KL, Sukontason K. Sukontason,

Comparison of the effectiveness of baits used in traps for

adult fly collection, Southeast Asian J Trop. Med. Public

Health. 2003; 34(3).

4. Clary DO, Wolstenholme DR. The mitochondrial DNA

molecule of Drosophila yakuba: Nucleotide sequence,

gene organization, and genetic code. J Mol. Evol. 1985;

22:252-271.

5. Friedrich M, Tautz D. Evolution and phylogeny of the

Diptera: A molecular phyogenetic analysis using 28S

rDNA sequence. Syst. Biol. 1997; 46:674-698.

6. Hebert PDN, Ratnasingham S, deWaard JR. Barcoding

anmal life: cytochrome c oxidase subunit I divergences

among closely related species. Proc. R. Soc. Lond. B

(suppl.). 2003; 270:s96-s99.

7. Iwasa M, dan Ishiguro N. Genetic and morphological

differences of Haematobia irritans and H. exigua, and

molecular phylogeny of Japanese Stomoxyini flies

(Diptera, Muscidae). Med. Entomol. Zool. 2010; 61:335-

344.

8. Kassiri H, Akbarzadeh K, Ghaderi A. Isolation of

Pathogenic Bacteria on the House Fly, Musca domestica

L. (Diptera: Muscidae), Body Surface in Ahwaz

Hospitals, Southwestern Iran. Asian Pacific Journal of

Tropical Biomedicine. 2012; S1116-S1119.

www.elsevier.com/locate/apjtb

9. Kalangi G, Tulung M, Salaki M, Mandey L.

Morphological characteristics of bedbugs (Cimex sp.)

from Manado and Sitaro north Sulawesi, Indonesia.

International Journal of Entomology Research. 2017;

2(2):70-75.

10. Lessinger AC, Junquiera MCA, Lemos TA, Kemper EL,

Da Silva FR, Vettore AL. The mitochondrial genome of

the primary screwworm fly Cochliomyia hominivorax

(Diptera: Calliporidae). Ins. Mol. Biol. 2000; 9:521-529.

11. Michel Veuille e, Ge´ rard Duvallet a. Phylogenetic

analyses of mitochondrial and nuclear data in

haematophagous flies support the paraphyly of the genus

Stomoxys (Diptera: Muscidae). Infection, Genetics and

Evolution. 2011; 11:663-670.

12. Manuahe C, Mokosuli YS, Roring VIY. Optimization of

DNA extraction and the position of mosquito Species

from southeast minahasa in North sulawesi using NADH

dehydrogenase Gene and Cytochrome oxidase Sub Unit 1

Gene. Journal of Entomology and Zoology Studies. 2016;

4(4):498-508.

13. Mege RA, Mokosuli YS. NA Barcoding of local pigs in

minahasa, north sulawesi. International Journal of Fauna

and Biological Studies. 2017; 4(5):82-87.

14. Mokosuli YS. Karakter Morfologi, Sumber Pakan, Dan

Bioaktivitas Farmakologis Racun Lebah Madu Endemik

Sulawesi Apis dorsata Binghami DAN Apis nigrocincta

Smith (Hymenoptera: Apidae). (Disertasi). Program

Pascasarjana Universitas Sam Ratulangi, Manado, 2013.

15. Nelson DL, Cox MM. Lehninger Principles of

Biochemistry 4th edition. W.H. Freeman and

Company. New York. 2005.


176

16. Preativatanyou K, Sirisup N, Payungporn S, Poovorawan

Y, Thavara U, Tawatsin A. Mitochondrial DNA-based

identification of some forensically important blowflies in

Thailand. Forensic Science International. 2010; 202:97-

101.

17. Sumampouw HM, Mokosuli YS, Oka DN. Analysis of

cythochrome oxidase sub unit 1 Gene (CO1) of fruit fly

(Droshophila sp.) from pineapples and aplication in

teaching DNA in Senior high school. International

Journal of Advanced Education and Research. 2014-

2017; 2(2):71-77. www.alleducationjournal.com

18. Sukontason KLP, Narongchai D, Sripakdee N, Boonchu

T, Chaiwong R, Ngern-Klun S, et al., First report of

human myiasis caused by Chrysomya megacephala and

Chrysomya rufifacies (Diptera: Calliphoridae) in

Thailand, and its implication in forensic entomology, J.

Med. Entomol. 2005; 42:702-704.

19. Tamura K, Dudley J, Nei M, Kumar S. Molecular

evolutionary genetic analysis (MEGA) Software version

4. Mol. Biol. E. 2007; 24:1596-1599.

20. Timah S, Mokosuli YS. Morphometry and Phylogeny

reconstruction Aedes sp. based DNA Mitochondrial

cytochrome oxidase gene sub unit 1 (CO1) in North

Sulawesi. International Journal of Mosquito Research.

2017; 4(3): 98-106.

21. Vossbrinck CR, Friedman S. A 28s ribosomal RNA

phylogeny of certain cyclorrhaphous Diptera based upon

a hypervariable region. Syst. Entomol. 1989;14:417-431.

22. Waha D, Tullung M, Berhimpon S and Mantiri F.

Phylogeny reconstruction of Gerridae from River

Ratatotok and River Talawaan North Sulawesi Based on

Mitochondrial DNA 16 S RNA Gene. International

Journal of Fauna and Biological Studies 2017; 4(2):81-87.

23. Warouw V, Salaki C, Mangindaan REP, Tulung M,

Maramis RTD, Mokosuli YS. Isolation and

Characterization of Partial Mitochondrial CO1 Gene from

Marine Insect Gerridae, Stenobates biroi from Mokupa

Beach Manado, North Sulawesi Indonesia. Journal of

Biology, Agriculture and Healthcare. ISSN (Paper) ISSN

2225-093X (Online). 2016; 6(6):41-472224-3208.

Documents

International Journal of Entomology