JOURNAL OF BACTERIOLOGY,0021-9193/01/$04.0010 DOI: 10.1128/JB.183.4.1423–1433.2001

Feb. 2001, p. 1423–1433 Vol. 183, No. 4

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Interaction of Proteus mirabilis Urease Apoenzyme andAccessory Proteins Identified with Yeast

Two-Hybrid TechnologySUSAN R. HEIMER AND HARRY L. T. MOBLEY*

Department of Microbiology and Immunology, University of Maryland School of Medicine,Baltimore, Maryland 21201

Received 1 September 2000/Accepted 16 November 2000

Proteus mirabilis, a gram-negative bacterium associated with complicated urinary tract infections, producesa metalloenzyme urease which hydrolyzes urea to ammonia and carbon dioxide. The apourease is comprisedof three structural subunits, UreA, UreB, and UreC, assembled as a homotrimer of individual UreABCheterotrimers (UreABC)3. To become catalytically active, apourease acquires divalent nickel ions through apoorly understood process involving four accessory proteins, UreD, UreE, UreF, and UreG. While homologuesof UreD, UreF, and UreG have been copurified with apourease, it remains unclear specifically how thesepolypeptides associate with the apourease or each other. To identify interactions among P. mirabilis accessoryproteins, in vitro immunoprecipitation and in vivo yeast two-hybrid assays were employed. A complex con-taining accessory protein UreD and structural protein UreC was isolated by immunoprecipitation and char-acterized with immunoblots. This association occurs independently of coaccessory proteins UreE, UreF, andUreG and structural protein UreA. In a yeast two-hybrid screen, UreD was found to directly interact in vivowith coaccessory protein UreF. Unique homomultimeric interactions of UreD and UreF were also detected invivo. To substantiate the study of urease proteins with a yeast two-hybrid assay, previously described UreEdimers and homomultimeric UreA interactions among apourease trimers were confirmed in vivo. Similarly, aknown structural interaction involving UreA and UreC was also verified. This report suggests that in vivo, P.mirabilis UreD may be important for recruitment of UreF to the apourease and that crucial homomultimericassociations occur among these accessory proteins.

Urease (urea amidohydrolase; EC 3.5.1.5) is a nickel metal-loenzyme which catalyzes the hydrolysis of urea into ammoniaand carbamate (for a review, see reference 25). The biologicalrole of urease varies from nitrogen recycling, as seen in manyplants and soil-associated bacteria, to an essential virulencefactor in several human pathogens (25). This study focused onurease produced by Proteus mirabilis, a gram-negative organ-ism frequently associated with complicated urinary tract infec-tions (26, 33). A hallmark of P. mirabilis infections is theformation of urinary stones. An increase in pH, arising fromurease-mediated urea hydrolysis, culminates in precipitation ofnormally soluble ions in urine to form struvite and carbonateapatite stones (10, 16).

The urease gene cluster of P. mirabilis encodes three struc-tural polypeptides, UreA, UreB, and UreC, which form theapoenzyme; four accessory polypeptides, UreD, UreE, UreF,and UreG; and an AraC-like positive transcriptional activator,UreR (see Fig. 7A) (18). Research published by this laboratoryand others has amassed clues to the functional role played bythe accessory proteins. For example, when ureolytic bacteriaare grown in medium lacking nickel ions, the urease apopro-tein is produced (21). Addition of nickel ions to purified apo-protein fails to generate active enzyme in standard purificationor assay buffers (21, 31). Early genetic analyses of several

ureolytic bacterial species revealed that it is possible to elimi-nate urease activity by disrupting genes encoding proteinsother than the urease subunits (14, 17, 21, 25, 30). In ourlaboratory, independent in-frame mutations of ureD, ureF, andureG led to the complete inactivation of P. mirabilis urease(14). Urease purified from homologous ure mutants in Kleb-siella aerogenes has insufficient concentrations of the nickelcofactor to support enzymatic activity (21). Based on theseobservations, it is generally believed that urease accessory pro-teins facilitate nickel incorporation.

Interestingly, accessory protein homologues UreD, UreF,and UreG of K. aerogenes have been copurified with theapourease (31, 32). In recombinant strains overproducingUreD, it was found to be associated with the urease apoprotein(31). Subsequent activation of the apourease was linked toUreD dissociation from the complex (31). Although the prop-erties of UreD have only been examined in K. aerogenes, wespeculated that it also serves as an apourease-specific chaper-one in P. mirabilis, maintaining the optimal protein conforma-tion to facilitate proper assembly of the metallocenter. It isworth noting that other accessory proteins do not appear tocopurify with the apourease in a ureD mutant strain (32). Thus,we propose that UreD may be crucial for the recruitment andstabilization of other accessory proteins in complexes with theapourease.

The P. mirabilis UreE homologue possesses a histidine-richmotif at the carboxyl terminus (18). We exploited this featureto purify UreE protein in a single step with nickel affinitychromatography (38). While full-length UreE homologues

* Corresponding author. Mailing address: Department of Microbi-ology and Immunology, University of Maryland School of Medicine,Baltimore, MD 21201. Phone: (410) 706-0466. Fax: (410) 706-6751.E-mail: hmobley@umaryland.edu.

1423

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

have been reported to bind approximately six nickel ions perdimer (22), recent experiments have shown that UreE trun-cates, lacking the histidine-rich tail, retain some essential nick-el-binding activity (3). It is postulated that nickel ions bound atthe UreE dimer interface (see Fig. 1) may be important fortransfer to the apourease (3, 7). Consistent with the role as aputative nickel donor, P. mirabilis ureE deletion mutants ex-hibit depressed urease activity in minimal medium that can bepartially restored by adding higher concentrations of the metalion (38). To date, UreE has not been demonstrated to interactwith either apourease or coaccessory proteins.

Most urease accessory gene sequences do not exhibit exten-sive homology with other genes accessible in the GenBankdatabase. However, UreG is an interesting exception; the pre-dicted amino acid sequence shares similarities with a P-loopmotif (PROSITE accession no. PDOC00017) which is charac-teristic of a variety of ATP- and GTP-binding proteins (21, 39).Equally important is the fact that the UreG amino acid se-quence is somewhat related to the HypB protein (21). ThehypB gene is part of the hydrogenase pleiotropic operon that isrequired for GTP-dependent activation of nickel-containinghydrogenases (23, 41). Limited research on the mechanism ofUreG in K. aerogenes has been reported (28, 37). Complexescomprised of UreD, UreF, and UreG have been shown to bindnucleotide-linked resin and enhance apourease activation invitro in a GTP-dependent manner; however, direct observa-tions of UreG interactions with GTP are lacking (28, 37).Consistent with deoxynucleoside triphosphate requirements,P-loop variants of UreG have been correlated with reducedurease activity (28). Limited data suggest that UreG, as well asUreF, can bind to the UreD-apoprotein complex (32). Wheth-er these associations are directly mediated by UreD is specu-lative and requires additional research.

Our objective was to identify how individual urease acces-

sory proteins interact with the apourease and coaccessory pro-teins during the process of nickel incorporation. The signifi-cance of this work extends beyond understanding a crucialvirulence factor of a widespread uropathogen. Findings re-ported here could be generalized to ureases produced by manyother species (25), as well as have implications for how othermetalloenzyme systems are activated. We conducted in vitroimmunoprecipitation experiments and an in vivo yeast two-hybrid assay to screen for protein-protein interactions. In thisstudy, we have identified new interactions involving P. mirabilisurease accessory proteins and confirmed previously describedinteractions among urease structural polypeptides.

MATERIALS AND METHODS

Strains and materials. Recombinant DNA constructs reported here or else-where were maintained in Escherichia coli DH5a (Table 1). Cloned P. mirabilisurease genes were expressed in E. coli DH5a and BL21(DE3)(pLysS) for im-munoprecipitation experiments. The Saccharomyces cerevisiae strains and plas-mids used in the two-hybrid studies (Table 1) were described in detail by Ausubelet al. (1). P. mirabilis HI4320, a urease-positive clinical isolate, was the originalsource of the urease genes (17) used in this study and served as an apoureasecontrol in immunoprecipitation experiments (Table 1). Culture medium compo-nents were purchased from Bio 101, Inc. (La Jolla, Calif.), and Sigma (St. Louis,Mo.). Restriction endonucleases, DNA polymerases, and other DNA-modifyingenzymes were obtained from either Gibco BRL (Rockville, Md.) or New En-gland Biolabs (Beverly, Mass.). All immunological and chemical reagents, unlessotherwise specified, were obtained from Sigma.

Recombinant DNA techniques. Recombinant DNA techniques, including re-striction endonuclease digestion, DNA precipitation, agarose gel electrophore-sis, T4 DNA ligation, and CaCl2 or lithium acetate DNA transformation, wereperformed in accordance with standard protocols (1, 19, 35). All PCR productsand DNA restriction fragments were purified prior to ligation reactions byagarose gel electrophoresis and Qiaquick Gel Extraction (Qiagen, Valencia,Calif.) following the manufacturer’s instructions. Plasmid DNA was isolatedfrom yeast using a glass bead lysis procedure and phenol-chloroform extraction(1). Prior to restriction endonuclease analysis, yeast-extracted plasmids wereamplified in E. coli DH5a. Plasmid DNA was isolated from bacterial cells either

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Description Reference(s) or source

Escherichia coliDH5a supE44 DlacU169 (f80 lacZDM15) hsdR17 recA endA1 gyrA96 thi-1 relA1 35BL21(DE3)(pLysS) B F2 dcm ompT hsdS (rB mB) gal l(DE3)(pLysS) Camr 35

Proteus mirabilis HI4320 Urease-positive clinical isolate 26

Saccharomyces cerevisiaeEGY48 his3 trp1 ura3 leu2 (4 lexA operators preceding leu2) 8, 11EGY191 his3 trp1 ura3 leu2 (1 lexA operator preceding leu2) 8

Cloning vectorspBS SK1 lacZ Ampr StratagenepMALC-2 malE Ampr New England Biolabs

Recombinant P. mirabilis ure genespMID1010 P. mirabilis ureDABCEFG Ampr 17p1701.1 P. mirabilis ureDABC Ampr 38pDBC P. mirabilis ureDBC Ampr This study

Two-hybrid vectorspEG202 lexA his3 Ampr 11pJG4-5 gal1 B42 1 HA epitope tag trp1 Ampr 34pJK101 gal1 2 lexA operators preceding lacZ ura3 Ampr 4pSH18-34 8 lexA operators preceding lacZ ura3 Ampr 42pJK103 1 lexA operator preceding lacZ ura3 Ampr 20

1424 HEIMER AND MOBLEY J. BACTERIOL.

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

by rapid alkaline lysis (2) or on a large scale with Midi DNA purification columns(Qiagen) as described by the manufacturer.

Protein biochemistry techniques. Qualitative and quantitative protein assays,such as sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE),bicinchoninic acid (BCA) protein assay, immunoblotting with alkaline phospha-tase conjugates, enzyme-linked immunosorbent assays (ELISA), and affinitychromatography, were performed in accordance with standard protocols (1)unless otherwise stated. Protease Factor Xa (New England Biolabs) was used inprotein digests in accordance with the manufacturer’s instructions.

Overexpression and purification of proteins UreC and UreD. Using the prim-ers described in Table 2, ureC and ureD were PCR amplified from pMID1010and ligated blunt ended into the EcoRV site of pBS SK1. Isolated as an XhoIfragment, ureC was further subcloned into the corresponding site in vectorpMALC-2 (New England Biolabs). The resulting plasmid encoded a malE fusionto the 59 end of ureC; likewise, ureD was directionally subcloned as an EcoRI-XhoI fragment into pMALC-2 to produce a malE-ureD fusion. Fusion plasmids(pmalC and pmalD) were transformed into E. coli DH5a for overexpression andmaintained under ampicillin selection at 100 mg/ml (1). Individual transformantswere cultured in 100 ml of Luria broth under antibiotic selection at 37°C withaeration, induced in mid-exponential phase with 0.3 mM isopropyl-b-D-thioga-lactopyranoside (IPTG), and incubated for an additional 2 h. Bacterial cells werecollected by centrifugation (5,000 3 g, 10 min, 4°C) and washed in 5 ml of coldamylose column buffer (20 mM Tris-HCl [pH 7.4], 200 mM NaCl, 10 mMb-mercaptoethanol, 1 mM EDTA). Washed bacterial pellets were resuspendedin 5 ml of cold column buffer and ruptured by passage through a French press at18,000 lb/in2. Unbroken cells and insoluble material were removed by centrifu-gation (14,000 3 g, 30 min, 4°C). MalE-UreC and MalE-UreD fusion proteinswere purified from the soluble fraction by passing lysate, diluted 1:5 in theabove-described buffer, over a 1-ml amylose resin column (New England Bio-labs) prepared in accordance with the manufacturer’s instructions. Bound pro-teins were washed in 20 ml of the amylose column buffer, eluted in 30 ml ofcolumn buffer containing 10 mM maltose, and collected as 3-ml fractions (1).MalE fusions were identified in eluted fractions by BCA assay (Pierce, Rockville,Ill.), as well as in SDS–10% polyacrylamide gels stained with Coomassie brilliantblue (1). UreC and UreD were cleaved from MalE by digestion with proteaseFactor Xa (New England Biolabs) and separated by preparative SDS-PAGE (1).Proteins that were embedded in SDS–10% polyacrylamide gel were pooled andstored at 220°C for later use.

Preparation of polyclonal antisera to UreD and MalE-UreC. Polyclonal rabbitsera were generated using approximately 100 mg of purified UreD embedded inSDS-polyacrylamide. The gel was emulsified in Freund’s complete adjuvant andused to immunize two New Zealand White rabbits by subcutaneous injection.Three 30-mg boosters were similarly administered at 3-week intervals withFreund’s incomplete adjuvant. In an analogous manner, purified MalE-UreCwas also used to immunize two New Zealand White rabbits. Specific UreD andMalE-UreC antibodies were isolated from rabbit antisera by affinity chromatog-raphy utilizing MalE-fusion proteins immobilized on an Aminolink column(Pierce) in accordance with the manufacturer’s instructions. Bound antibodieswere washed progressively with (i) 10 mM Tris-HCl (pH 7.5), (ii) 10 mM Tris-HCl (pH 7.5)–500 mM NaCl, (iii) 100 mM glycine (pH 2.5) collected in 1.0 MTris-HCl (pH 8.0), (iv) 1.0 M Tris-HCl (pH 8.0), and (v) diethanolamine (pH11.3) collected in 1.0 M Tris-HCl (pH 8.0). Specific antibodies that recognize theUreD and MalE-UreC proteins were found in the 100 mM glycine (pH 2.5)eluates neutralized with 10 mM Tris-HCl (pH 8.0).

Preparation of monoclonal antibodies to UreC and UreD. Purified UreC andUreD proteins embedded in SDS-polyacrylamide were supplied to BioWorldLaboratories (Dublin, Ohio) for the production of monoclonal antibodies.Briefly, 12 BALB/c mice were injected with a homogeneous mixture of UreC andUreD, followed by four boosters at 2-week intervals. ELISA analysis of antiseraidentified two mice as having suitable ratios of MalE to MalE-UreC to MalE-

UreD antibody titers, specifically, 1:20:52 and 1:5:2. Isolated murine spleen cellswere fused with a select myeloma cell line (Bioworld) to generate hybridomas; ina similar manner, hybridoma supernatants were screened by ELISA againstMalE, MalE-UreC, and MalE-UreD. Hybridomas, identified by the secretion ofUreC- or UreD-specific antibodies, were used to produce ascites and expandedfor frozen storage.

Construction of pDBC. Using the primers described in Table 2, ureD was PCRamplified from the P. mirabilis gene cluster encoded by pMID1010. An 800-bpDNA fragment encoding ureD was subcloned into the EcoRV site of pBS SK1.The insertion of ureD was confirmed by restriction endonuclease mapping. Theresulting vector (pDT7) encoded ureD under the control of a T7 promoter.Subsequently, ureBC was PCR amplified with the 59 primer described for ureBand the 39 primer outlined for ureC (Table 2). An ;2.0-kb PCR product wassubcloned into the SmaI site of pDT7. Restriction endonuclease mapping verifiedthat the ureBC genes were transcribed in the same direction as ureD. Thisconstruct was transformed into E. coli BL21(DE3)(pLysS) for expression.

Coimmunoprecipitation of recombinant urease proteins. P. mirabilis HI4320,E. coli DH5a, and E. coli BL21(DE3)(pLysS), transformed with recombinant P.mirabilis urease genes, were cultured in 100 ml of L broth under appropriateantibiotic selection with aeration at 37°C. P. mirabilis HI4320 and E. coli DH5acultures were induced in early exponential-phase growth with 50 mM urea andallowed to incubate until growth reached late log phase. E. coli BL21(DE3)(pLysS) strains containing pBS SK1 and pDBC were induced in early exponen-tial phase with 0.3 mM IPTG. Bacterial cells were harvested by centrifugation(5,000 3 g, 10 min, 4°C), washed with 10 ml of 50 mM HEPES buffered at pH7.5, and resuspended in 5 ml of 50 mM HEPES (pH 7.5). Washed cells werepassed through a French press at 18,000 lb/in2, and lysates were cleared of debrisby centrifugation (5,000 3 g, 10 min, 4°C). Protein concentrations of the lysateswere estimated by BCA assay (Pierce) in accordance with the manufacturer’sinstructions. Bacterial extracts (;2 to 4 mg/ml) were gently mixed with 5 ml ofanti-UreC or anti-UreD ascites in a final volume of 0.5 ml at 4°C for 2 h (12).Immunocomplexes were precipitated with 150 ml of protein A-Sepharose beads(Sigma) and washed in accordance with the manufacturer’s instructions. Boundproteins were resuspended in 100 ml of Laemmli sample buffer and incubated at100°C for 5 min (12). Denatured immunoprecipitated proteins (20 ml) wereseparated in an SDS–12% polyacrylamide gel and electroblotted onto a polyvi-nylidene difluoride membrane (Millipore) (1). Coimmunoprecipitated proteinswere immunoblotted with affinity-purified rabbit antisera against MalE-UreCand UreD overnight at 4°C, washed, and treated with anti-rabbit immunoglob-ulin G conjugated to alkaline phosphatase (Sigma) in accordance with the man-ufacturer’s instructions. Alkaline phosphatase conjugates were visualized with5-bromo-4-chloro-3-indolylphosphate (BCIP)–Nitro Blue Tetrazolium (NBT).

PCR amplification. P. mirabilis ure genes were individually PCR amplifiedfrom the recombinant ure cluster encoded by pMID1010 (17) using Vent DNApolymerase (Boehringer Mannheim, Indianapolis, Ind.) in an MJ Research Mini-cycler in accordance with the manufacturer’s instructions. The DNA primersused to PCR amplify the ure genes are summarized in Table 2. Agarose-purifiedPCR products were ligated into pBS SK1, and constructs were confirmed byrestriction endonuclease digestion. All of the PCR primers used in this studywere designed to encode EcoRI and XhoI recognition sites that allowed direc-tional cloning of the ure genes into pEG202 and pJG4-5.

Subcloning of ure genes into two-hybrid vectors. Recombinant ure genes wereisolated from pBS SK1 by restriction endonuclease digestion with EcoRI andXhoI, gel purified, and ligated into the corresponding restriction sites in pEG202and pJG4-5. The resulting DNA constructs fused urease genes to the 39 end oflexA and B42, respectively.

DNA sequencing. The junctions of p202 and p45 derivatives encoding ureA,ureB, ureE, and ureG fusions in addition to p202C, p202D, and p202F weresequenced to confirm that each recombinant plasmid coded an in-frame fusionby the dideoxy-chain termination method (36) at the University of Maryland at

TABLE 2. PCR primers used to amplify urease genes

P. mirabilis gene Forward primer Reverse primer

ureA 59 AGCAGTAATGGAATTCACAC 39 59 GATCAGCTCGAGACCTACAC 39ureB 59 ACTCGAATTCTGTGTAGGTA 39 59 TAAGCTCGAGGTGTGATAGT 39ureC 59 ATGGAATTCACCTCACGTCA 39 59 CTCACTCGAGACGCTGGTTA 39ureD 59 AAGTTGGAATTCGTGGGTATG 39 59 CCATCTCGAGTCCTAAAATAAAC 39ureE 59 AACGGAATTCTTTACTCAG 39 59 TGCGAATTCTTGGATGATC 39ureF 59 TGGGAATTCGATCATCAAAG 39 59 TGGGGAATTCTGGCGATCAC 39ureG 59 TGAGAATTCGTGATGCAAGA 39 59 ACCCATACTCGAGCTCATAG 39

VOL. 183, 2001 UREASE STRUCTURAL AND ACCESSORY PROTEIN INTERACTIONS 1425

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

Baltimore Biopolymer Core Facility (Applied Biosystems 373A automated DNAsequencer with the Big Dye Terminator Cycle Sequencing Kit). Fusion junctionsof p45C, p45D, and p45F were sequenced using a [35S]dATP Sequenase kit(Amersham; Arlington Heights, Ill.) in accordance with the manufacturer’s in-structions. The sequencing primers used in this study were (i) pEG202-derivedconstructs (p202; 59-TGTTGCCAGAAAATAGCGAG39) and (ii) pJG4-5-de-rived constructs (p45; 59 TGACTGGCTGAAATCGAATG39).

Immunoblots to confirm expression of LexA- and B42-urease fusions. S. cer-evisiae EGY48 (p202- and p45-ure derivatives) were grown in 3 ml of syntheticdefined dropout medium (Ura2 His2 Trp2) containing 2% (wt/vol) galactoseovernight at 30°C with aeration. (Note that p45-ure fusions are regulated by thegal1 promoter.) Cultures were diluted 1:15 into 3 ml of fresh medium and grownfor an additional 7 h. Each culture was harvested by adding 30 ml of polyethyleneglycol 3350 (50% [wt/vol] stock solution) and centrifuged (5,000 3 g, 10 min,4°C). The resulting pellets were concentrated 20:1 in Tris-EDTA containingLaemmli sample buffer and then denatured at 100°C for 5 min (1). Lysates wereseparated by electrophoresis (Mighty Small II; Hoefer, San Francisco, Calif.)through an SDS–12% polyacrylamide gel in accordance with standard protocolsusing sample sizes that were ;15% of the total lysate volume. Separated proteinswere electroblotted to a polyvinylidene difluoride membrane (Immobilon-P;Millipore, Bedford, Mass.); afterwards, the membrane was blocked with 1%(wt/vol) bovine serum albumin–TTBS (100 mM Tris-HCl [pH 7.5], 150 mMNaCl, 0.1% [wt/vol] Tween 20) and washed with TTBS in accordance withstandard protocols (1). Membranes blotted with EGY48(p202-ure) lysates weregently agitated overnight at 4°C in TTBS containing LexA antiserum diluted1:5,000, whereas antihemagglutinin (anti-HA) monoclonal antibody (BoehringerMannheim) was diluted 1:260 to treat blots of EGY48(p45-ure) lysates overnightat 4°C (1). Anti-rabbit immunoglobulin G and anti-mouse polyvalent immuno-globulin conjugated to alkaline phosphatase were used to identify primary anti-bodies bound to LexA and B42 derivatives, respectively, in accordance with themanufacturer’s instructions. Alkaline phosphatase conjugates were visualizedwith BCIP-NBT.

Repression assay to confirm DNA-binding properties of LexA-urease fusions.Yeast strains bearing p202-ure derivatives and pJK101 were grown at 30°C withaeration to mid-exponential phase in 5 ml of synthetic, defined-dropout medium(Ura2 His2) containing 1% (wt/vol) raffinose–2% (wt/vol) galactose, which in-duces the lacZ reporter encoded by pJK101 (1). Cultures were collected by theaddition of 50 ml of polyethylene glycol 3350 (50% [wt/vol] stock solution) andcentrifugation at 5,000 3 g for 10 min. Cell pellets were resuspended in an equalvolume of Z buffer at pH 7.0 (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl,1 mM MgSO4, 50 mM b-mercaptoethanol]. b-Galactosidase activities producedby each strain were measured in triplicate with a standard chromogenic assayusing o-nitrophenyl-b-D-galactopyranoside substrate (1). These activities are re-ported as percentages of the b-galactosidase activity produced by strainEGY48(pJK101), which was arbitrarily set at 100%.

Background transcriptional activity of LexA- and B42-urease fusions. LexA-and B42-urease protein fusions were assessed for endogenous transcriptionalactivity in S. cerevisiae strain EGY48(pSH18-34), which bears an integrated leu2reporter and a plasmid-borne lacZ reporter. EGY48(p202-ure) derivatives weregrown at 30°C for 5 or 6 days on the following synthetic, defined-dropout agarmedia: (i) Ura2 His2 Leu2 medium with 2% (wt/vol) glucose (ii) Ura2 His2

Leu2 medium with 1% (wt/vol) raffinose and 2% (wt/vol) galactose, (iii) Ura2

His2 medium with 2% (wt/vol) glucose and 2.5 mg of 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal) per ml; and (iv) Ura2 His2 medium with1% (wt/vol) raffinose, 2% (wt/vol) galactose, and 2.5 mg of X-Gal per ml. Strainswere scored daily for growth on leucine-deficient medium and the formation ofblue patches on X-Gal-containing medium (1). Similarly, EGY48(p45-ure) de-rivatives were grown on the following supplemented dropout media: (i) Ura2

Trp2 Leu2 medium containing 2% (wt/vol) glucose, (ii) Ura2 Trp2 Leu2

medium with 1% (wt/vol) raffinose and 2% (wt/vol) galactose, (iii) Ura2 Trp2

medium containing 2% (wt/vol) glucose and 2.5 mg of X-Gal per ml, and (iv)Ura2 Trp2 medium containing 1% (wt/vol) raffinose, 2% (wt/vol) galactose, and2.5 mg of X-Gal per ml. These strains were also scored for the same character-istics indicative of reporter activation. If within 1 or 2 days a fusion exhibitedgrowth on leucine-deficient medium or blue patches on X-Gal-containing agar,the endogenous transcriptional activity was considered too strong for use in aninteractive assay. As an alternative, constructs encoding transcriptionally activefusions were transformed into yeast strain EGY191(pJK103). EGY191 containsan integrated leu2 reporter downstream of a single LexA operator and is signif-icantly less sensitive than strain EGY48, which contains four operators. Likewise,pJK103 has one LexA operator upstream of a lacZ reporter gene versus pSH18-34, which has eight operators (8, 20). Transformants were reevaluated as de-scribed above for transcriptional activating properties.

Screening for urease-protein interactions via two-hybrid system. Fusions en-coded by p202A, p202B, p202E, p202F, and p202G (i.e., LexA) were transformedinto yeast strain EGY48(pSH18-34) and maintained on synthetic, defined-drop-out agar medium (Ura2 His2 medium with 2% [wt/vol] glucose). In parallel,p202D was transformed into less-sensitive reporter strain EGY191(pJK103).Each p202-ure transformant was independently retransformed with constructsencoding B42-ure fusions (p45A, p45B, p45C, p45D, p45E, p45F, and p45G) andselected on dropout medium (Ura2 His2 Trp2 medium with 2% [wt/vol] glu-cose). Transformants carrying dual-fusion plasmids were grown at 30°C for 5 or6 days on the following synthetic, defined-dropout agar media: (i) Ura2 His2

Trp2 Leu2 medium with 2% [wt/vol] glucose, (ii) Ura2 His2 Trp2 Leu2 me-dium with 1% (wt/vol) raffinose and 2% (wt/vol) galactose, (iii) Ura2 His2 Trp2

medium prepared with 2% glucose and 2.5 mg of X-Gal per ml, and (iv) Ura2

His2 Trp2 medium prepared with 1% (wt/vol) raffinose, 2% (wt/vol) galactose,and 2.5 mg of X-Gal per ml. Interactive strains were scored each day for growthon leucine-deficient medium and the formation of blue patches on X-Gal-con-taining medium (1). Yeast strains maintaining vector controls were plated along-side each interactive strain for comparison.

RESULTS

Polyclonal and monoclonal antibodies against urease pro-teins. Polyclonal and monoclonal antibodies were generatedagainst two urease proteins. A translational fusion of UreC,the largest structural subunit, and the maltose-binding protein(MalE) was used for immunization of New Zealand Whiterabbits. Using a slightly different approach, an affinity-purifiedMalE-UreD fusion was digested with protease Factor Xa torelease the UreD polypeptide. The products of the proteasedigests were separated in an SDS-polyacrylamide gel (data notshown), and isolated UreD polypeptide was used to immunizeNew Zealand White rabbits. Similar to the strategy employedfor UreD polyclonal antisera production, purified MalE-UreCand MalE-UreD fusions were also cleaved by protease FactorXa to generate UreC and UreD polypeptides. Purified pro-teins were also used for the commercial production and isola-tion of monoclonal antibodies.

Coimmunoprecipitation of accessory protein UreD with ure-ase structural proteins. Several metalloenzymes, dependenton accessory proteins for activation, require direct contactbetween the apoenzyme and an accessory protein in vitro priorto metal incorporation (5, 13, 32). To address whether analo-gous interactions occur with P. mirabilis urease, UreC wasimmunoprecipitated from lysates of E. coli DH5a expressingthe P. mirabilis urease gene cluster encoded by pMID1010 andscreened for coprecipitating accessory proteins. E. coli DH5a(pMID1010), regardless of whether it is cultured in modifiedM9 medium or Luria broth, produces similar amounts of activeurease as measured by a phenol-hypochlorite urease assay(data not shown). However, immunoblotting of lysates with af-finity-purified MalE-UreC antiserum revealed a greater quan-tity of UreC soluble protein from cultures grown in L broth(data not shown). If P. mirabilis urease is in an active state afterassociating with its accessory proteins, possibly a greater pro-portion of urease is in a prebound or bound state in lysates ofL broth cultures as the result of nickel chelation by mediumcomponents.

Thus, lysates of E. coli DH5a(pMID1010) were preparedfrom L broth cultures, immunoprecipitated with monoclonalUreC antibodies, and analyzed by immunoblotting with affin-ity-purified antisera to MalE-UreC and UreD. Immunoblotsconfirmed that UreC is expressed and precipitated from lysatesof E. coli DH5a(pMID1010) grown in the presence of 50 mM

1426 HEIMER AND MOBLEY J. BACTERIOL.

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

urea (Fig. 1B). MalE-UreC antiserum reacts with an expected60-kDa protein band in the crude fraction (Fig. 1B, lane 1) andpellet (Fig. 1B, lane 3). A comparable protein band is nearlyundetectable in lysates of uninduced cultures (Fig. 1A, lanes 1and 3). Likewise, a 60-kDa protein is detected in neither thesupernatant nor the pellet of control immunoprecipitations inwhich no lysate was added (data not shown). Consistent withour predictions, the accessory protein UreD coprecipitatedwith UreC, as shown in Fig. 1C. An appropriately sized 30-kDaprotein band reacted strongly with UreD antiserum in thecrude lysate and pellet of UreC-immunoprecipitated lysatesfrom induced cultures (Fig. 1C, lanes 1 and 3). Similar proteinbands were not detected in uninduced lysates and control im-munoprecipitations comprised of monoclonal antibodies alone(data not shown).

In a complementary experiment, identical lysates were pre-cipitated with monoclonal anti-UreD antibody. A faint, butdistinct, 30-kDa protein band noted in the immunoblot (Fig.1C, lane 5) verifies that UreD was present in the precipitate.Moreover, UreC was also detected in UreD-mediated immu-noprecipitations of induced cultures (Fig. 1B, lane 5) and ab-sent in uninduced cultures (Fig. 1A, lane 5). In these experi-ments, two additional protein bands were noted to cross-reactwith the polyclonal antisera; the light chain of monoclonalUreD antibodies is observed as a 25-kDa protein in Fig. 1C,and an unknown protein with mobility similar to that of UreCwas seen in crude cultures and supernatants. Since this proteinwas not seen in the pellet fraction, it was regarded as a non-specific reaction with an E. coli protein. Altogether, theseresults demonstrate that UreC, a structural component of ure-ase, and the accessory protein UreD are both present in amultiprotein complex.

To assess whether a similar complex containing UreC andUreD polypeptides existed in P. mirabilis, lysates were pre-pared from wild-type strain HI4320 grown under inducing con-ditions (50 mM urea) in L broth and precipitated separatelywith monoclonal anti-UreC and -UreD antibodies. An immu-noblot shows that the 60-kDa UreC protein is present in thepellets of both precipitation reactions (Fig. 2B, lanes 3 and 5),whereas UreC is barely detectable in precipitations of lysatesfrom uninduced cultures (Fig. 2A, lanes 3 and 5). These ob-servations corroborate experiments involving the recombinanturease; this implies that accessory protein UreD and ureasestructural protein UreC are present in a moderately stableprotein complex in wild-type P. mirabilis strain HI4320. It isunclear what fraction of each protein is bound versus freelysoluble protein in these lysates and whether this distributioncontributes to a smaller quantity of UreC in the precipitate.

To establish whether urease coaccessory proteins such asUreE, UreF, and UreG are required for the formation of thesestructures, UreD was immunoprecipitated from lysates of E.coli DH5a carrying cloned P. mirabilis urease genes ureDABC(p1701.1) (38). Immunoblots establish that both UreD (Fig.3A, lane 6) and UreC (Fig. 3B, lane 6) are among the pelletedproteins, whereas neither polypeptide is detected in lysatescontaining the pBS SK1 vector control (Fig. 3A and B, lanes 1to 3). Thus, in the absence of other accessory proteins, UreDstill associates with UreC.

As previously mentioned, K. aerogenes apourease has beenstably purified from strains deficient in accessory proteins (21).Therefore, it is likely in a ureDABC-encoding strain (p1701.1)that UreC is associated with both the UreA and UreB costruc-tural proteins. In light of this information, UreD may be in-volved in a structure that includes three urease structural pro-teins versus freely soluble UreC. Under these circumstances, itis possible that UreD is associated with UreC in an indirectmanner or interacts directly with UreC only in the context ofthe apourease. To test these hypotheses, UreD was immunopre-cipitated from lysates expressing only ureDBC and not ureA.If the association between UreD and UreC depends on UreA,

FIG. 1. Immunoblots illustrating that UreC and UreD coimmuno-precipitate from lysates of E. coli DH5a carrying a recombinant P.mirabilis ure gene cluster (pMID1010). Soluble protein from unin-duced (A) and urea (50 mM)-induced (B and C) E. coli DH5a(pMID1010) was immunoprecipitated with monoclonal anti-UreC(left column) and -UreD (right column) antibodies, separated by SDS–12% PAGE, and immunoblotted with polyclonal anti-UreC serum (Aand B) and anti-UreD serum (C). The immunoblot is representative ofthree experiments. Lanes: 1, crude culture extracts of E. coli DH5a(pMID1010); 2, supernatants (supnt) from UreC immunoprecipitationreactions; 3, solubilized pellets from UreC immunoprecipitation re-actions; 4, supernatants from UreD immunoprecipitation reactions;5, solubilized pellets from UreD immunoprecipitation reactions.

FIG. 2. Immunoblots depicting UreC and UreD coprecipitatingfrom lysates of wild-type P. mirabilis HI4320. Soluble protein fromstrain HI4320, uninduced (A) and induced with 50 mM urea (B), wasimmunoprecipitated with anti-UreC (left column) and -UreD (rightcolumn) monoclonal antibodies, separated by SDS–12% PAGE, andimmunoblotted with polyclonal anti-UreC serum. Lanes: 1, crude cul-ture extracts of HI4320; 2, supernatants (supnt) from UreC immuno-precipitation reactions; 3, solubilized pellets from UreC immunopre-cipitation reactions; 4, supernatants from UreD immunoprecipitationreactions; 5, solubilized pellets from UreD immunoprecipitation reac-tions.

VOL. 183, 2001 UREASE STRUCTURAL AND ACCESSORY PROTEIN INTERACTIONS 1427

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

then UreC should not be found in significant quantities amonganti-UreD precipitates. Clearly, both UreD (Fig. 4C, lane 6)and UreC (Fig. 4D, lane 6) are immunoprecipitated by UreDantibodies. Experiments with UreC antibodies confirmed theseresults by coprecipitating UreC and UreD (Fig. 4A and B, lane6). Unfortunately, neither UreC nor UreB has been expressedindividually in a stable form, preventing similar experiments

with ureB deletions (S. Heimer and H. Mobley, unpublished ob-servation). These data imply that UreA is probably not neces-sary for UreD associations with UreC. It is uncertain whetherUreB is directly or indirectly involved with the association.

Expression of urease genes as lexA and b42 fusions. Toexamine interactions of urease structural and accessory pro-teins in vivo, a yeast two-hybrid assay was employed that makesuse of the DNA-binding domain of LexA and a transcriptionalactivation epitope called B42 (11). To prepare for two-hybridscreens, P. mirabilis urease genes ureDABCEFG were individ-ually PCR amplified and cloned into pBS SK1.

The derivatives of pEG202 and pJG4-5 (p202-ure and p45-ure, respectively) were transformed into S. cerevisiae strainEGY48, and the transformants were assayed for fusion proteinexpression by immunoblotting. On an anti-LexA immunoblotof whole lysates of various yeast transformants, unique proteinbands of 33 and 34 kDa were observed (Fig. 5A, lanes 1 and 2)which are consistent with the expected sizes of LexA fusionswith urease structural proteins UreA and UreB, respectively.Likewise, expression of urease accessory proteins UreD, UreE,and UreF as fusions with LexA were detected by anti-LexAimmunoblotting (Fig. 5A, lanes 3, 4, and 5) as 52-, 42-, and 43-kDa protein bands, respectively. Accessory protein UreG fusedto LexA is predicted to migrate as a 47-kDa protein. Unfortu-nately, fusion proteins in this size range cannot be identifiedconclusively due to a cross-reacting band recognized by theLexA antiserum. Several protein bands resembling truncates ofa LexA-UreC fusion were detected in the lysate of EGY48(p202C) transformants; however, a full-length fusion productwas not observed by Western blot analysis (data not shown).

To identify B42 epitope fusions, whole lysates of EGY48(p45-ure) derivatives were immunoblotted with a commerciallyavailable anti-HA antibody which recognizes the HA epitope

FIG. 3. Immunoblots demonstrating that recombinant UreC andUreD coprecipitate in the absence of coaccessory proteins. Cultures ofE. coli DH5a(pBS SK1) (vector control) and DH5a(p1701.1) (encod-ing ureDABC) were induced with 50 mM urea. Soluble protein wasimmunoprecipitated with anti-UreD monoclonal antibodies, separatedby SDS–12% PAGE, and immunoblotted with anti-UreD polyclonalserum (A) and anti-UreC polyclonal serum (B). Lanes: 1, crude cul-ture extracts of E. coli DH5a(pBS SK1); 2, supernatants (supnt) col-lected from immunoprecipitation reactions of E. coli DH5a(pBSSK1); 3, solubilized pellets from immunoprecipitation reactions of E.coli DH5a(pBS SK1); 4, crude culture extracts of E. coli DH5a(p1701.1); 5, supernatants collected from E. coli DH5a(p1701.1) im-munoprecipitation reactions; 6, solubilized pellets from E. coli DH5a(p1701.1) immunoprecipitation reactions.

FIG. 4. Immunoblots revealing that UreC and UreD coprecipitate in the absence of UreA. Soluble protein from IPTG-induced cultures of E.coli BL21(DE3)(pLysS)(pBS SK1) and (pDBC) was immunoprecipitated with anti-UreC (left column) and anti-UreD (right column) monoclonalantibodies, separated by SDS–12% PAGE, and immunoblotted with anti-UreC polyclonal serum (A and D) and anti-UreD polyclonal serum (Band C). Lanes: 1, crude culture extracts of E. coli (pBS SK1); 2, supernatants (supnt) from immunoprecipitation reactions of E. coli (pBS SK1);3, solubilized pellets from immunoprecipitation reactions of E. coli (pBS SK1); 4, crude culture extracts of E. coli (pDBC); 5, supernatants fromE. coli (pDBC) immunoprecipitation reactions; 6, solubilized pellet from E. coli (pDBC) immunoprecipitation reactions. ctrl, control.

1428 HEIMER AND MOBLEY J. BACTERIOL.

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

also encoded by pJG4-5 (1, 11). B42 epitope fusions and UreBwere noted at 25 and 26 kDa (Fig. 5B, lanes 1 and 2, respec-tively), consistent with their predicted molecular weights. Ac-cessory gene ureD, ureE, and ureF fusions with b42 were foundto produce appropriately sized fusion proteins migrating at 42,30, and 34 kDa (Fig. 5B, lanes 4, 5, and 6). Lysates of EGY48(p45C) produced several truncated B42-UreC polypeptides,but a full-length fusion product was not detectable (Fig. 5B,lane 3). Anti-HA immunoblotting also failed to detect a uniqueprotein band of the size expected for a B42-UreG fusion (Fig.5B, lane 7).

Thus, Western blotting has confirmed that structural pro-teins UreA and UreB are stably expressed as LexA and B42epitope fusions in yeast, as well as accessory proteins UreD,UreE, and UreF. Structural protein UreC is probably ex-pressed as both LexA and B42 epitope fusions; however, thestability of these fusions is questionable, as indicated by thevarious immunoreactive truncated products. Contrary to pre-dictions made from DNA sequence analysis, accessory proteinUreG was not detected as either a LexA or a B42 fusion.

Repression assay confirms DNA-binding activity of LexAfusions. To verify that the LexA DNA-binding domain re-tained its sequence-specific recognition and DNA-binding ac-tivity as a fusion in S. cerevisiae, EGY48(p202-ure) derivativeswere transformed with pJK101. This construct is designed suchthat lexA operators, derived from colE1, interrupt the gal1

promoter upstream of lacZ (1, 4). If a LexA fusion bindsspecifically to these sites, galactose-inducible lacZ transcrip-tion will be repressed. In this study, b-galactosidase activity wasmeasured in triplicate for each transformant and reported as apercentage of the activity detected in the positive control,EGY48(pJK101). All strains cotransformed with p202-ure de-rivatives of the accessory genes and pJK101 produced less than20% of the b-galactosidase activity measured in EGY48(pJK101). Likewise, structural protein LexA-UreA and LexA-UreB fusions also repressed lacZ expression to less than 5.0%of uninhibited reporter levels. Surprisingly, p202C and pJK101cotransformants had high b-galactosidase activity (;360%),suggesting that LexA-UreC fusions activate transcription ofthe lacZ reporter upon binding to recognition sites. Theserepression assays demonstrate that urease structural and ac-cessory proteins do not interfere with the DNA-binding func-tions of LexA fusions. However, the LexA-UreC fusion hasenhanced transcriptional activating activity and thus cannot beused for interactive studies with B42 fusions.

Background transcriptional activity of LexA and B42 fu-sions. The two-hybrid system used in this study relies on tworeporter genes, leu2 and lacZ, to assess whether LexA and B42epitope fusions interact in vivo (1, 11). These reporter genesare expressed when a transcriptionally active complex of fusionproteins occupies the LexA-binding sites upstream of theirrespective promoters. In S. cerevisiae strain EGY48, the up-stream activating sequence of leu2 has been with replaced withfour LexA operators from colE1 (1, 8, 11). This strain has beentransformed with the reporter plasmid pSH18-34, which en-codes gal1-lacZ downstream of eight LexA operators (1). It isessential that individual urease protein fusions with eitherLexA or B42 do not modulate expression of these reportergenes in a direct or indirect manner. EGY48(pSH18-34) wasindependently transformed with p202-ure (i.e., LexA) and p45-ure (i.e., B42) derivatives and streaked onto synthetic, defined-dropout agar medium that was either deficient in leucine orcontained 2.5 mg of X-Gal per ml (1). Experiments were per-formed in the presence of 2% glucose or 2% galactose toregulate the expression of B42 fusions. During 5 days of 30°Cincubation, strains were visually scored for growth and color.Background reporter activities were considered significant ifgrowth occurred on leucine-deficient medium and blue patchesformed on X-Gal-containing medium within 2 days of incuba-tion. LexA fusions with structural protein UreC and accessoryprotein UreD were associated with significantly high levels ofreporter activities in the presence of both glucose and galac-tose (data not shown). Within 2 days of incubation, the B42-UreC fusion also exhibited high reporter background levels inyeast strain EGY48(pSH18-34) (data not shown). To compen-sate for the high background levels, alternate reporter systemswere tested which were expected to be less sensitive. These re-porters were S. cerevisiae strain EGY191, which contains onlyone LexA operator upstream of the leu2 gene, and pJK103encoding gal1-lacZ preceded by one LexA operator (1, 20).Unfortunately, alternate p202C transformants continued togenerate high levels of reporter activity and were omitted fromfurther studies (data not shown).

Most fusions produced a low yet detectable level of back-ground activity that appeared in 3 to 4 days of incubation.These reporter activities were considered to be modest, and we

FIG. 5. Immunoblots confirming expression of LexA and B42 epi-tope fusions with urease proteins in S. cerevisiae. Protein extracts fromS. cerevisiae EGY48 carrying p202-ure and p45-ure derivatives wereseparated by SDS-PAGE. (A) EGY48(p202-ure) lysates were reactedwith anti-LexA polyclonal antibodies. Lanes contain lysates of EGY48transformed with plasmids p202A (lane 1), p202B (lane 2), p202D (lane3), p202E (lane 4), p202F (lane 5), and p202G (lane 6). (B) EGY48(p45-ure) lysates were reacted with anti-HA monoclonal antibodies. Lanescontain lysates of EGY48 transformed with plasmids p45A (lane 1), p45B(lane 2), p45C (lane 3), p45D (lane 4), p45E (lane 5), p45F (lane 6), andp45G (lane 7). Alkaline phosphatase-labeled immune complexes werevisualized with the chromogenic substrate BCIP-NBT. Estimated molec-ular sizes are indicated. Truncated arrows denote possible truncated prod-ucts of the B42-UreC fusion (panel B, lane 3) and the expected size offull-length B42-UreG (panel B, lane 7).

VOL. 183, 2001 UREASE STRUCTURAL AND ACCESSORY PROTEIN INTERACTIONS 1429

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

did not anticipate interference with the detection of specificinteractions. This characteristic was noted in strain EGY48(pSH18-34) cotransformed with ureA, ureE, and ureF fusedwith lexA and B42 (data not shown). Comparable results wereobserved with p202D or p45C when expressed in EGY191(pJK103) in the presence of galactose (data not shown).Screens for urease-protein interactions were conducted withstrains expressing this phenotype.

Two-hybrid analysis of structural protein interactions. Fu-sions of lexA with ureA and ureB were individually cotrans-formed into EGY48(pSH18-34) with B42 fusions to ureA, ureB,and ureC. These cotransformants were patched onto a syn-thetic, defined-dropout agar medium that was deficient inleucine or contained 2.5 mg of X-Gal per ml. Each growthexperiment was performed in the presence of 2% glucose or2% galactose. Strains were visually scored for growth and colorover a 5-day period of incubation at 30°C. Striking reporteractivities were observed in EGY48(pSH18-34) strains coex-pressing LexA-UreA and B42 fusions of UreA and UreCwithin 2 to 3 days of inoculation in the presence of galactose.Strains producing LexA-UreA and B42-UreA or B42-UreC(Fig. 6A, right column, rows 2 and 3, respectively) synthesizesignificantly more b-galactosidase than do control strains pro-ducing LexA-UreA and only B42 (right column, row 1), B42-UreA and LexA (left column, row 2), or B42-UreC and LexA(left column, row 3). Comparable observations were made withthe leu2 reporter shown in Fig. 6B. These results were notobserved in the absence of galactose (data not shown). Alto-gether, these results suggest that UreA interacts in vivo withother UreA and UreC polypeptides, which is consistent withX-ray diffraction studies of K. aerogenes urease crystals (15).Reporter activation was not detected among strains carryingureB fusions (data not shown).

Two-hybrid analysis of accessory protein interactions. Toidentify novel interactions between urease accessory proteins,p202E, p202F, and p202G were independently cotransformedinto EGY48(pSH18-34) with B42 fusions of ureD, ureE, ureF,and ureG. Cotransformants were patched onto a synthetic,defined-dropout agar medium that was deficient in leucine orcontained 2.5 mg of X-Gal per ml in the presence of 2%glucose or 2% galactose. During incubation at 30°C, strainswere visually scored for growth and color. P. mirabilis UreEdimers, which were initially characterized by size exclusionchromatography (38), were identified in vivo in this two-hybridscreen. EGY48(pSH18-34) cotransformed with p202E andp45E grew vigorously on medium deficient in leucine (Fig. 6B,

FIG. 6. Urease-protein interactions identified in vivo with a yeasttwo-hybrid assay. EGY48(pSH18-34) bearing p202A, p202E, or p202Fwas transformed with p45A, p45C, p45D, p45E, or p45F. Likewise,p202D EGY191(pJK103) bearing was transformed with p45-ura deriv-atives. Four independent transformants were grown at 30°C for 3 to 4days on synthetic, defined-dropout agar medium (Ura2 His2 Trp2

medium prepared with 1% [wt/vol] raffinose, 2% [wt/vol] galactose,and 2.5 mg of X-Gal per ml [A and C] or Ura2 His2 Trp2 Leu2

medium prepared with 1% [wt/vol] raffinose and 2% [wt/vol] galactose[B]). Interactive strains were scored for the formation of blue colonies(A and C) and growth on leucine-deficient medium (1) (B). Yeaststrains maintaining vector controls were plated alongside each inter-active strain for comparison. Representative plates are shown.

1430 HEIMER AND MOBLEY J. BACTERIOL.

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

right column, row 5) and generated high levels of b-galactosi-dase activity (Fig. 6A, right column, row 5) in the presence ofgalactose compared to strains containing vector control p202E(right column, row 4) or p45E (left column, row 3). LexA-UreFfusions also produced significant amounts of b-galactosidaseactivity when coexpressed with B42-UreD and B42-UreF (Fig.6C, right column, rows 4 and 5, respectively) compared withLexA (left column, row 3) and B42 (right column, row 3)controls in the presence of galactose. Protein interactions in-volving the LexA-UreD fusion were examined with less sensi-tive reporters (EGY191 and pJK103) due to high backgroundactivity. When UreD was coexpressed as a LexA and B42fusion in the presence of galactose, levels of b-galactosidaseactivity suggestive of in vivo protein interactions were observed(Fig. 6C, right column, row 2). Controls for B42-UreD andLexA-UreD are also shown (left column, row 1, and right col-umn, row 1, respectively). The reporter activities describedhere were not detectable in the absence of galactose; hence,these activities are not the result of non-specific interactionsbut require both LexA and B42 fusions.

Using a similar strategy, EGY48(pSH18-34) cotransfor-mants of p202A and p202B combined with p45D, p45E, p45F,or p45G were screened for interactions. Five days followinginoculation, significant levels of reporter activity were lackingin these strains (data not shown). Thus, direct interactionsbetween these urease structural and accessory proteins werenot detectable in vivo.

In summary, UreD and UreF proteins were found in vivo toform homomultimeric structures using a yeast two-hybrid as-say. The accessory protein UreD was observed to associate invivo with coaccessory protein UreF. Finally, the formation ofUreE protein homomultimers was confirmed in vivo.

DISCUSSION

A variety of mechanisms for the synthesis and assembly ofmetalloenzymes have been described in the literature. In sev-eral instances, accessory (i.e., nonstructural) proteins are re-quired for the production of catalytically active metalloen-zymes (24). These accessory proteins are postulated to servevarious functions, including cofactor synthesis, metal ion ch-elators or donors, and deoxynucleoside triphosphatases, as wellas chaperones and proteases of structural proteins. It is likelythat some accessory proteins require physical contact with theirrespective apoenzyme or other coaccessory proteins to fulfillthese putative roles and facilitate proper metal ion incorpora-tion. One group of multipolypeptide complexes has been ob-served in studies of K. aerogenes urease involving three acces-sory proteins (UreD, UreF, and UreG) and the apourease (27,31, 32). The interactions stabilizing these protein complexesweaken in the presence of nickel, and the accessory proteinsdissociate from the apourease as it becomes enzymatically ac-tive (31, 32). Similar metal ion-dependent interactions havebeen reported between K. pneumoniae apodinitrogenase andNifY protein (13), as well as Streptomyces apotyrosinase andMelC1 (5).

To identify whether analogous and heretofore unrecognizedinteractions occur between P. mirabilis apourease and acces-sory proteins, monoclonal antibodies to UreC and UreD wereused to precipitate protein complexes from P. mirabilis and

E. coli DH5a expressing cloned urease genes. UreC and UreDproteins coprecipitated from strains encoding the entire P. mi-rabilis ure gene cluster (Fig. 1 and 2). These observations areconsistent with the hypothesis that UreD of P. mirabilis inter-acts with the apourease similar to the K. aerogenes homologue(31). Comparable results from immunoprecipitation experi-ments with E. coli DH5a carrying only ureDABC imply that theassociation between UreC and UreD is not mediated by anddoes not require other coaccessory proteins (Fig. 3 and 7A).Corroborating studies with homologues in K. aerogenes havealso been reported (32).

It has been shown that the apourease can be purified fromurease accessory gene mutants, and this protein can be par-tially reactivated with the subsequent addition of nickel undercertain conditions (21, 31). Thus, it is generally accepted thatthe accessory proteins are not involved in apourease assembly.We speculate that UreD associations with UreC in vivo prob-ably do not precede apourease formation. However, it remainsunclear whether UreD interaction occurs exclusively within thecontext of the apourease such that other structural proteins arerequired to stabilize it. Immunoprecipitation experiments us-ing lysates of E. coli DH5a expressing only P. mirabilis ureDBCindicate that UreA is not necessary for UreC and UreD tocoprecipitate (Fig. 4 and 7B). To determine whether UreCalone is sufficient for UreD interaction in vivo, we expressed

FIG. 7. Hypothetical models of P. mirabilis urease interactions withstructural and accessory proteins. (A) The 6,500-bp P. mirabilis ureasegene cluster encodes eight proteins that comprise, regulate, and as-semble the urease homoenzyme. Previously described UreA and UreEhomomultimeric interactions were confirmed in vivo (Fig. 6) (15, 22,38). Likewise, UreA and UreC structural interactions were also con-firmed in vivo (Fig. 6) (15). (B) UreD associates with UreC in thecontext of the apourease independently of the UreA structural protein(Fig. 4); UreD was arbitrarily drawn contacting the apoenzyme faceopposite UreA; there is no direct evidence for this structure. AlthoughUreD and UreF interact in the absence of structural proteins (Fig. 6),UreD is still capable of associating with the apourease without coac-cessory proteins such as UreF (Fig. 3). (C) Data reported here suggestthat UreD is capable of homomultimeric interactions in vivo (Fig. 6).Based on the homotrimeric nature of the apourease, one explanationfor our observation is that a single molecule of UreD associated withUreABC may interact with additional UreD molecules bound to ad-jacent UreABC heterotrimers. These interactions could stabilize over-all the accessory protein interactions with the apourease and hypothet-ically coordinate nickel uptake among the three active sites of urease.A similar hypothesis could be applied to UreF; homomultimeric UreFinteractions in vivo (Fig. 6) could occur between individual UreFmolecules bound through UreD to adjacent UreABC heterotrimers.The three-dimensional structure of urease is inferred from the closelyrelated urease of K. aerogenes (15).

VOL. 183, 2001 UREASE STRUCTURAL AND ACCESSORY PROTEIN INTERACTIONS 1431

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

UreC as an amino-terminal fusion with LexA and a B42epitope in a yeast two-hybrid system. Unfortunately, UreCfusions affected growth rates and promoted high levels of tran-scription in yeast, which interfered with the detection of mostreporter gene activities (an exception was seen in UreA-UreCinteractions [Fig. 6]). Since ureC was unsuitable for most usesin a two-hybrid assay and was difficult to express by itselfrecombinantly in E. coli DH5a, we are still uncertain whetherthis structural protein directly interacts with UreD. An equallyimportant factor to address is the role played by the structuralprotein UreB in UreD interactions (40).

We postulate that P. mirabilis UreD may function in therecruitment or stabilization of other coaccessory protein asso-ciations with the apourease, in addition to acting as a chaper-one similar to its homologue in K. aerogenes (31). In agreementwith that hypothesis, we have identified a new interaction be-tween UreD and another accessory protein, UreF, in a yeasttwo-hybrid screen for in vivo protein associations (Fig. 7B andC). UreF homologues have been also described as putativechaperones that prevent the binding of nickel ions to the non-carbamylated apourease (27). In a two-hybrid assay involvingLexA-UreF coexpressed with B42-UreD, reporter activitieswere detected in the presence of galactose, which are indica-tive of specific in vivo interactions (Fig. 6C). A direct interac-tion of this kind is also consistent with two prior observationsinvolving urease accessory protein homologues. In one case,the apourease could not be purified in a form associated withUreF from a ureD mutant strain (32). The second observationwas the loss of immunoblot detection of UreD bound toapourease in native gels in the presence of UreF (27). Unfor-tunately, we were unable to confirm UreF and UreD interac-tions with the two-hybrid system when the prior accessoryprotein was fused to the B42 epitope and the latter was ex-pressed as a LexA fusion (data not shown). The transcriptionalactivity of the LexA-UreD fusion may have obscured the de-tection of interactions that generate weaker reporter activity(data not shown).

The homotrimeric nature of P. mirabilis urease poses aninteresting activation barrier; namely, each of the three activesites must acquire and properly coordinate two nickel ions toachieve maximum catalytic activity. It is known that UreDhomologues associate with apourease as multimers, varyingfrom one to three molecules; it is assumed that each moleculeis associated with a separate trimer (32). Furthermore, onecould speculate that P. mirabilis apourease could be boundsimultaneously by three distinct accessory protein complexes,comprised of UreD, UreF, and UreG, at each of the activesites. Hypothetically, accessory proteins bound to one trimer ofthe apourease could interact with another complex of acces-sory proteins anchored to an adjacent trimer. Similar to modelsof cooperactivity, perhaps, conformational changes associatedwith nickel incorporation could be communicated from oneaccessory protein complex to another, affecting the overallenergy required to generate fully active holourease (29). Sim-pler still, initial accessory protein interactions with the apou-rease may stabilize additional accessory complexes assemblingat other active sites through direct protein contact. In thisstudy, two novel interactions were identified in two-hybridscreens, i.e., UreD and UreF self-interactions, which could beexplained sterically by such an arrangement. This observation

emphasizes the likelihood, for example, that UreD can formimportant associations in vivo with other molecules of UreD. Itis not known whether UreD multimers are found within a dis-tinct accessory protein complex associated with the apourease.However, it is feasible that UreD multimers form betweenindividual proteins bound to different trimers of P. mirabilisapourease (Fig. 7B). Similar arguments could be made for theUreF self-interactions detected in vivo (Fig. 7B). If contactsdid occur between accessory proteins bound at different trim-ers, it could serve as a mechanism by which to coordinatenickel uptake in urease. To our knowledge, there has been nodiscussion in the literature of the possibility of cooperativenickel or substrate binding among the three active sites.

It is worth noting that other biologically relevant multimersformed by P. mirabilis urease proteins were detected in vivowith a two-hybrid assay (Fig. 7B). Specifically, the accessoryprotein UreE, coexpressed in yeast as both LexA and B42epitope fusions, yielded reporter activity suggesting homomul-timer formation (Fig. 6). UreE homologues are probably thebest studied of the urease accessory proteins. This protein isinvolved in nickel ion chelation within the cell and regulationof nickel transfer to the apourease (6, 7). UreE has beenpurified from P. mirabilis in a single step on a nickel affinitycolumn and migrated as a dimer on a gel filtration column (38).In a similar fashion, UreA was found with the two-hybridsystem to self-interact in vivo (Fig. 6 A and B). X-ray crystal-lography of K. aerogenes urease indicates that three UreAhomologues are arranged in triad symmetry on the same faceof the apourease (Fig. 7B) (15). This arrangement is stabilizedby interactions between adjacent UreA subunits in addition todirect associations of UreA with the structural protein UreC.Also seen in Fig. 6A and B is evidence supporting the inter-action between structural proteins UreA and UreC in vivo.None of these interactive strains produced significant reporteractivity in the absence of galactose, which argues against non-specific reporter activation. Confirming these biologically sig-nificant interactions among P. mirabilis urease proteins with ayeast two-hybrid system, including the formation of homomul-timers, we believe, validates this method of detection for thepurpose of our study.

We were unable to detect any interactions with UreB andUreG using a two-hybrid system that has been suggested ofhomologues elsewhere (15, 21, 28). Immunoblotting (Fig. 5Aand B) and in vivo DNA-binding assays suggest that UreBfusions are synthesized in yeast; however, the conformation ofthese fusions could be significantly different than that of thewild type, preventing protein interactions. For similar reasons,other possible interactions may have escaped detection as well.Strangely, UreG fusions were not detected in either anti-HAor anti-LexA immunoblots although the DNA constructs werefound to encode in-frame fusions. While protein instabilityseems a reasonable explanation, p202G conferred LexA DNA-binding activity on transformed yeast.

In summary, we have demonstrated that, in P. mirabilis,accessory protein UreD is present in a protein complex con-taining the structural protein UreC. This association occursindependent of other coaccessory proteins and the structuralprotein UreA. It remains unclear whether UreD interacts di-rectly with UreC or if UreB plays a role in this association. Wehave provided evidence for direct interaction between UreD

1432 HEIMER AND MOBLEY J. BACTERIOL.

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

and UreF, a coaccessory protein. This finding is consistent withour hypothesis that UreD also recruits and/or stabilizes otherP. mirabilis accessory proteins in structures involving the apou-rease. In this study, unique homomultimers were observedamong UreD and UreF proteins. We propose that these inter-actions may be important in vivo to stabilize multiaccessoryprotein complexes with the apourease and could play a role incoordinating nickel incorporation among different active sites.Lastly, we have confirmed homomultimeric protein interac-tions, previously described in Klebsiella, such as that of UreAand UreE in addition to the UreA-UreC association in vivo,which validates the use of two-hybrid technology in this study.

ACKNOWLEDGMENTS

We thank Roger Brent (Boston, Mass.), who generously suppliedthe S. cerevisiae strains and plasmids necessary for the two-hybridexperiments; Erica Golemis for supplying the LexA polyclonal anti-serum and discussion of the two-hybrid experiments; ChristopherCoker and David McGee for their critiques of the manuscript; andChristopher Coker, John Fulkerson, and Xin Li for numerous techni-cal suggestions.

This work was supported in part by Public Health Service grantAI23328 from the National Institutes of Health.

REFERENCES

1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G.Seidman, and K. Struhl. 1987. Current protocols in molecular biology.Greene Publishing Associates and Wiley-Interscience, New York, N.Y.

2. Birnboim, H. C., and J. Doly. 1979. Rapid alkaline extraction procedure forscreening recombinant plasmid DNA. Nucleic Acids Res. 7:1513–1523.

3. Brayman, T. G., and R. P. Hausinger. 1996. Purification, characterization,and functional analysis of a truncated Klebsiella aerogenes UreE ureaseaccessory protein lacking the histidine-rich carboxyl terminus. J. Bacteriol.178:5410–5416.

4. Brent, R., and M. Ptashne. 1984. A bacterial repressor protein or a yeasttranscriptional terminator can block upstream activation of a yeast gene.Nature 321:612–615.

5. Chen, L. Y., M. Y. Chen, W. M. Leu, T. Y. Tsai, and Y. H. Lee. 1992. Coppertransfer and activation of the Streptomyces apotyrosinase are mediatedthrough a complex formation between apotyrosinase and its trans-activatorMelC1. J. Biol. Chem. 267:20100–20107.

6. Colpas, G. J., T. G. Brayman, L-J. Ming, and R. P. Hausinger. 1999. Iden-tification of metal-binding residues in the Klebsiella aerogenes urease nickelmetallochaperone, UreE. Biochemistry 38:4078–4088.

7. Colpas, G. J., and R. P. Hausinger. 2000. In vivo and in vitro kinetics of metaltransfer by the Klebsiella aerogenes urease nickel metallochaperone, UreE. J.Biol. Chem. 275:10731–10737.

8. Estojak, J., R. Brent, and E. A. Golemis. 1995. Correlation of two-hybridaffinity data with in vitro measurements. Mol. Cell. Biol. 15:5820–5829.

9. Field, S., and O. Song. 1989. A novel genetic system to detect protein-proteininteractions. Nature 340:245–246.

10. Griffith, D. P., D. M. Musher, and C. Itin. 1976. Urease: the primary causeof infection-induced urinary stones. Investig. Urol. 13:346–350.

11. Gyuris, J., E. Golemis, H. Chertkov, and R. Brent. 1993. Cdi1, a human G1and S phase protein phosphatase that associates with Cdk2. Cell 75:791–803.

12. Harlow, E., and D. Lane. 1988. Antibodies: a laboratory manual. Cold SpringHarbor Laboratory Press, Cold Spring Harbor, N.Y.

13. Homer, M. J., T. D. Paustian, V. K. Shah, and G. P. Roberts. 1993. The nifYproduct of Klebsiella pneumoniae is associated with apodinitrogenase anddissociates upon activation with the iron-molybdenum cofactor. J. Bacteriol.175:4907–4910.

14. Island, M. D., and H. L. T. Mobley. 1995. Proteus mirabilis urease: linker-insertion mutagenesis of the positive activator and accessory genes. J. Bac-teriol. 177:5653–5660.

15. Jabri, E., M. B. Carr, R. P. Hausinger, and P. A. Karplus. 1995. The crystalstructure of urease from Klebsiella aerogenes. Science 268:998–1004.

16. Johnson, D. E., R. G. Russell, C. V. Lockatell, J. C. Zulty, J. W. Warren, andH. L. T. Mobley. 1993. Contribution of Proteus mirabilis urease to persis-tence, urolithiasis, and acute pyelonephritis in a mouse model of ascending

urinary tract infection. Infect. Immun. 61:2748–2754.17. Jones, B. D., and H. L. T. Mobley. 1988. Proteus mirabilis urease: genetic orga-

nization, regulation, and expression of structural gene. J. Bacteriol. 170:3342–3349.18. Jones, B. D., and H. L. T. Mobley. 1989. Proteus mirabilis urease: nucleotide

sequence determination and comparison with jack bean urease. J. Bacteriol.171:6414–6422.

19. Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in yeast genetics.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

20. Karmens, J., P. Richardson, G. Mosialo, R. Brent, and T. Gilmore. 1990.Oncogenic transformation by vRel requires an amino-terminal activationdomain. Mol. Cell. Biol. 10:2840–2847.

21. Lee, M. H., S. B. Mulrooney, M. J. Renner, Y. Markowicz, and R. P. Haus-inger. 1992. Klebsiella aerogenes urease gene cluster: sequence of ureD anddemonstration that four accessory genes (ureD, ureE, ureF, and ureG) areinvolved in nickel metallocenter biosynthesis. J. Bacteriol. 174:4324–4330.

22. Lee, M. H., S. Pankratz, S. Wang, R. A. Scott, M. G. Finnegan, M. K.Johnson, J. A. Ippolito, D. W. Christianson, and R. P. Hausinger. 1993.Purification and characterization of Klebsiella aerogenes UreE protein: anickel-binding protein that functions in urease metallocenter assembly. Pro-tein Sci. 2:1042–1052.

23. Maier, T., A. Jacobi, M. Sauter, and A. Bock. 1993. The product of the hypBgene, which is required for nickel incorporation into hydrogenases, is a novelguanine nucleotide-binding protein. J. Bacteriol. 175:630–635.

24. Maroney, M. J. 1999. Structure/function relationships in nickel metallobio-chemistry. Curr. Opin. Chem. Biol. 3:188–199.

25. Mobley, H. L. T., M. D. Island, and R. P. Hausinger. 1995. Molecular biologyof microbial ureases. Microbiol. Rev. 59:451–480.

26. Mobley, H. L. T., and J. W. Warren. 1987. Urease-positive bacteriuria andobstruction of long-term urinary catheters. J. Clin. Microbiol. 25:2216–2217.

27. Moncrief, M. C., and R. P. Hausinger. 1996. Purification and activation prop-erties of UreD-UreF-urease apoprotein complexes. J. Bacteriol. 178:5417–5421.

28. Moncrief, M. C., and R. P. Hausinger. 1997. Characterization of UreG,identification of a UreD-UreF-UreG complex, and evidence suggesting thata nucleotide-binding site in UreG is required for in vivo metallocenterassembly of Klebsiella aerogenes urease. J. Bacteriol. 179:4081–4086.

29. Monod, J., J. Wyman, and J.-P. Changeux. 1965. On the nature of allosterictransitions: a plausible model. J. Mol. Biol. 12:88–118.

30. Mulrooney, S. B., and R. P. Hausinger. 1990. Sequence of the Klebsiellaaerogenes urease genes and evidence for accessory proteins facilitating nickelincorporation. J. Bacteriol. 172:5837–5843.

31. Park, I.-S., M. B. Carr, and R. P. Hausinger. 1994. In vitro activation ofurease apoprotein and role of UreD as a chaperone required for nickelmetallocenter assembly. Proc. Natl. Acad. Sci. USA 91:3233–3237.

32. Park, I.-S., and R. P. Hausinger. 1995. Evidence for the presence of ureaseapoprotein complexes containing UreD, UreF, and UreG in cells that arecompetent for in vivo enzyme activation. J. Bacteriol. 177:1947–1951.

33. Rubins, R. H., N. E. Tolkoff-Rubins, and R. S. Cotran. 1986. Urinary tractinfection, pyelonephritis, and reflux nephropathy, p. 1085–1141. In B. M.Brenner and F. C. Rector (ed.), The kidney. The W.B. Saunders Co., Phil-adelphia, Pa.

34. Ruden, D. M., J. Ma, Y. Li, K. Wood, and M. Ptashne. 1991. Generatingyeast transcriptional activators containing no yeast protein sequences. Na-ture 35:250–252.

35. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

36. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

37. Soriano, A., and R. P. Hausinger. 1999. GTP-dependent activation of ureaseapoprotein in complex with the UreD, UreF, and UreG accessory proteins.Proc. Natl. Acad. Sci. USA 96:11140–11144.

38. Sriwanthana, B., M. D. Island, D. Maneval, and H. L. T. Mobley. 1994.Single-step purification of Proteus mirabilis urease accessory protein UreE, aprotein with a naturally occurring histidine tail, by nickel chelate affinitychromatography. J. Bacteriol. 176:6836–6841.

39. Sriwanthana, B., M. D. Island, and H. L. T. Mobley. 1993. Sequence of theProteus mirabilis urease accessory gene ureG. Gene 129:103–106.

40. Taha, T. S. M., T. G. Brayman, A. Karplus, and R. P. Hausinger. 1997.Urease nickel metallocenter structure and assembly, p. 391–413. In G.Winkelmann and C. J. Carrano (ed.), Transition metals in microbial metab-olism. Harwood Academic Publishers, Amsterdam, The Netherlands.

41. Waugh, R., and D. H. Boxer. 1986. Pleiotropic hydrogenase mutants ofEscherichia coli K-12: growth in the presence of nickel can restore hydro-genase activity. Biochimie 68:157–166.

42. West, R. W. J., R. R. Yocum, and M. Ptashne. 1984. Saccharomyces cerevisiaeGAL1-GAL10 divergent promoter region: location and function of the up-stream activator sequence UASG. Mol. Cell. Biol. 4:2467–2478.

VOL. 183, 2001 UREASE STRUCTURAL AND ACCESSORY PROTEIN INTERACTIONS 1433

on August 16, 2018 by guest

http://jb.asm.org/

Dow

nloaded from