THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 268, No. 24, Issue of August 25, pp. 17830-17836,1993 Printed in U.S.A.

Interaction between Retinoic Acid and Vitamin D Signaling Pathways*

(Received for publication, March 16, 1993)

CH-I228 Plan-les-Ouates, Switzerland I~

The nuclear signaling pathways for retinoids and vitamin D differ in the specificity of the respective receptors for response elements. Two pathways for the action of both retinoic acid receptors (RARs) and vi- tamin D receptors (VDRs) have been identified, one being retinoid X receptor (RXR)-dependent and the other being RXR-independent. Moreover, RXRs were found to function as homodimers. In several steps we converted the retinoid specific response element of the human retinoic acid receptor 6 promoter into the vi- tamin D/retinoic acid response element of the human osteocalcin promoter. We found that VDR homodimers only bind to the motif RGGTGA. The extended osteo- calcin element also contains an imperfect direct repeat based on the motif RGGTGA spaced by three nucleo- tides, which is bound by RXR homodimers and acti- vated by 9-cis-retinoic acid. The responsiveness of the osteocalcin element to all-trans-retinoic acid is me- diated neither by RAR homodimers nor by RAR-RXR heterodimers. However, a VDR-RAR heterodimer binds to the osteocalcin response element and mediates activation by all-trans-retinoic acid. This heterodimer also binds to pure retinoid response elements, but it does not mediate activation by vitamin D alone. In combination with all-trans-retinoic acid, however, vi- tamin D enhances VDR-RAR heterodimer-mediated gene expression. This finding suggests a direct inter- action between nuclear signaling by retinoic acid and vitamin D increasing the combinatorial possibilities for gene regulation by the nuclear receptors involved.

The biologically active metabolites of vitamin A (retinol) and vitamin D, all-trans-retinoic acid (RA)’ and 1,25-dihy- droxyvitamin DS (VD), have profound effects on cellular differentiation, embryonic development and calcium homeo- stasis (1-4). They exert their effects by binding as ligands to their respective intracellular receptors, RARs and VDRs, which are members of the large family of ligand-activated transcription factors termed the nuclear receptor family (5, 6). Studies of estrogen and glucocorticoid receptors indicated that the classical steroid hormone receptors form homodimers and modulate transcription of their target genes via cis-acting palindromic response elements (7, 8). The concept that each

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

11 To whom correspondence should be addressed. Tel.: 41-22-37- 29443; Fax: 41-22-37-29460.

’The abbreviations used are: RA, retinoic acid; VD, 1,25-dihy- droxyvitamin Da; RAR, retinoic acid receptor; VDR, vitamin D recep- tor; RXR, retinoid X receptor; FCS, fetal calf serum; CAT, chlor- amphenicol acetyltransferase.

Magdalena SchraderS, Igor BendikQ, Michael Becker-AndrM, and Carsten Carlberg*II From the SClinique de Dermatologie, H6pital Cantonal Universitaire, CH-I211 Geneue 14, Switzerland, the §Cancer Center, La Jolla Cancer Research Foundation. La Jolla. California 92037, and the (Glaxo Institute for Molecular Siology,

hormone binds to a specific receptor homodimer was found to be oversimplified for RARs and VDRs. Both receptors form heterodimeric complexes with RXRs to bind with high affinity to their response elements (9-14). Thus, for transcriptional activation by all-trans-RA and -VD, RXR-dependent path- ways were postulated. However, recent evidence suggested that nuclear signaling of all-trans-RA and -VD is also trans- mitted through RXR-independent pathways (15,17)’ presum- ably mediated by RAR and VDR homodimers. The specific ligand for RXRs was found to be a stereoisomer of all-truns- RA, 9-cis-RA (18,19). The notion that homodimers of RXRs also bind to DNA (20) constituted a third retinoid signaling pathway. All three RXR-dependent pathways are transcrip- tionally activated by 9-cis-RA (15, 17, 20).’ Analogously, RAR-dependent pathways are induced by all-trans-RA (17); and VDR-dependent pathways are induced by VD (15). Inter- estingly, 9-cis-RA was also found to bind RARs (18, 19, 21) but seems to act as a specific antagonist of their RXR- independent action.‘ In this way 9-cis-RA would not only positively coordinate the action of nuclear signaling of VD and all-trans-RA, it would also negatively regulate the activity of RAR homodimers.

Unlike for steroid hormone receptors, the natural response elements for RARs, RXRs, and VDRs include directly re- peated rather than palindromic half-sites based on the hex- amer RGGTCA. It was suggested that the spacing between the half-sites directs the binding specificity of RXR, VDR, and RAR. This rule (22, 23) predicts that directly repeated motifs with spacings of one, three, and five base pairs are RXR, VDR, and RAR binding sites, respectively. Accordingly, the RA response element of the P2 promoter of the human RARB gene is a direct repeat of two RGTTCA motifs sepa- rated by five nucleotides (24). This very strong response element is bound by RAR homodimers, RXR ho- modimers, and RAR-RXR heterodimers (17)’ and, therefore, responsive to all three retinoid signaling pathways.

The response element in the promoter of the human bone osteoblast-specific protein osteocalcin has been reported to be located at positions -510 to -488 (25) and -513 to -493 (26) mediating VD and all-trans-RA action (27). This response element contains two directly repeated copies of the half-site motif GGGTGA separated by six spacing nucleotides. Appar- ently, the spacing number is not in accordance with the spacing rule. Additional sequences downstream, however, with a third imperfect repeat separated by three nucleotides were also associated with VD responsiveness (28). Recently, it was reported that this extended osteocalcin response element (-510 to -485) is bound and activated by VDR homodimers but not by VDR-RXR heterodimers (15).

Here, we show the critical sequence parameters for the

* C. Carlberg, J.-H. Saurat, and G. Siegenthaler, submitted for publication.

17830

VDR-RAR Heterodimers 17831

switch in specificity from retinoid to VD signaling pathways. We converted the RARB RA response element in several steps into the osteocalcin VD/RA response element. We found that RGGTGA motifs with five or six intervening nucleotides were bound by VDR homodimers. Neither RAR-RXR heterodi- mers nor RAR homodimers bound to such response elements. Moreover, only heterodimers of VDRs and RARs conferred responsiveness to all-trans-RA of the osteocalcin element. The interaction between VDRs and RARs suggests, in addi- tion to the RXR-dependent action of VDRs, an alternative cross-talk between the nuclear signaling of VD and retinoids. Therefore, our data provide further combinatorial possibilities for the regulation of VD- and retinoid-responsive genes.

MATERIALS AND METHODS

Cell Culture-The human breast cancer cell line, MCF-7, was grown in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS). The Drosophila cell line, SL-3 (29), was grown at room temperature in Schneider’s medium (Life Technologies, Inc.) supple- mented with 15% FCS.

DNA Constructs-The two 42-mer oligonucleotides containing the RARB gene promoter RA response element (24)

5’ ctagtgctCGGGTAGGGTTCACCGAAAGTTCACTCGactgt 3’ 3’ acgaGCCCATCCCAAGTGGCTTTCAAGTGAGCtgagcagatc 5’

OLIGONUCLEOTIDES 1 AND 2

were synthesized on a Pharmacia Gene Assembler Plus apparatus, purified, phosphorylated, and annealed to yield the indicated double- stranded DNA fragment. This fragment was subcloned into the XbaI site of pBLCAT2 (30) upstream of the tk promoter driving the expression of the chloramphenicol acetyltransferase (CAT) gene. All other response elements (see Fig. 1 for their core sequences) had the same flanking sequences and were synthesized and cloned in the same way. RARa and RXRa cDNAs subcloned into pSG5 (Stratagene) were kindly provided by J. F. Grippo (Roche Nutley).

Transfection and CATAssays-For MCF-7 cells, 2 X lo5 cells were seeded into 6-well plates and grown overnight in phenol red-free RPMI supplemented with 10% charcoal-treated FCS. For SL-3 cells, 5 X 10’ cells/6-well plate were grown overnight in Schneider’s medium supplemented with 15% charcoal-treated FCS.

Liposomes were formed by incubating 1 pg of the reporter plasmid and 1 pg of the reference plasmid pCHllO (Pharmacia LKB Biotech- nology Inc.) with 30 pg of N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-tri- methylammonium methylsulfate (DOTAP, Boehringer Mannheim) for 15 min at room temperature in a total volume of 100 pl. For the transfection of SL-3 cells, 0.25 pg of a pSG5-based (Stratagene) VDR-, RARa-, and RXRa-expression vector were also included. After dilution with 0.9 ml of phenol red-free RPMI (or Schneider’s medium for SL-3 cells), the liposomes were added to the cells. One ml of phenol red-free RPMI supplemented with 20% charcoal-treated FCS (or 1 ml of Schneider’s medium supplemented with 30% charcoal- treated FCS for SL-3 cells) was added 8 h after transfection. At this time VD, all-trans-RA, g-cis-RA, combinations of them (final concen- trations, 1 p M each), or solvent was also added. The cells were harvested 16 h after initiation of the treatment and lysed in 100 p1 of 250 mM Tris-HC1, pH 7.8, by three cycles of freezing and thawing. For the CAT assay, 75 p1 of the supernatant were incubated with acetyl-coA and [14C]chloramphenicol for 1-5 h. The acetylation products were separated on TLC plates and quantitated by liquid scintillation counting. Protein concentrations were determined by the Bradford method (Bio-Rad), and @-galactosidase activity was meas- ured at 420 nm after incubation of 20 pl of supernatant with o- nitrophenyl 8-D-galactopyranoside. Both the protein concentration and the 8-galactosidase activity were used for normalization of the CAT activity and yielded similar results. Stimulation factors were calculated as the ratio of CAT activity of ligand-stimulated cells to that of mock-induced control. Each condition was analyzed in tripli- cate, and data are shown as mean with standard deviation.

In Vitro Translation of Nuclear Receptors and DNA Binding As- says-Five pg of linearized cDNAs for VDR, RARa, and RXRm were used for in vitro transcription in a total volume of 50 pl containing 0.5 mM dNTPs, 40 units of RNasin, 40 mM Tris-HC1, pH 7.5, 6 mM MgCl,, 2 mM spermidine, 10 mM NaCl, 10 mM dithiothreitol, and 20 units of T7 RNA polymerase (all from Promega Corp.). The tran-

scription reactions were incubated for 60 min at 37 “C, then 10 units of RQ1 RNase-free DNase I (Promega Corp.) were added, and the mixture was further incubated for 5 min at 37 “C. Five pg of each RNA were mixed with 175 pl of rabbit reticulocyte lysate, 100 units of RNasin and 20 p~ complete amino acid mixture (all from Promega Corp.) in a total volume of 250 p1 and incubated at 30 “C for 90 min. The response element probes were prepared by double digestion of the respective plasmid DNA with Hind111 and BamHI, purified by gel electrophoresis, and labeled by a fill-in reaction using [cx-~’P] dCTP and T7 DNA polymerase (Pharmacia). Five pl of in vitro translated receptors were preincubated for 10 min at room tempera- ture in a total volume of 20 pl of binding buffer (10 mM Hepes pH 7.9, 80 mM KCl, 1 mM dithiothreitol, 0.2 pg/pl poly(dI/dC), and 5% glycerol). About 1 ng of labeled probe (25,000 cpm) was added, and the incubation was continued for 30 min. The protein-DNA com- plexes were resolved on a 5% non-denaturing polyacrylamide gel (at room temperature) in 0.5 X TBE (45 pM Tris borate, 1 pM EDTA, pH 8.3) (prerun for 2 h). The dried gel was exposed to a Kodak XAR- 5 film.

RESULTS

Conversion of the RARB RA Response Element into the Osteocalcin V D Response Element-To define the sequences that are necessary and sufficient to provide a VD response, we mutagenized the RA response element within the promoter of the human RARp gene promoter (24) to convert it in several steps into the VD response element of the osteocalcin gene promoter (25, 26). The RARB RA response element is a direct repeat of two RGTTCA motifs with five intervening nucleotides (Fig. hi). The osteocalcin response element, con- tains two directly repeated GGGTGA motifs with six spacing nucleotides (Fig. 1H). Therefore, we initially mutagenized the binding motifs and subsequently increased the spacing dis- tance. The T residue in the third position was converted in both motifs into a G residue (B: DR5[RGGTCA]), alterna- tively the C residue in the fifth position was changed into a G residue (C: DR5[RGTTGA]), or both mutations were done in parallel (D: DR5[RGGTGA]). Either the spacer was mu- tagenized to resemble that of the osteocalcin element without restoring the AP-1 site (E: DR5[GGGTGA]) or simply one nucleotide was inserted (F: DRG[RGGTGA]). The response element G contains the core sequence of the osteocalcin element (positions -511 to -495). The element H (positions -511 to -485) is an extended version of element G containing an additional imperfect motif spaced by three nucleotides. The response elements G and H contain the TGACTCA binding motif for the ubiquitous transcription factor AP-1, a heterodimer of the proto-oncogene products c-Fos and c-Jun (27).

Induction of Endogenous V D and Retinoid Receptors in MCF-7 Cells-The eight response elements (Fig. 1) were cloned in combination with a tk promoter in front of a CAT

A :

B:

C: D:

E:

F: G:

H

hRARP[-53 to -351 DRS[PuGGTCA]

DRS[PuGTTGA]

DRS[PuGGTGA]

DR5IGGGTGAl

DR6[PuCGTGA]

hOC[-511 to -4951

hOC[-511 to -4851

GGTTCACCGAAAGTTCACT

GGGTCACCGAAAGGTCACT

GGTTGACCGAAAGTTGACT

GGGTGACCGAAAGGTGACT

GGGTGACCACCGGGTGAT

GGGTGACCGCAAAGGTGACT

GGGTGACTCACCGGGTGAT

GGGTGACTCACCGGGTGAACGGGGGCAT

sponse element of the RARj3 (hRAR8) gene (A) (24) into the VD/ FIG. 1. Response elements. Conversion of the human RA re-

RA response element of the human osteocalcin (hOC) gene promoter ( H ) (26) by six intermediate mutations (B-G). The core sequences have identical flanking sequences and were cloned next to a tk promoter in front of a CAT reporter gene (see “Materials and Meth- ods”). Sequences of the response element half-sites are typed in bold letters.

17832 VDR-RAR Heterodimers

reporter gene. Their transactivation potential was analyzed in the human breast cancer cell line MCF-7. This cell line expresses VDRs, RARs, and RXRs endogenously (15,17) and, therefore, can be induced by the specific ligands of these receptors, VD, all-trans-RA and 9-cis-RA. Transfected cells were stimulated with the three ligands, each alone and in the three possible combinations (Fig. 2). Short-term incubations (16 h) were performed with the ligands to diminish isomeri- zation of the retinoids.' The maximal induction was 4.9-fold for VD, 10.1-fold for all-trans-RA, 9.8-fold for g-cis-RA, 10.3- fold for VD and g-cis-RA, 19.8-fold for all-trans- and 9-cis- RA, and 10.2-fold for VD and all-trans-RA.

A Direct Repeat of the Motif RGGTGA Mediates Inducibility by VD-Fig. 2a shows that responsiveness to VD is linked to the presence of RGGTGA motifs within the response element (D-H). Spacing of five and six nucleotides mediates VD response with similar efficiency. However, the induction is increased by an additional 25% when the spacer contains an inverted copy of the RGGTGA motif, as in the two natural sequences, G and H. This augmentation could be related to the AP-1 site formed by these sequences (27). The two seg- ments of the osteocalcin promoter, G and H, showed nearly identical responses to VD suggesting that, in contrast to former results (28), the third motif (GGGGCA) might not be involved in activation by VDRs.

The Osteocalcin Element Is Also Responsive to All-trans- RA-As shown previously (17) the first two mutations, B and C, of the RARp RA response element decreased its respon- siveness to all-trans-RA (Fig. 26). The five VD response elements based on RGGTGA motifs (D-H) conferred induc- tion by all-trans-RA. The response to 9-cis-RA of elements B

a b

and C was similar to that to all-trans-RA (Fig. 2c). As previ- ously reported (15), the extended osteocalcin element (H) was also weakly induced by 9-cis-RA; however, the shorter osteo- calcin element (G) and the elements D, E, and F did not respond to this ligand. The response of the eight elements to combined stimulation by VD and 9-cis-RA (Fig. ad) appears to represent a superposition of their responsiveness to the individual ligands (Figs. 1, a and c). The relative induction of the set of response elements by a combination of all-trans- and 9-cis-RA (Fig. 2e) was very similar to that obtained with 9-cis-RA alone (Fig. 2c); only the RARP element (A) and mutant B responded strongly. The stimulation pattern with VD and all-trans-RA (Fig. 2 f ) was nearly identical to that obtained with all-trans-RA alone (Fig. 2b).

Homodimer Activity of VDRs, RARs, and RXRs-The pres- ence or absence of VDRs, RARs, and/or RXRs and their specific ligands seems to determine the signaling pathway through which VD- and retinoid-regulated genes are modu- lated. However, detailed studies in MCF-7 cells are hampered by the fact that these, as almost all mammalian cells, express the two retinoid receptor subfamilies. We have shown previ- ously (15, 17)'that in Drosophila SL-3 cells, which are devoid of endogenous VDRs, RARs, and RXRs, the VD and retinoid pathways can be reconstituted separately by transfection with appropriate receptor expression plasmids.

For all response elements tested, transient expression of VDR in SL-3 cells (Fig. 3a) gave a response pattern very similar to that of MCF-7 cells stimulated with VD (Fig. 2a). This not only substantiated the finding that the osteocalcin response element (H) is activated by VDRs in a RXR-inde- pendent way (15) but also established this for the other

C

100 - VD

100

80

60

40

- 20 - 20

0

all-trans RA

A B C D E F G H

d

VDI9-cis RA 80

A B C D E F G H

e

loo in all-trans RA/9-cis RA 80 -

60 -

40 -

20 - T T T

A

f 100

40

20

B C D E F G H

VDlall-trans RA

A B C D E F G H A B C D E F G H A B C D E F G H FIG. 2. Ligand-dependent transactivation by endogenous receptors in MCF-7 cells. MCF-7 cells were transfected with CAT

reporter plasmids containing one of the eight different response elements (A-H, see Fig. 1). The data compiled in the histograms represent the CAT activity induction values after treatment with VD ( a ) , all-trans-RA ( b ) , 9-cis-RA (c), VD/9-cis-RA ( d ) , all-trans-RAIS-cis-RA ( e ) , or VDlall-trans-RA ( f ) . Values are expressed as percentage of those obtained with the VD/RA response element of the human osteocalcin gene promoter (a ) and the human RA response element of the RARP gene promoter (b-f), respectively. The bars indicate standard deviation.

VDR-RAR Heterodimers 17833

c c c - r d

R X R a

1.:.

FIG. 3. Homodimer activity of VDR, RAR, and RXR. SL-3 cells were transfected with CAT reporter plasmids containing one of the eight different response elements (A-H, see Fig. 1) and expression vectors for VDR (a), RARa ( b ) , or RXRa ( c ) . Induction by VD (a), all-trans-RA (b) , and 9-cis-RA (c) is expressed as percentage of that obtained with the VD/RA response element of the human osteocalcin gene promoter (in a) and the human RA response element of the RARj3 gene promoter (in b and c), respectively. The bars indicate standard deviation. As a control, equal amounts of the respective 32P- labeled DNA fragments were shifted with in vitro translated VDR (a), RARa (b ) , or RXRa (c) receptor protein, respectively. The shifted protein-DNA complexes are shown below the histograms.

elements with RGGTGA motifs (D-G). Gel shift experiments with in vitro translated VDRs suggested that these types of VD response elements were bound by VDR homodimers. When RARa was expressed, induction with all-trans-RA (Fig. 3b) yielded significant CAT activity only with the RARB RA response element (A) and mutant B, in accordance to the gel shift experiments. As reported recently (17), RAR homodi- mers bind to RA response elements, similar to that of the RARB gene promoter, but apparently they do not mediate the responsiveness to all-trans-RA of the osteocalcin element. The response pattern to 9-cis-RA of SL-3 cells expressing RXRa (Fig. 3c) resembles that established for 9-cis-RA-in- duced MCF-7 cells (Fig. 2c). RXR homodimers transactivated the RARB RA response element (A) and mutant B and, although less efficiently, the extended osteocalcin element (H) but not its shorter version (G). This suggested that the imperfect direct repeat, but not the RGGTGA motifs, pro- motes the binding of RXR homodimers. Gel shifts support this suggestion. As observed previously (15, 17); the in vitro binding of VDRs and RARs to their response elements is for some unknown reason much weaker than that of RXR ho- modimers or heterodimers.

VDR-RXR and RAR-RXR Heterodimer Activity--In SL-3 cells we expressed RAR, RXR, and VDR in the three combi- nations of two, thus creating by free association variations of homodimeric and heterodimeric receptor species. Subse- quently, we treated these cells with the responsive ligands either individually or in appropriate combinations of two. In the presence of VDR and RXRa the response pattern after stimulation with VD alone (Fig. 4a, black columns) was nearly identical to that established in the presence of VDR alone (Fig. 3a). The response pattern to 9-cis-RA alone (Fig. 4a, light gray columns) was also very similar to that established after expression of RXRa alone (Fig. 8c). The response pat- tern after treatment with both ligands (Fig. 4a, white columns) was essentially identical to that observed for the response elements A-C after treatment with 9-cis-RA alone and to that observed for the response elements D-G after treatment with VD alone. Only the extended osteocalcin element (H), which is responsive to each of the two ligands, showed an increased induction by combined stimulation with VD and 9-cis-RA. This induction was only additive and not synergistic, as expected for the action of VDR-RXR heterodimers (15). Since homodimers of in vitro translated RXRs migrate in gel shift experiments slightly faster than homo- and heterodimers of VDRs and RARs, RXR homodimers could be discriminated in gel shift experiments from other protein complexes (Fig. 4a). A plausible interpretation is that the response elements A-C were bound by RXR homodimers, the elements D-G by VDR homodimers, and the extended osteocalcin element by both VDR and RXR homodimers but not by VDR-RXR heterodimers. The combined expression of RARa and RXRa followed by stimulation with all-trans-RA (Fig. 4b, dark gray columns) resulted in a response pattern similar to that ob- served in the presence of RARa alone (Fig. 3b). Likewise, the 9-cis-RA response pattern (light gray columns) is comparable with that observed in the presence of RXRa alone (Fig. 3c). For a detailed comparison the higher absolute stimulation rate for RAR-RXR heterodimers as compared with RAR and RXR homodimers has to be taken into account. The stimu- lation with both ligands (white columns) resulted in a syner- gistic response for element B, whereas for elements A, C, D, and E, only an additive effect was observed. As already shown in the previously mentioned experiments, the extended osteo- calcin element (H) was not activated by all-trans-RA, and its weak activation by 9-cis-RA was mediated by RXR homodi-

17834 VDR-RAR Heterodimers

FIG. 4. Heterodimer activity of VDR, RAR, and RXR. SL-3 cells were transfected with CAT reporter plasmids containing one of the eight different re- sponse elements (A-H, see Fig. 1) and expression vectors for VDR and RXRa (a), RARa and RXRa (b), or VDR and RARa (c). Induction values by VD (black columns), all-trans-RA (dark gray col- umns), 9-cis-RA (light gray columns), and mixtures of VD and 9-cis-RA (white bars in a), all-trans-RA and 9-cis-RA (white bars in b), or VD and all-trans- RA (white bars in c) are expressed as percentage of those obtained with the VD/RA response element of the human osteocalcin gene promoter (in a ) and the human RA response element of the RARP gene promoter (in b and c), re- mectivelv. The bars indicate standard

t>

= o c

.\ deviation. AS a control, equal amounts of the respective 3ZP-labeled DNA frag- ments were shifted with preincubated mixtures of in vitro translated VDR and RXRa (a), RARa and RXRa (b), or VDR and RARa (c) receptor proteins, respectively. The shifted protein-DNA complexes are shown below the histo- grams.

A

C

VDR/HARo!

mers. The two VD response elements F and G containing direct repeats of two RGGTGA motifs separated by six nucle- otides were unresponsive to retinoids. The gel shift experi- ments showed the strong binding of RAR-RXR heterodimers to the RA response elements A-C, weak heterodimer binding to elements D and E, and RXR homodimer binding to the extended osteocalcin element (H).

VDR-RAR Mediate the All-trans-RA Responsiueness of the Osteocalcin VD Response Element-Since potential isomeri- zation of retinoids in our experimental system was kept at a

minimum, responsiveness to all-trans-RA should be consid- ered specifically mediated by the action of RARs. The exper- iments in Figs. 3b and 46 clearly indicated that RARs do not bind to the osteocalcin response element, neither as homodi- mers nor as RAR-RXR heterodimers. Therefore, we tested the third combinatorial possibility for heterodimer formation between VDRs, RARs, and RXRs, i.e. VDR-RAR heterodi- mers. When SL-3 cells were transfected with expression plas- mids encoding VDR and RARcu, we observed for the elements D-G a response to VD (Fig. 4c compared with Figs. 3a and

VDR-RAR Heterodimers 17835

4a; all black columns) probably mediated by VDR homodimers. In addition, these elements showed a response to all-trans- RA (Fig. 4c, darkgray column), which cannot be explained by the action of RAR homodimers (Fig. 3b). The three retinoid response elements A-C mediated the expected response by RAR homodimers. In the presence of both ligands (Fig. 4c, white columns) the response was clearly augmented, with the exception of element C. In comparison with the rather weak protein-DNA complexes formed by VDR and RAR homodi- mers (Figs. 3, a and b) , a mixture of VDR and RAR provided strong binding complexes with the various response elements, indicative of their heterodimeric character. Surprisingly, these VDR-RAR heterodimers bound even better to the two retinoid response elements A and B than to the five VD response elements D-H. Since the retinoid response elements (A-C) had been shown not to be responsive to VD (Fig. 3a) even in the presence of endogenous receptors in MCF-7 cells (Fig. Za), VDR-RAR heterodimers can be considered not to be inducible by VD (Fig. 4c, black columns for response elements A-C). However, the action of all-trans-RA-stimulated VDR- RAR heterodimers appears to be enhanced by VD (Fig. 4c, white columns).

DISCUSSION

We report the conversion of a response element specific for the three retinoid pathways into a response element that is activated through the RXR-independent pathway of VD ac- tion as well as through a pathway of coupled action of VD and all-trans-RA. Since in mammalian cell systems, like MCF-7 cells (Fig. 2) , one cannot discriminate between the transcriptional effects of homo- and heterodimers of VDRs, RARs, and RXRs, we have used for our studies Drosophila SL-3 cells. We have previously shown (15,17) that SL-3 cells do not contain nuclear receptors that can functionally substi- tute for the mammalian RXR even though they express the ultraspiracle gene product, which is closely related to RXRs (31). Also putative "accessory" factors (32) do not bind 9-cis- RA or VD and therefore cannot be responsible for the ob- served synergistic effectg related to transcriptionally active heterodimers.

We found that activation by VDR homodimers is mediated only by response elements that are based on direct repeats of two RGGTGA motifs separated by five or six nucleotides (Fig. 3a) . From the few known VD response elements only the human osteocalcin gene promoter contains this kind of direct repeat. Other VD response elements, as those in the promoters of the mouse osteopontin gene (33) or of the rat osteocalcin gene (34), consist of direct repeats with only three spacing nucleotides and are activated by VDR-RXR heterodimers (15). The extended human osteocalcin response element ad- ditionally contains an imperfect direct repeat with three in- tervening nucleotides and was, therefore, believed to bind VDR-RXR heterodimers responsible for VD action on the gene (28) . However, we found this third motif not contributing to any enhanced response to VD but enabling the binding of RXR homodimers, thus evoking weak inducibility by 9-cis- RA to the response element.

Neither VDR-RXR and RAR-RXR heterodimers nor RAR homodimers bound the osteocalcin response element (Figs. 3b and 4, a and b) . The inducibility by all-trans-RA (Fig. 2b) of this response element can be explained, however, by the binding of VDR-RAR heterodimers (Fig. 4c). Before the dis- covery of RXRs as co-factors for efficient DNA binding of VDR (9, 11) there were several indications that VDR needed an accessory factor for its function (35-37). This co-factor had an estimated molecular mass of 55 kDa (36) being close

to that of RXR and RAR. Furthermore, the accessory factor was found to enhance the binding of VDRs to the mouse RARP RA response element (36) , as we observed the binding of VDR-RAR heterodimers to the human homologue of this response element (Fig. 4c). We believe therefore that, depend- ing on the response element, VDR may select one of the two retinoid receptors as a co-factor. This idea is supported by the finding that, like RARs and RXRs, the unknown nuclear accessory factor was present in almost all tissues (36). Beside its ability to form heterodimers with RXRs, RARa was found to interact with several cell-type-specific proteins (38) . Since the short as well as the extended human osteocalcin elements showed no difference in the binding of and transactivation by VDR-RAR heterodimers, we conclude that the heterodimeric complex binds preferentially to the direct repeat with a six- nucleotide spacer rather than to the imperfect direct repeat with a three nucleotide spacer similar to the VDR homodimer.

The notion that several members of the nuclear hormone receptor superfamily form heterodimers with RXR increased the number of transcription factors with potentially unique specificities. In this respect our observation of the biological function of VDR-RAR heterodimers on at least one natural response element extends the list of combinatorially active gene regulators (16) . Therefore, one can think of up to six separate hormone response pathways that are governed by VD, all-trans-RA, and 9-cis-RA acting individually or by the three binary combinations. In cells in which only one of these ligands is present, the respective target genes will be activated only moderately. In the presence of a second ligand, however, some of these genes, whose promoters bind the respective heterodimers, will be more sensitive and achieve a greater maximal response. A possible function of such a mechanism could be controlling the switch from proliferation to differ- entiation, though the reality is certainly more complicated. There might be undiscovered VD- or retinoid-sensitive recep- tors or orphan receptors that interfere with the nuclear sig- naling by these ligands.

Acknowlegments-We thank Prof. J.-H. Saurat for discussions and support, Dr. K. M. Muller for critical reading of the manuscript, A. Wyss for oligonucleotide synthesis, and Drs. M. Klaus and C. Apfel for 9-cis-RA.

REFERENCES 1. Tabin, C. J. (1991) Cell 66,199-217 2. Leid, M., Kastner, P., and Chambon, P. (1992) Trends Biochem. Sci. 17,

3. Pike, J. W. (1991) Annu. Reu. Nutr. 11, 189-216 4. Norman, A. W., Nemere, I., Zhou, L.-X., Bishop, J. E., Lowe, K. E., Maiyar,

A. C., Collins, E. D., Taoka, T., Sergeev, I., and Farach-Carson, M. C. (1992) J. Steroid Bbchem. Mol. Biol. 41.231-240

427-433

5. Evans, R . M. (1988) Science 240,889-895' 6. OMalley, B. W. (1990) Mol. Endocrinol. 4, 363-369 7. Green. S.. and Chambon. P. (1988) Trends Genet. 4.309-314 8. Luisi, .B. F . , Xu, W. X.,'Otwinowski, Z., Freedman; L. P., Yamamoto, K.

R.. and Sieler. P. B. (1991) Nature 352.497-505 9. Yu, V. C., Delsek, C., Anderaen, B., Holloway, J. M., Devary, 0. V., Naar,

A. M., Kim, S. Y., Boutin, J.-M., Glass, C. K., and Rosenfeld, M. G.

10. Bugge, T. H., Pohl, J., Lonnoy, O., and Stunnenberg, H. G. (1992) EMBO (1991) Cell 67,1251-1266

11. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992) J. 11,1409-1418

Nature 365.44fi-449 12. Leid. M.. Kastner. P.. Lvons. R.. Nakshatri. H.. Saunders. M.. Zacharewski.

~ ~~~.~ . "~~ ." .~~

T.; Chen, J.-Y.; S h b , A,', Gamier, J.-hi., Mader, S., and'chambon, P:

13. Marks, M. S., Hallenbeck, P. L., Nagata, T., Segars, J. H., Appella, E., (1992) Cell 68,377-395

Nikodem. V. M.. and Ozato. K. (1992) EMBO J. 11. 1419-1435 14. Zhang, X.-K., Hoffmann, B., Tran, P. B.lV., Graupnk, G., and Pfahl, M.

15. Carlberg, C., Bendik, I., Wyss, A,, Meier, E., Sturzenbecker, L. J., Grippo,

16. Green, S. (1993) Nature 361,590-591 17. Schrader, M., WYSS, A., Sturzenbecker, L. J., Grippo, J. F., LeMotte, P.,

18. Heyman, R. A., Mangeisdorf, D. J., Dyck, J. A,, Stein, R. B., Eichele, G., and Carlberg, C. (1993) Nucleic Acids Res. 21, 1231-1237

19. Levin, A. A,, Sturzenbecker, L. J., Kazmer, S., Bosakowski, T., Huselton, Evans, R. M., and Thaller, C. (1992) Cell 68,397-406

C., Allenby, G., Speck, J., Kratzeisen, C., Rosenberger, M., Lovey, A,,

(1992) Nature 355,441-446

J. F., and Hunziker, W. (1993) Nature 361,657-660

17836 VDR-RAR Heterodimers

20. Zhang, X.-&.: Lehmann, J., Hoffmann, B., Dawson, M. I., Cameron, J., 28. Ozono, K., Liao, J., Kerner, S. A., Scott, R. A., and Pike, J. W, (1990) J. and Grip o J F. (1992) Nature 366,359-361 Evans, R. M. (1990) Cell 61,497-504

Graupner, G., Herrmann, T., Tran, P., and Pfahl, M. (1992) Nature 3 6 8 , BWL Chern. 266,21881-21888

berger, M., Lovey, A., Kastner, P., Grippo, J. F., Chambon, P., and Levin, 31. Oro, A. E., McKeown, M., and Evans, R. M. (1990) Nature 347 , 298-301 A. A. (1993) Proc. Natl. Acad. Sei. U. S. A. 90.30-34

22. Nair, A. M., Boutin, J.-M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, 32. Yao, T.-P., Segraves, W. A., Oro, A. E., McKeown, M., and Evans, R. M.

C. K., and Rosenfeld, M. G. (1991) Cell 66, 1267-1279 (1992) Cell 71,63-72

23. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) 33. Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., and Denhardt,

D. T. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,9995-9999 Cell 66,1255-1266

24. de The, H., Vivanco-Ruiz, M. M., Tiollais, P., Stunnenberg, H., and Dejean, 34. Demay, M. B., Gerard, J. M., DeLuca, H. F., and Kronenberg, H. M. (1990)

Proc. Natl. Acad. Sci. U. S. A. 87,369-373 A. (1990) Nature 343,177-180

25. Kerner, S. A. Scott, R. A., and Pike, J. W. (1989) Proc. Natl. Acad. Sei. 35. Liao, J., Ozano, K., Sone, T., McDonnell, D. P., and Pike, J. W. (1990)

U. S. A. 86: 4455-4459 26. Morrison, N. A., Shine, J., Fra onas, J.-C., Verkest, V., McMenemey, M. 37. Ross T. K. Moss V. E., Prahl J. M., and DeLuca, H. F. (1992) Proc. Natl.

36. Sone, T., Ozono, K., and Pike, J. W. (1991) Mol. Endocrinol. 5,1578-1586

27. Schiile, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and 38. Glass, C. K., Devary, 0. V., and Rosenfeld, M. G . (1990) Cell 6 3 , 729-738 L., and Eisman, J. A. (1989) %cience 246 , 1158-1161 A i d . Sci. U. S’A. 89, 256-i60

21. Allenby, G., Bocquel, M.-T., Saunders, M., Kazmer, S., Speck, J., Rosen- 30. Luckow, B., and Schutz, G. (1987) Nucleic Acids Res. 15,5490 687-591 29. Schneider, I. (1972) J. Embryol. Exp. MorphoL 27,353-365

P~oc. Natl. Acd. Sci. U. S. A. 87,9751-9755