Insulin insulin-like growth factorndash1 insulin receptor and insulin-like growth factorndash1 receptor expression in the chick eye and theirregulation with imposed myopic or hyperopic defocus

Alexandra Marcha Penha Frank Schaeffel Marita Feldkaemper

University Eye Hospital Institute for Ophthalmic Research Section of Neurobiology of the Eye Tuebingen Germany

Purpose Insulin stimulates eye growth in chicks and this effect is greatly enhanced if the retinal image is degraded bythe defocus of either sign However it is unclear whether the insulin receptor (IR) is expressed at all in the chicken retinain animals 1ndash2 weeks post-hatching We have investigated IR expression and whether IR transcript abundance varies inthe fundal layers To elucidate the possible role of insulin and insulin-like growth factor (IGF)-1 signaling in eye growthregulation mRNA (mRNA) levels were measured for insulin IGF-1 IR and IGF-1 receptor (IGF-1R) during imposednegative or positive defocusMethods Chicks were treated binocularly with positive or negative spectacle lenses for 4 or 24 h or they remaineduntreated (n=6 for each treatment group) Northern blot analyses were performed to screen for transcription variants inthe different fundal layers of untreated animals Real-time PCR was used to quantify IR IGF-1R IGF-1 and insulinmRNA levels in the different fundal layers of the chick eye in the three treatment groupsResults IR mRNA was found in all the studied tissues although there is evidence of tissue-specific transcript variationsThree major transcripts were detected for IR The brain retina and choroid showed the longest transcript (43 kb) whichwas not present in the liver Nevertheless the liver and brain showed a second transcript (26 kb) not present in the retinaand choroid A short transcript (13 kb) was the predominant form in the liver and choroid and it seems to be present inthe retinal pigment epithelium (RPE) and sclera as well In the retina no significant gene expression changes were foundwhen defocus was imposed Interestingly in the RPE both IR and IGF-1R were already downregulated after short periods(4 h) of positive lens wear In contrast IR and IGF-1R were upregulated in the choroid and fibrous sclera during treatmentwith negative but not positive lensesConclusions Differences observed in the IR transcript length in different tissues suggest possibly different functionsThe differential regulation of IR and IGF-1R in the RPE choroid and fibrous sclera is consistent with their involvementin a signaling cascade for emmetropization

The prevalence of myopia in the human population hasdramatically increased in developed regions of Asia [1] butalso in Western societies [2] during the last decades It isestimated that approximately 30 of the worldwidepopulation is currently myopic [3] Genetic as well asenvironmental factors have been implicated in thedevelopment of myopia but the relative importance of genesversus environment remains controversial [4] Myopia can beartificially induced in animal models like chicks [5] treeshrews [6] monkeys [78] and guinea pigs [9] by placingnegative lenses which induce hyperopic defocus [10] in frontof the animalrsquos eye The shift of the focal plane behind thephotoreceptor layer triggers substantially increased eyegrowth Furthermore the choroid thins In contrast positivelenses imposing myopic defocus slow the rate of ocularelongation and the choroid thickens by up to a factor of 3 inchicks [11]

Correspondence to Marita Feldkaemper Institute for OphthalmicResearch Section of Neurobiology of the Eye Tuebingen GermanyPhone +49 (0) 7071-29 87424 FAX +49 (0) 7071 295193 emailmaritafeldkaemperuni-tuebingende

Among the retinal transmitters and modulatorsimplicated in eye growth regulation are vasoactive intestinalpolypeptide [1213] dopamine [14ndash16] retinoic acid [17ndash19] glucagon [20ndash22] insulin [2324] γ-aminobutyric acid[25] and growth factors such as transforming growth factorand basic fibroblast growth factor [2627] In addition it hasbeen shown that the transcription factor Egr-1 (called ZENKin chicks) may be involved [28ndash30]

It was previously found that glucagon and insulin haveopposite effects on cell proliferation in the retina [31] and onaxial eye growth [2432] While intravitreal glucagoninjections inhibit growth toward myopia in chicks by slowingaxial eye growth rates insulin not only blocks hyperopiadevelopment which is normally induced by positive lensesbut also induces high amounts of axial myopia that is furtherincreased when negative lenses are worn [32] In additioninsulin and insulin-like growth factor (IGF)-1 both increasethe rate of ocular elongation in eyes not wearing any lenses[24] Glucagon agonist injections prevent deprivation myopiain a dose-dependent manner [2033] largely by increasingchoroidal thickness [24] On the contrary insulin injections

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gtReceived 17 December 2010 | Accepted 26 May 2011 | Published 31 May 2011

copy 2011 Molecular Vision

1436

cause choroidal thinning in chicks wearing positive lenses buthave no effect on choroidal thickness in animals that havenormal vision [32] When both glucagon and insulin areinjected as a cocktail the growth-promoting effect of insulinis blocked while the effects of glucagon on choroidalthickness are also suppressed [32] Interestingly a very recentstudy [34] demonstrated a genetic association between IGF-1and high-grade myopia in an international family cohortThese findings are in line with experimental data from thechicken model of myopia showing that IGF-1 can promoteocular growth and axial myopia

So far only a few studies have targeted IGF-1 and insulinin the eye apart from those related to their roles inembryogenesis The human interphotoreceptor matrixdisplays IGF-1 immunoreactivity while cultured humanretinal pigment epithelium (RPE) cells synthesize and releaseIGF-1 raising the possibility that the RPE may serve as asource of IGF-1 in vivo [35] Moreover cultured embryonicretinal chicken explants contain synthesize and releaseappreciable amounts of IGF-1 which can stimulate the DNAsynthesis of retinal explants [36] Insulin-likeimmunoreactivity was demonstrated in glial cell culture butit remains unclear whether this immunoreactivity was due tothe binding of circulating pancreatic insulin to insulinreceptors (IRs) andor uptake and storage in these cells or ifinsulin is indeed locally synthesized In situ hybridizationstudies showed that Muumlller cells contain mRNA (mRNA)necessary for de novo synthesis of insulin or a closelyhomologous peptide [37] Because Muumlller cells containglycolytic enzymes and can synthesize and store glycogen[38] it has been suggested that insulin produced in the retinamay play a role in glucose or amino acid metabolism Thereis evidence that retinal cells are capable of synthesizingpreproinsulin mRNA raising the possibility that insulin isinvolved in intracellular (autocrine) and intercellular(paracrine) signaling [39] Moreover it has been speculatedthat insulin acts like a growth hormone during developmentto control retinal differentiation Later it may act as amodulator of neurotransmission within the retina [39] Thepresence of insulin in the developing retina before pancreaticinsulin synthesis is initiated [40] suggests an important roleof insulin in the retina perhaps as a growth or trophic factorFrom the rat brain it is already known that insulin canmodulate neurotransmission by increasing the efficiency ofneuroactive amino acid reuptake [41] In addition insulin hasbeen shown to affect brain monoamine metabolism [42] anddopamine release [43]

The polypeptide hormones insulin and IGF-1 exert theirbiologic effects by binding to distinct transmembranereceptors on the surface of the target cells Although thereceptors for insulin and IGF-1 are like their ligands highlyhomologous [4445] they are known to have different butpartially overlapping physiologic functions [46] Whileinsulin is known to be a key regulator of physiologic processes

such as glucose transport and glycogen and fat biosynthesis[47] IGF-1 is believed to mediate the effects of growthhormone and play a role as a paracrine growth factor [48] Thelevels of the IR are regulated during development and it islikely that changing the receptor level while keeping the levelof insulin constant may be a regulatory mechanism [49]Analysis of the protein structure has revealed that receptorsfor IGF-1 and insulin belong to a family of cell surfaceglycoproteins that share a cytoplasmic tyrosine-kinasefunction [5051] Both are oligomers composed of two typesof subunits α-subunits containing the hormone-binding siteand β-subunits which are phosphorylated after binding of theligand The alpha and beta subunits are encoded by a singlegene Ligand interaction with the extracellular portions ofthese receptors activates intracellular tyrosine-kinase activityand generates a biologic signal that is thought to be specifiedby structural determinants in the cytoplasmic domain Thepresence of IRIGF receptor hybrids was demonstrated inproliferative neuroretina These receptors were considered tobe physiologically relevant for the action of the locallyproduced proinsulin found in early neurogenesis [52] Twotypes of IGF receptors on nerve cell membranes from themurine and human central nervous system (CNS) wereidentified based on their binding specificity subunit structurekinase activity and interaction with antibodies to insulinreceptor [53] In the CNS insulin receptors are also composedof two types of subunit but the size of the α-subunit issignificantly smaller whereas the β-subunit is similar to thatof other cell types [54ndash56] The differences in the compositionof IR in neuronal and nonneuronal cells suggest a uniquefunction for IR in neural networks [57]

Because of these fundamental differences between IRmolecules in the brain and peripheral target tissues [54] thefirst objective of this study was to investigate which transcriptvariants of IR exist in the fundal layers of the eye comparedto the liver and brain to learn more about which variants mightbe involved in eye-growth regulation The second objectivewas to study changes in mRNA levels for insulin IGF-1 IRand IGF-1 receptor (IGF-1R) after defocus was imposed inthe retinal image for 4 or 24 h a condition that is known toinduce axial refractive errors

METHODSTreatment of animals Ten-day-old male White Leghornchickens were raised under a 12 h12 h light-dark cycle andtreated binocularly either with plus (+7D) or minus (minus7D)lenses for 4 (n=6) and 24 h (n=9) respectively In addition aseparate control group was used for each treatment durationTo attach the lenses Velcro rings were glued onto the feathersaround the eyes a few hours before the lens treatment wasstarted The experimental treatment was in accordance withthe ARVO Statement for Care and Use of Animals inOphthalmic and Vision Research and was approved by theuniversity commission for animal welfare

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1437

Tissue preparation The chicks were sacrificed by anoverdose of diethyl ether between 1 and 3 PM Eyes wereenucleated and vertically cut with a razor blade discardingthe anterior part containing the lens The vitreous body wasremoved and the pecten was cut out From the posterior partof the eye a biopsy punch of 8 mm was made and placed in aPetri dish that was filled with ice-chilled saline The differentfundal layers were carefully separated under visual control ofa dissecting microscope In addition forebrain and liversamples were dissected from four untreated animals All thetissues were immediately collected in RNAlater (QiagenHilden Germany) immediately frozen in liquid nitrogen andstored at minus80 degC until RNA extraction In general the righteyes were taken for further analysis Only when the separationof the fundal layers was not optimal was the left eye studiedinstead

Total RNA extraction and cDNA synthesis Different RNAextraction methods were used for northern blot and real-timePCR analyses For northern blot analysis total RNA from theliver brain retina RPE choroid and sclera was isolated usingTRIzol (Invitrogen Karlsruhe Germany) according to themanufacturerrsquos instructions For real-time PCR analyses theRNeasy Mini kit (RNeasy Mini Kit Qiagen HildenGermany) was used following the manufacturerrsquosinstructions All tissues were homogenized in the respectivelysis buffer for 1 min at a range of speed that increased in foursteps from 11000 to 20000 rpm (Diax 900 HomogenizerHeidolph Ketheim Germany) All RNA samples were treated

with DNase I (DNA-free Ambion Darmstadt Germany) andthe respective yield was measured by spectrophotometry at260 and 280 nm The optical density (OD260OD280) ratios werecalculated to ensure the quality of the isolated RNA andsamples with a ratio between 18 and 20 were used for furtheranalysis The integrity of the RNA samples was confirmed byagarose-gel electrophoresis Thereafter 1 microg of brain liverretina RPE and choroid and 05 microg of both sclera layers werereversed transcribed by Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Promega Mannheim Germany)using 025 microg oligo(dT)15 and 0025 microg random hexamerprimers (Invitrogen) in a final volume of 15 microlSemiquantitative real-time polymerase chain reaction Table1 shows all of the specific primer sequences used forsemiquantitative real-time PCR the respective amplicon sizeand the NCBI accession number Primer design wasperformed using the web-based program Oligo Explorer 14(Gene Link Hawthorne NY) The specificity of the PCRreactions was verified by melting-curve analysis and agarose-gel electrophoresis and the PCR products were sequenced toverify their identity The PCR reactions were performed in athermocycler (iCycler iQ Real-Time PCR System Bio-RadHercules CA) using a fluorescence detection kit (QuantiTectSYBR Green PCR kit Qiagen) Primer annealing wasexecuted at 59 degC for 30 s and elongation at 72 degC for 20 sEvery single reaction with a final volume of 15 μl containeda primer concentration of 06 μM a template amountcorresponding to 2 ng of RNA and the master mix of the

TABLE 1 SEQUENCES OF THE SPECIFIC PRIMERS USED FOR REAL TIME-PCR AMPLIFICATION

Gene Forward primer (5prime-3prime) Reverse primer (5prime-3prime) Amplicon size NCBI accessionβ-actin CTGAACCCCAAAGCCAAC CACCATCACCAGAGTCCATCAC 147 bp NM_205518HPRT TGGCGATGATGAACAAGGT GCTACAATGTGGTGTCCTCCC 162 bp NM_204848Insulin CTTCTGGCTCTCCTTGTCTTTT CAAGGGACTGCTCACTAGGGGC 172 bp NM_2052222Insulin Receptor CGCTGAGAATAACCCTGGTC GCTGCCATCTGGATCATTTC 60 bp XM_0012333981IGF-1 CTTCAGTTCGTATGTGGAGACA GATTTAGGTGGCTTTATTGGAG 167 bp NM_0010043841IGF-1 Receptor TCCAACACAACACTGAAGAATC ACCATATTCCAGCTATTGGAGC 167 bp NM_2050321Insulin(hydrolysisprobe primers)

GGCTCTCTACCTGGTGTGTG CTCGCTTGACTTTCTCGTATTCC 149 bp NM_2052222

Insulin-hydrolysis-probe

CACTCCTGCCTCGCCACGC

IR ndash insulin receptor IGF-1 ndash insulin-like growth factor-1 IGF-1R ndash IGF-1 receptor

TABLE 2 PRIMER SEQUENCES USED TO COMPARE THE AMPLIFICATION OF DIFFERENT REGIONS OF THE INSULIN RECEPTOR MRNA

Gene Region on the sequence Primer (5prime-3prime) Amplicon sizeIR-LD L2-(binding) domain GGTCGTATGCCTTGGTTTC 118 bp AGCTGGCGAAGATTCTGG IR-TK Tyrosine kinase domain CGTCCACCACCAACACTG 58 bp TGCCATCAGCGATCTCTG IR-TK2 Tyrosine kinase domain GTTCACAGAGACCTGGCA 103 bp

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1438

fluorescence kit Each sample was analyzed in triplicate andthe fluorescence signal was measured with every cycle at72 degC In addition but only for insulin a hydrolysis probe andprimers designed by Biomers (Ulm Germany) were used toverify the specificity of insulin mRNA expression (Table 1)To compare the amplification of different regions from theIR mRNA sequence different pairs of primers comprisingdifferent exons were designed based on the sequence providedby the Entrez and Ensembl databases (Table 2)

Northern blot analysis Differences in transcript size wereanalyzed by northern blotting Biotin-labeled antisense probeswere designed using Oligo Explorer 14 based on thepublished mRNA chicken sequences in the Entrez andEnsembl databases Two specific probes for IR were used fornorthern blot analysis (Table 3) Approximately 1 μg of RNAwas run in a 08 formaldehyde-agarose gel blottedovernight onto a positively charged nylon membrane (RocheMannheim Germany) and crosslinked upon exposure toultraviolet light Blots were hybridized overnight with 100 ngml of biotin-labeled IR probe at 50 degC The next day themembranes were washed twice for 5 min each with 2times Saline-Sodium-Citrate buffer (SSC)01 sodium dodecyl sulfate

(SDS) at 42 degC followed by two additional washes for 15 mineach with 05times SSC01 SDS at the same temperature (1timesSSC buffer contains 015 M NaCl and 15 mM Na3-citrate2H2O pH 70) Chemiluminescence detection was performedwith the Chemiluminescent Nucleic Acid Detection Mode kit(Thermo Scientific GmbH Ulm Germany) Blots wereexposed to X-ray films Curix HT1 (AGFA LeverkusenGermany) and the time of exposure was adjusted as needed toobtain the desired signal strength Liver RNA was used as apositive control for IR expression and the brain was used asa nervous tissue control Two to four samples per tissue wereused for northern blot analysis with probe 1 (Table 4) but onlyone retina brain and liver sample was used for northern blotanalysis with probe 2

Statistics and data analysis Statistical analysis was donebased on the quantification cycle (Cq) values of the PCRproducts To test the primersrsquo efficiency a dilution curve wascreated using template amounts ranging from 05 to 160 ngper well The efficiency (E) for each primer was calculatedaccording to the formula E=10(minus1slope) giving a value between1 and 2 whereby 1 corresponds to 0 efficiency and 2 to100 The slope (m) was determined by plotting the mean of

TABLE 3 SEQUENCES OF THE SPECIFIC PROBES USED FOR NORTHERN BLOT ANALYSIS

Gene Probe Probe sequence RegionInsulinreceptor

1 AGCCATCTGGATCATTTCTCTCAGTGTTGGTGGTGGACG Tyrosine kinase domain

2 TTCCTCCACGGATATTTATAACCAAGCTCCCATTAACAACTGTGCAGCCA L2-binding domain

TABLE 4 SUMMARY OF TREATMENT GROUPS

Title of the experiment Lens treatment Duration oftreatment

Tissues n

Northern blot analysis of IR expression Without lenses1 - Liver 4 - Brain 4 - Retina 4 - RPE 2 - Choroid 4 - Sclera (both layers) 2Comparison of amplification of differentregions of IR

Without lenses1 - Liver 4

- Brain 4 - Retina 4 - RPE 4 - Choroid 4 - Fibrous sclera 4 - Cartilaginous sclera 4Insulin IGF-1 IR and IGF-1R mRNAexpression in the ocular fundal layers

Without lenses 4 h Retina 6

Plus lenses 4 h RPE 4

Minus lenses 4 h Choroid 4

Without lenses1 24 h Retina 9

Plus lenses 24 h RPE2 9

Minus lenses 24 h Choroid 9

24 h Fibrous sclera 9

24 h Cartilaginous sclera 9

1Same animals 2The RPE tissues from both eyes were analyzed separately for all 24 h treatment groups We then calculated the mean of both eyes before calculating the grand mean (See section ldquoTissue preparationrdquo)

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1439

Cq of each of the cDNA dilution samples versus the logarithmof the sample concentration The efficiencies were 203 forβ-actin 211 for hypoxanthin-guanin-phosphoribosyl-transferase (HPRT) 202 for IR 197 for IGF-1 and 198 forIGF-1R The mean normalized expression (MNE) [58] wasused to compare relative expression levels among differentgroups and was calculated according to the following formulawhere E is the primer efficiency reference corresponds to β-actin and the targets are IR IGF-1 and IGF-1R

MNE =(Ereference)

Cqreference mean

(Etarget)Cqtargetmean

MNE values were first analyzed using an outlier calculator(GraphPad La Jolla CA) Then one-way ANOVA(ANOVA) was applied for statistical comparison between thedifferent treatment groups A significant ANOVA (plt005)was followed by a Students t-test for post hoc analysisStatistical tests were performed using JMP version 7 software(SAS Institute Cary NC)

RESULTSNorthern blot analysis of insulin receptor expression inuntreated tissues Northern blots were used to compare thetranscript length of the IR (Figure 1) in neuronal andnonneuronal tissues The emphasis in the northern blotanalyses was placed on the investigation of transcript variantsamong different tissues and not on the quantification of theIR mRNA levels in those tissues Therefore a loading controlwas not used Figure 1 shows a northern blot result for IRexpression in the liver brain retina choroid and RPE

With probe 1 the brain and the retina showed twotranscripts approximately 43 kb and 13 kb long with thelonger transcript being more abundant In addition the brainshowed a third band of about 26 kb This transcript was alsofound in the liver together with the more abundant 13 kb

transcript and a small transcript of 04 kb which might be adegradation product (not shown) The choroid like the brainand retina also expressed two transcripts of 43 and 13 kbbut in this tissue the shorter transcript was more prominentthan the longer one The RPE contained only very smallamounts of IR mRNA and mainly the shorter variant Inaddition we analyzed two scleral samples (combined fibrousand cartilaginous layer) They expressed the 13 kb transcriptand two smaller transcripts of approximately 08 kb and 04kb (results not shown) With probe 2 which wascomplementary to a part of the L2-binding domain the retinaand the brain only showed one very strong bandcorresponding to 53 kb The same band was found in the liveralthough it was very faint in combination with a 20 kb band

Comparison of amplification of different regions of the insulinreceptor mRNA sequence by real-time PCR Three pairs ofprimers were designed to amplify different parts of the IRsequence The first primer pair called insulin receptor ligand-binding domain (IR-LD) amplified a part of the sequencecorresponding to the L2 domain in the receptor protein Theleucine-rich L2 domain is involved in the ligand binding andis encoded by exon numbers 4 and 5 The second primer pairIR-tyrosine kinase (TK) was designed to amplify a fragmentthat after translation belongs to the tyrosine-kinase domainwhich is a catalytic domain with phosphotransferase activityand comprises exons 16 and 17 The mentioned exons arelocalized on the longest transcript sequence for the IR mRNAbased on the Ensembl database Based on the results (Figure2) all tissues expressed mRNA for the tyrosine-kinase domainand the L2 (binding domain) although in different amountsFor both the IR-TK and IR-LD the retina and brain showedthe highest amounts followed by the choroid RPE liver andcartilaginous and fibrous sclera The third primer pair alsoamplified a part of the tyrosine-kinase domain and comprisedexons 17 and 18 Concerning the IR-TK2 region no specificPCR product was obtained in most tissues only the retina andliver showed a very low expression (data not shown)

Figure 1 Northern blot showing theexpression pattern of the insulinreceptor mRNA (probe 1) in the liver(L) brain (B) and different fundalocular layers the retina (R) choroid(Ch) and retinal pigment epithelium(RPE) Three major transcripts with 4326 and 13 kb were found although thepattern was different among the studiedtissues

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1440

Insulin receptor IGF-1 receptor IGF-1 and insulin mRNAexpression in ocular fundal layers of untreated animals Theexpression levels of IR IGF-1R IGF-1 and insulin weremeasured and compared in all fundal layers of untreatedchicks The results are shown in Figure 3 with a higherquantification cycle threshold corresponding to a loweramount of mRNA Both receptors and IGF-1 were detectedin all tissues but besides the retina the amount of IGF-1mRNA was very low In addition insulin mRNA was detectedin the retina but at very low concentrations and in the choroidwith even lower levels than in the retina Retinal insulinexpression was confirmed when an insulin-specific hydrolysisprobe was used The usage of a hydrolysis probe offers a highspecificity because hybridization and fluorescence will only

occur if the target DNA sequence exactly matches thehydrolysis probe sequence (for further information seereference [59]) The results for insulin mRNA quantificationare not shown in detail since the expression level was too lowto be precisely quantified

Comparing the mRNA amount between different fundallayers it turned out that the mRNA for both receptors wasmost abundant in the retina followed by the RPE choroidand cartilaginous and fibrous sclera In the fibrous sclera theCq values for all the genes were higher and therefore mRNAlevels were lower for the reference genes (β-actin andHPRT) as well as for all the other genesInsulin mRNA expression in the retina retinal pigmentepithelium and choroid after lens treatment Although only

Figure 2 Quantification cycle values fortwo different regions of the insulinreceptor sequence in different tissuesare shown All tissues expressed theinsulin receptor tyrosine kinase domainmRNA as well as the insulin receptorL2-rich binding domain mRNA Thesample size is 4 animals per tissuesError bars represent the standard errorof the mean

Figure 3 Quantification cycle valuesfor all genes in all fundal layers areshown The mRNA for the insulin receptor and insulin-like growth factorreceptors is most abundant in the retinafollowed by the RPE choroid cartilag-inous and fibrous sclera The samplesize is 6 animals per tissues Error barsrepresent the standard error of the mean

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1441

very low amounts of insulin mRNA were detectable in theretina and choroid of untreated animals lens treatment mightupregulate this amount The expression level of insulin wastherefore measured and compared in the retina RPE andchoroid after 4 and 24 h of lens treatment However nosignificant increase in insulin mRNA levels was detectedunder any of these conditionsInsulin receptor IGF-1 receptor and IGF-1 mRNA levels inthe retina after lens treatment Treatment with negative andpositive lenses did not significantly alter IR or IGF-1R mRNAexpression levels after 4 or 24 h of lens treatment comparedwith the appropriate control group (Figure 4) In additionneither 4 h nor 24 h of lens treatment had a significantinfluence on IGF-1 mRNA expression levels

Insulin receptor IGF-1 receptor and IGF-1 mRNA levels inthe retinal pigment epithelium after lens treatment Fourhours of myopic defocus induced a twofold downregulationof IR and an approximately fourfold downregulation ofIGF-1R mRNA levels compared to the respective controlgroups (Figure 5 ANOVA IR plus lens versus controlp=003 IGF-1R plus lens versus control p=003) This effectdisappeared when the animals were treated with lenses for 24h In comparison to the levels in control animals lenstreatment did not significantly influence IGF-1 mRNA levelsafter 4 or 24 h Nevertheless IGF-1 mRNA levels weresignificantly lower after 4 h of positive lens wear comparedto 4 h of negative lens wear (ANOVA minus versus plusp=005)

Insulin receptor IGF-1 receptor and IGF-1 mRNA levels inthe choroid after lens treatment In the choroid treatment withnegative lenses for 4 h resulted in an initial threefold increaseof IR mRNA concentration compared to the control group(Figure 6 ANOVA minus lens versus control p=003) Thesechanges in the minus lensndashtreated group remained after 24 hcompared with both the control and plus groups (ANOVA

minus lens versus control p=0004 minus lens versus plus lensp=001 Figure 6) IGF-1R was also increased in the minuslensndashtreated group compared to the plus lens group but onlyafter 24 h of lens treatment This effect was not as strong asfor IR (ANOVA minus lens versus plus lens p=005)IGF-1 mRNA expression in the choroid was very low anddifficult to quantify Within this limitation no significantchanges in IGF-1 mRNA expression were detectedInsulin receptor IGF-1 receptor and IGF-1 mRNA levels inboth scleral layers after lens treatment In the cartilaginoussclera lens treatment influenced neither IR nor IGF-1RmRNA levels after 24 h of lens treatment (Figure 7A)However in the fibrous sclera (Figure 7B) 24 h of positive-imposed defocus induced a threefold upregulation of IRmRNA levels compared with the control group and a fourfoldupregulation for IGF-1R at the same time point (ANOVAIR minus lens versus control p=0038 IGF-1R minus lensversus control p=0005) IGF-1 was expressed at low levelsespecially in the cartilaginous sclera Lens treatment did notinduce a significant change in IGF-1 mRNA levels in eitherlayer

DISCUSSIONInsulin receptor transcript variants Significant differencesin the transcript sizes of IR have been previously described indifferent tissues and animal species Four different IRtranscript variants were reported in chicks (Ensembl database)with transcript lengths varying between 198 and 3220 bp Allof these can be translated to a protein product but in the caseof the small transcripts the functions are unknown Inaddition several proteomic studies showed differences in themolecular weight of IR alpha and beta subunits amongdifferent tissues [60ndash63] IR therefore seems to undergodifferent transcriptional and translational regulation andposttranslational modifications including glycosylation orproteolytic cleavage in the CNS [64] In the brain the α-

Figure 4 Retinal insulin receptorinsulin growth factorndash1 receptor andinsulin-like growth factor-1 mRNAlevels after 4 and 24 h of plus (+7D) andminus (minus7D) lens treatment Results areexpressed as the mean normalizedexpression (MNE)plusmnSEM For the 4 hexperiment six animals per groups wereused nine per group were used for the24 h experiment Insulin receptor (IR)insulin-like growth factor (IGF)-1receptor (IGF-1R) and IGF-1 mRNAlevels were not significantlyinfluenced by lens wear in the retina

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1442

subunit of the IR has a lower molecular size compared to thatof other tissues It was therefore hypothesize that insulinexerts its proposed neuromodulatory effects mediated by thespecific IRs in the brain [63] In our study we found 43 kb26 kb and 13 kb long IR transcripts when we used a probethat corresponds to part of the sequence for the IR tyrosine-kinase domain An mRNA of 43 kb can account for a proteinas large as IR (1332 amino acids) whereas the smallesttranscript can only encode for parts of the protein We wereable to show that different tissues expressed transcripts ofdifferent lengths the RPE and sclera seem to express mainlyshort IR transcripts Moreover the smaller mRNA transcriptwas the predominant form in the choroid and liver while thelonger transcript was most abundant in the brain and retinaThis result may suggest that IRs in the retina and brain havea different function than in the nonneuronal tissues Asexpected from the Ensembl database only one long transcriptwas detected in the brain and retina when an L2-bindingdomainndashspecific probe was used

One recent publication stated that the chicken retina doesnot express IR mRNA [65] In contrast we found relativelyhigh amounts in the retina of our chicks Since different partsof IR were amplified in both studies we used three differentprimer pairs for the amplification of different parts of IR in anattempt to solve the discrepancy We found that the mRNAfor the insulin-binding domain and the tyrosine-kinasedomain are present at moderate levels in the retinaNevertheless one PCR product that was designed to amplifya short sequence between exons 17 and 18 could only be

detected in a very small amount in the retina and liversuggesting that this part of the sequence is not efficientlytranscribed or differs from that in the literaturePossible sites of action for insulin and IGF-1 in the eyeSeveral lines of evidence support a role of insulin andorIGF-1 in the control of eye growth [243234] including onestrong clue coming from chicken studies in which it wasshown that intravitreal injections of both peptides lead to thedevelopment of myopia The current study aimed to quantifythe mRNA expression of both the receptors and their ligandsin all fundal layers to gain a broader insight into their roleIR and IGF-1R were expressed in all tissues being moreabundant in the retina followed by the RPE choroid andcartilaginous and fibrous sclera Therefore assuming that themRNA is translated into protein all of these are possibly targetsites for insulin and IGF-1 action IGF-1 mRNA expressionwas only relatively high in the retina meaning that only herecould a significant amount of IGF-1 be produced This resultcorresponds with an older study [66] in which IGF-1-specifictranscripts were higher in the neural retina than in the scleraplus choroid plus RPE Although insulin mRNA expressionwas detected in the retina and choroid as confirmed with aspecific hydrolysis probe and gel electrophoresis its level wasvery low It was therefore impossible to quantify these lowamounts reliably Lens treatment did not increase insulinmRNA levels in the retina RPE or choroid Taken togetherit seems unlikely that changes in the amount of insulinproduced by the retina itself influences eye growth Rather itis more likely that IGF-1 plays a physiologic role in the retina

Figure 5 Insulin receptor insulin-likegrowth factor-1 and insulin-like growthfactorndash1 receptor mRNA levels after 4and 24 h of plus (+7D) and minus (minus7D)lens treatment in the retinal pigmentepithelium Results are expressed as themean normalized expression (MNE)plusmnSEM For the 4 h experiment sixanimals per groups were used 9 pergroup were used for the 24 h experimentStatistically significant differencesbetween the treated groups and thecontrol as determined by one-wayANOVA (ANOVA) are denoted in thegraph ( for plt005) Insulin receptor(IR) and insulin-like growth factor(IGF)-1 receptor (IGF-1R) mRNAlevels were lower after 4 h ofplus lens treatment compared tountreated control animals In additionIGF-1 mRNA levels were significantlylower after 4 h of plus lens treatmentcompared to the minus lensndashtreatedanimals After 24 h of lens treatmentthere were no significant differences inall genes between all groups

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1443

Insulin and IGF-1 mRNA levels in the retina seem to bedevelopmentally regulated as shown by binding assaysdecreasing by about 50 between the embryonic and the post-hatching stages [67] In the rat retina it has already beenshown that Muumlller cells may contain the mRNA necessary forde novo synthesis of insulin or a closely homologous peptide[37] However the source of insulin in the avascular chickenretina still remains unclear and due to the very low amountsit will be difficult to uncover its function

Influence of lens treatment on insulin receptor IGF-1receptor and IGF-1 expression in the fundal layers of the eyeLens wear influenced IR IGF-1R and IGF-1 mRNAexpression in different fundal layers of the chicken eye withmost changes seen in the RPE choroid and fibrous sclera Inour study the whole retina was used to measure changes ingene expression after induced positive and negative defocusInsulin and IGF-1R mRNA were both highly expressed in theretina but neither their expression level nor the IGF-1 mRNA

Figure 6 Insulin receptor insulin-likegrowth factorndash1 receptor and insulin-like growth factorndash1 mRNA levels after4 and 24 h of plus (+7D) and minus(minus7D) lens treatment in the choroidResults are expressed as the meannormalized expression (MNE)plusmnSEMFor the 4 h experiment six animals pergroups were used nine per group wereused for the 24 h experimentStatistically significant differencesbetween the treated groups and thecontrol as determined by one-wayANOVA (ANOVA) are denoted in thegraph ( for plt005 and for plt001)mRNA levels for insulinreceptor (IR) were significantlyincreased after 4 h and 24 h of minus lenstreatment and the insulin-like growthfactor (IGF)-1 receptor (IGF-1R)mRNA level was higher in the minuslensndashtreated group compared to the pluslensndashtreated group after 24 h of lenswear

Figure 7 Insulin receptor insulin-likegrowth factor-1 receptor and insulin-like growth factorndash1 mRNA levels after24 h of plus (+7D) and minus (minus7D) lenstreatment in the cartilaginous sclera (A)and fibrous sclera (B) Results areexpressed as the mean normalizedexpression (MNE)plusmnSEM Nine animalswere analyzed per group Statisticallysignificant differences between thetreated groups and the control asdetermined by one-way ANOVA(ANOVA) are denoted in the graph (for plt005 and for plt001) In thecartilaginous sclera the mRNAcontents of the two receptorswere not significantly different In thefibrous sclera the expression of theinsulin and the insulin-like growthfactor (IGF)-1 receptor (IGF-1R) washigher in the minus lensndashtreated groupcompared to controls

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1444

levels were influenced by defocus of 4 and 24 h In contrastshort plus lensndashtreatment periods (4 h) led to a strongdownregulation of both receptors in the RPE in addition theIGF-1 mRNA levels were much lower in the plus lens groupcompared to the minus lensndashtreated animals Insulin andIGF-1R signaling may therefore be involved in the onset ofgrowth arrest after negative defocus It is not surprising thatthe gene expression changes did not persist after 24 h oftreatment since it is known from microarray studies that onlya minority of gene expression changes seem to be common tomultiple treatment times [68] This can be interpreted in termsof different mechanisms one for the onset of increased (minuslens) or decreased (plus lens) eye growth and the other formaintaining its persistence An upregulation of IGF-1RmRNA expression in the RPE of chicks that were treated withminus lenses for 2 days was recently reported usingmicroarrays [69] We did not measure the upregulation of thisreceptor after one day but as already discussed time oftenmatters and may explain the different results

In the present study we were able to demonstrate thatshort treatment with plus lenses mainly affected mRNA levelsin the RPE whereas longer and minus lens treatmentinfluenced gene expression level in the choroid and fibroussclera The choroid is a thin layer of vascular pigmented tissuewith two main physiologic functions the nourishment of theexternal retina and the regulation of ocular temperature Bothinsulin and IGF-1 mRNA levels were present at low levels inthe choroid as confirmed with a specific hydrolysis probe andgel electrophoresis but it was impossible to quantify the lowamounts reliably Nevertheless the respective receptors levelschanged during the treatment Higher mRNA levels of IR werealready measured after 4 h and insulin and IGF-1R showedhigher expression levels than controls andor plus lensndashtreatedanimals after 24 h of lens wear Zhu and Wallman [24]recently hypothesized that although it is unknown whetherglucagon and insulin first act at the retina RPE or choroidthey finally act to change the physiologic state of the choroidwhich in turn modulates both choroidal thickness and scleralgrowth the latter being manifested as a change in the rate ofocular elongation Our results support this hypothesisEspecially after minus lens treatment the only changes inreceptor gene expression were detected in the choroid andsclera Since only low insulin and IGF-1 mRNA levels weredetected in the choroid is seems unlikely that they aresynthesized in significant amounts in this tissue Instead thetissue could be a potential target for these growth factorsrsquoaction given that insulin and IGF-1 injections in chicken eyeswere shown to induce choroidal thickness changes undersome experimental conditions Insulin increases ocularelongation without thinning the choroid in animals notwearing lenses Only when plus lenses were attached whichnormally cause choroidal thickness does insulin thin thechoroid as well as accelerating ocular elongation In contrast

IGF-1 injections increase ocular elongation together withthickening rather than thinning the choroid [2432]

In contrast to that of mammals the sclera of chicks iscomposed of two layers an inner cartilaginous layercontaining collagen types II and IV and aggrecan as thepredominant proteoglycans and an outer fibrous layer (likethat in mammals) which contains collagen type I and smallproteoglycans such as decorin [70] When the rate ofelongation of the eye is visually manipulated both sclerallayers show opposite modulation [62] with the fibrous scleragetting thinner and the cartilaginous becoming thicker duringinduced eye growth Interestingly we were able to show thatthe fibrous sclera showed a similar upregulation of IR mRNAexpression as the choroid One of the reasons for thisupregulation of the IGF-1R mRNA expression in the fibroussclera might be that IGF-1 exerts an effect on the developingocular tissue by influencing the synthesis and degradation ofthe extracellular matrix in chicks [71] In the guinea pigmodel it was already shown that IGF-1 can induce fibroblastproliferation in a dose-dependent manner through the signaltransducer and activator of transcription 3 (STAT3) signalingtransduction pathway [7273] No lens-induced changes ingene expression were detected in the cartilaginous scleraCompared to the fibrous sclera the cartilaginous sclera hadhigher mRNA levels for all measured genes This result isconsistent with a previous study by Schippert et al [74] Theseauthors also showed that the fibrous sclera generally has lowermRNA levels than the cartilaginous sclera in untreated chicksCo-cultures already demonstrated that the choroid caninfluence the underlying sclera for example by changingproteoglycan synthesis in the sclera [75] Retinoic acid thesynthesis of which is influenced in opposite directions bypositive and negative defocus in both the retina and choroidhas been shown to affect proteoglycan synthesis in the chicksclera [17] Moreover retinoic acid might interact with theIGF-1 signaling by changing the level of IGF-binding proteinsand thereby modulating scleral IGF-1 levels [76]Comparison to studies in humans Recent epidemiologicaland retrospective case series studies in humans underlined arole of IGF-1 as regulator of ocular growth at least in patientswith primary growth hormone insensitivity [77] children withgrowth hormone deficiency [78] and children born preterm[79] Low IGF-1 serum concentrations were associated withhyperopia in these studies These results are consistent withour animal study showing an association of reduced IGF-1mRNA levels with the development of hyperopia in the RPEof chicks Interestingly patients with primary growthhormone insensitivity who received IGF-1 therapy showed atendency toward mild myopia These findings point toward arole of IGF-1 as a growth signal in humans as well as in chicksImplications and summary In summary we found that a shortexposure to myopic defocus (plus lenses) leads to adownregulation of insulin receptor and IGF-1R receptor

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1445

expression in the RPE In contrast hyperopic defocus imposed by minus lenses (but not myopic defocus) signifi-cantly increased their expression levels in the choroidSimilar changes were seen in the fibrous sclera Taken

IGF-1 signaling during eye growth Whether different IRtranscript variants found in the retina and choroid are also

translated into proteins with different functions needs to beshown in the future

ACKNOWLEDGMENTSThis work was supported by the European Union Marie CurieResearch training Network MYEUROPIA Grant MRTN-CT-2006ndash034021

REFERENCES1 Lin LL Shih YF Tsai CB Chen CJ Lee LA Hung PT Hou

PK Epidemiologic study of ocular refraction amongschoolchildren in Taiwan in 1995 Optom Vis Sci 199976275-81 [PMID 10375241]

2 Vitale S Sperduto RD Ferris FL 3rd Increased prevalence ofmyopia in the United States between 1971ndash1972 and 1999ndash2004 Arch Ophthalmol 2009 1271632-9 [PMID20008719]

3 Dirani M Chamberlain M Garoufalis P Chen C Guymer RHBaird PN Refractive errors in twin studies Twin Res HumGenet 2006 9566-72 [PMID 16899164]

4 Morgan I Rose K How genetic is school myopia Prog RetinEye Res 2005 241-38 [PMID 15555525]

5 Wallman J Turkel J Trachtman J Extreme myopia producedby modest change in early visual experience Science 19782011249-51 [PMID 694514]

6 McBrien NA Norton TT The development of experimentalmyopia and ocular component dimensions in monocularlylid-sutured tree shrews (Tupaia belangeri) Vision Res 199232843-52 [PMID 1604853]

7 Wiesel TN Raviola E Myopia and eye enlargement afterneonatal lid fusion in monkeys Nature 1977 26666-8[PMID 402582]

8 Troilo D Judge SJ Ocular development and visual deprivationmyopia in the common marmoset (Callithrix jacchus) VisionRes 1993 331311-24 [PMID 8333155]

9 Howlett MH McFadden SA Spectacle lens compensation inthe pigmented guinea pig Vision Res 2009 49219-27[PMID 18992765]

10 Schaeffel F Glasser A Howland HC Accommodationrefractive error and eye growth in chickens Vision Res 198828639-57 [PMID 3195068]

11 Wallman J Wildsoet C Xu A Gottlieb MD Nickla DL MarranL Krebs W Christensen AM Moving the retina choroidalmodulation of refractive state Vision Res 1995 3537-50[PMID 7839608]

12 Stone RA Laties AM Raviola E Wiesel TN Increase in retinalvasoactive intestinal polypeptide after eyelid fusion inprimates Proc Natl Acad Sci USA 1988 85257-60 [PMID2448769]

13 Seltner RL Stell WK The effect of vasoactive intestinal peptideon development of form deprivation myopia in the chick apharmacological and immunocytochemical study Vision Res1995 351265-70 [PMID 7610586]

14 Stone RA Lin T Laties AM Iuvone PM Retinal dopamine andform-deprivation myopia Proc Natl Acad Sci USA 198986704-6 [PMID 2911600]

15 Iuvone PM Tigges M Stone RA Lambert S Laties AMEffects of apomorphine a dopamine receptor agonist onocular refraction and axial elongation in a primate model ofmyopia Invest Ophthalmol Vis Sci 1991 321674-7 [PMID2016144]

16 Schaeffel F Hagel G Bartmann M Kohler K Zrenner E 6-Hydroxy dopamine does not affect lens-induced refractiveerrors but suppresses deprivation myopia Vision Res 199434143-9 [PMID 8116274]

17 Mertz JR Wallman J Choroidal retinoic acid synthesis apossible mediator between refractive error and compensatoryeye growth Exp Eye Res 2000 70519-27 [PMID10866000]

18 Seko Y Shimizu M Tokoro T Retinoic acid increases in theretina of the chick with form deprivation myopia OphthalmicRes 1998 30361-7 [PMID 9731117]

19 Bitzer M Feldkaemper M Schaeffel F Visually inducedchanges in components of the retinoic acid system in fundallayers of the chick Exp Eye Res 2000 7097-106 [PMID10644425]

20 Feldkaemper MP Schaeffel F Evidence for a potential role ofglucagon during eye growth regulation in chicks VisNeurosci 2002 19755-66 [PMID 12688670]

21 Buck C Schaeffel F Simon P Feldkaemper M Effects ofpositive and negative lens treatment on retinal and choroidalglucagon and glucagon receptor mRNA levels in the chickenInvest Ophthalmol Vis Sci 2004 45402-9 [PMID14744878]

22 Vessey KA Rushforth DA Stell WK Glucagon- and secretin-related peptides differentially alter ocular growth and thedevelopment of form-deprivation myopia in chicks InvestOphthalmol Vis Sci 2005 463932-42 [PMID 16249466]

23 Feldkaemper MP Burkhardt E Schaeffel F Localization andregulation of glucagon receptors in the chick eye andpreproglucagon and glucagon receptor expression in themouse eye Exp Eye Res 2004 79321-9 [PMID 15336494]

24 Zhu X Wallman J Opposite effects of glucagon and insulin oncompensation for spectacle lenses in chicks InvestOphthalmol Vis Sci 2009 5024-36 [PMID 18791176]

25 Stone RA Liu J Sugimoto R Capehart C Zhu X Pendrak KGABA experimental myopia and ocular growth in chickInvest Ophthalmol Vis Sci 2003 443933-46 [PMID12939312]

26 Rohrer B Stell WK Basic fibroblast growth factor (bFGF) andtransforming growth factor beta (TGF-beta) act as stop andgo signals to modulate postnatal ocular growth in the chickExp Eye Res 1994 58553-61 [PMID 7925692]

27 Honda S Fujii S Sekiya Y Yamamoto M Retinal control onthe axial length mediated by transforming growth factor-betain chick eye Invest Ophthalmol Vis Sci 1996 372519-26[PMID 8933768]

28 Fischer AJ Morgan IG Stell WK Colchicine causes excessiveocular growth and myopia in chicks Vision Res 199939685-97 [PMID 10341956]

29 Bitzer M Schaeffel F Defocus-induced changes in ZENKexpression in the chicken retina Invest Ophthalmol Vis Sci2002 43246-52 [PMID 11773038]

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1446

together the current study supports a role of insulin andor

30 Schippert R Burkhardt E Feldkaemper M Schaeffel FRelative axial myopia in Egr-1 (ZENK) knockout miceInvest Ophthalmol Vis Sci 2007 4811-7 [PMID 17197510]

31 Fischer AJ Omar G Walton NA Verrill TA Unson CGGlucagon-expressing neurons within the retina regulate theproliferation of neural progenitors in the circumferentialmarginal zone of the avian eye J Neurosci 20052510157-66 [PMID 16267223]

32 Feldkaemper MP Neacsu I Schaeffel F Insulin acts as apowerful stimulator of axial myopia in chicks InvestOphthalmol Vis Sci 2009 5013-23 [PMID 18599564]

33 Vessey KA Lencses KA Rushforth DA Hruby VJ Stell WKGlucagon receptor agonists and antagonists affect the growthof the chick eye a role for glucagonergic regulation ofemmetropization Invest Ophthalmol Vis Sci 2005463922-31 [PMID 16249465]

34 Metlapally R Ki CS Li YJ Tran-Viet KN Abbott D MalecazeF Calvas P Mackey DA Rosenberg T Paget S GuggenheimJA Young TL Genetic association of insulin-like growthfactor-1 polymorphisms with high-grade myopia in aninternational family cohort Invest Ophthalmol Vis Sci 2010514476-9 [PMID 20435602]

35 Waldbillig RJ Pfeffer BA Schoen TJ Adler AA Shen-Orr ZScavo L LeRoith D Chader GJ Evidence for an insulin-likegrowth factor autocrine-paracrine system in the retinalphotoreceptor-pigment epithelial cell complex J Neurochem1991 571522-33 [PMID 1717648]

36 Calvaruso G Vento R Giuliano M Lauricella M Gerbino ETesoriere G Insulin-like growth factors in chick embryoretina during development Regul Pept 1996 6119-25[PMID 8701023]

37 Das A Pansky B Budd GC Demonstration of insulin-specificmRNA in cultured rat retinal glial cells Invest OphthalmolVis Sci 1987 281800-10 [PMID 3312078]

38 Kuwabara T Cogan DG Retinal glycogen Arch Ophthalmol1961 66680-8 [PMID 14460992]

39 Budd GC Pansky B Glatzer L Preproinsulin mRNA in the rateye Invest Ophthalmol Vis Sci 1993 34463-9 [PMID8440600]

40 Meimaridis DG Morse DE Pansky B Budd GC Insulinimmunoreactivity in the fetal and neonatal rat retina NeurosciLett 1990 118116-9 [PMID 2259461]

41 Rhoads DE DiRocco RJ Osburn LD Peterson NARaghupathy E Stimulation of synaptosomal uptake ofneurotransmitter amino acids by insulin possible role ofinsulin as a neuromodulator Biochem Biophys Res Commun1984 1191198-204 [PMID 6143558]

42 Shimizu H Bray GA Effects of insulin on hypothalamicmonoamine metabolism Brain Res 1990 510251-8 [PMID1691951]

43 Amoroso S Taglialatela M Canzoniero LM Cragoe EJ Jr diRenzo G Annunziato L Possible involvement of Ca++ ionsprotein kinase C and Na(+)-H+ antiporter in insulin-inducedendogenous dopamine release from tuberoinfundibularneurons Life Sci 1990 46885-94 [PMID 2157121]

44 Froesch ER Zapf J Insulin-like growth factors and insulincomparative aspects Diabetologia 1985 28485-93 [PMID3902539]

45 Rechler MM Nissley SP The nature and regulation of thereceptors for insulin-like growth factors Annu Rev Physiol1985 47425-42 [PMID 2986537]

46 Kim JJ Accili D Signalling through and insulin receptorswhere is the specificity Growth Horm IGF Res 20021284-90 [PMID 12175645]

47 Kahn CR The molecular mechanism of insulin action AnnuRev Med 1985 36429-51 [PMID 2986528]

48 Nilsson A Isgaard J Lindahl A Dahlstrom A Skottner AIsaksson OG Regulation by growth hormone of number ofchondrocytes containing IGF-I in rat growth plate Science(New York NY) 1986 233571-4

49 Holdengreber V Ren Y Ben-Shaul Y Hausman RE Co-localization of the insulin receptor jun protein and cholineacetyltransferase in embryonic chick retina Exp Eye Res1998 66307-13 [PMID 9533858]

50 Yarden Y Ullrich A Molecular analysis of signal transductionby growth factors Biochemistry 1988 273113-9 [PMID3291942]

51 Yarden Y Ullrich A Growth factor receptor tyrosine kinasesAnnu Rev Biochem 1988 57443-78 [PMID 3052279]

52 Garcia-de Lacoba M Alarcon C de la Rosa EJ de Pablo FInsulininsulin-like growth factor-I hybrid receptors with highaffinity for insulin are developmentally regulated duringneurogenesis Endocrinology 1999 140233-43 [PMID9886830]

53 Gammeltoft S Haselbacher GK Humbel RE Fehlmann MVan Obberghen E Two types of receptor for insulin-likegrowth factors in mammalian brain EMBO J 198543407-12 [PMID 3004958]

54 Heidenreich KA Zahniser NR Berhanu P Brandenburg DOlefsky JM Structural differences between insulin receptorsin the brain and peripheral target tissues J Biol Chem 19832588527-30 [PMID 6345543]

55 Gammeltoft S Fehlmann M Van Obberghen E Insulinreceptors in the mammalian central nervous system bindingcharacteristics and subunit structure Biochimie 1985671147-53 [PMID 3907719]

56 Rees-Jones RW Hendricks SA Quarum M Roth J The insulinreceptor of rat brain is coupled to tyrosine kinase activity JBiol Chem 1984 2593470-4 [PMID 6368546]

57 Lowe WL Jr Boyd FT Clarke DW Raizada MK Hart CLeRoith D Development of brain insulin receptors structuraland functional studies of insulin receptors from whole brainand primary cell cultures Endocrinology 1986 11925-35[PMID 3522210]

58 Simon P Q-Gene processing quantitative real-time RT-PCRdata Bioinformatics 2003 191439-40 [PMID 12874059]

59 Bustin SA Absolute quantification of mRNA using real-timereverse transcription polymerase chain reaction assays J MolEndocrinol 2000 25169-93 [PMID 11013345]

60 Waldbillig RJ Fletcher RT Chader GJ Rajagopalan SRodrigues M LeRoith D Retinal insulin receptors 1Structural heterogeneity and functional characterization ExpEye Res 1987 45823-35 [PMID 3123267]

61 Waldbillig RJ LeRoith D Insulin receptors in the peripheralnervous system a structural and functional analysis BrainRes 1987 409215-20 [PMID 3555703]

62 Shemer J Raizada MK Masters BA Ota A LeRoith D Insulin-like growth factor I receptors in neuronal and glial cells

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

1447

Characterization and biological effects in primary culture JBiol Chem 1987 2627693-9 [PMID 2953724]

63 Masters BA Shemer J Judkins JH Clarke DW Le Roith DRaizada MK Insulin receptors and insulin action indissociated brain cells Brain Res 1987 417247-56 [PMID3308002]

64 Gammeltoft S Kowalski A Fehlmann M van Obberghen EInsulin receptors in rat brain insulin stimulatesphosphorylation of its receptor beta-subunit FEBS Lett 198417287-90 [PMID 6428937]

65 Fischer AJ Scott MA Zelinka C Sherwood P A novel type ofglial cell in the retina is stimulated by insulin-like growthfactor 1 and may exacerbate damage to neurons and Mullerglia Glia 2010 58633-49 [PMID 19941335]

66 Danias J Stylianopoulou F Expression of IGF-I and IGF-IIgenes in the adult rat eye Curr Eye Res 1990 9379-86[PMID 1692782]

67 Waldbillig RJ Arnold DR Fletcher RT Chader GJ Insulin andIGF-1 binding in chick sclera Invest Ophthalmol Vis Sci1990 311015-22 [PMID 2162332]

68 Stone RA Khurana TS Gene profiling in experimental modelsof eye growth clues to myopia pathogenesis Vision Res2010 502322-33 [PMID 20363242]

69 Zhang Z Su J Zhang Y Wildsoet C Effect of imposed myopicdefocus on the gene expression profiles ARVO AnnualMeeting 2008 April 27-May 1 Fort Lauderdale (FL)

70 Rada JA Thoft RA Hassell JR Increased aggrecan (cartilageproteoglycan) production in the sclera of myopic chicks DevBiol 1991 147303-12 [PMID 1916012]

71 Tripathi BJ Tripathi RC Livingston AM Borisuth NS The roleof growth factors in the embryogenesis and differentiation ofthe eye Am J Anat 1991 192442-71 [PMID 1781453]

72 Zhu ZC Zhang JS Ji XY Wang YF Chen Y Li XJ Insulin-like growth factor-1 induced activation and expression ofsignal transducers and activators of transcription-3 in scleralfibroblast of guinea pigs Zhonghua Yan Ke Za Zhi 2007431125-9 [PMID 18331685]

73 Kusakari T Sato T Tokoro T Visual deprivation stimulates theexchange of the fibrous sclera into the cartilaginous sclera inchicks Exp Eye Res 2001 73533-46 [PMID 11825024]

74 Schippert R Brand C Schaeffel F Feldkaemper MP Changesin scleral MMP-2 TIMP-2 and TGFbeta-2 mRNA expressionafter imposed myopic and hyperopic defocus in chickens ExpEye Res 2006 82710-9 [PMID 16289164]

75 Nickla DL Wallman J The multifunctional choroid Prog RetinEye Res 2010 29144-68 [PMID 20044062]

76 Jones JI Clemmons DR Insulin-like growth factors and theirbinding proteins biological actions Endocr Rev 1995163-34 [PMID 7758431]

77 Bourla DH Laron Z Snir M Lilos P Weinberger D Axer-Siegel R Insulinlike growth factor I affects oculardevelopment a study of untreated and treated patients withLaron syndrome Ophthalmology 2006 1131197e1-5

78 Parentin F Tonini G Perissutti P Refractive evaluation inchildren with growth defect Curr Eye Res 2004 2811-5[PMID 14704909]

79 Hok-Wikstrand M Hard AL Niklasson A Hellstrom A Earlypostnatal growth variables are related to morphologic andfunctional ophthalmologic outcome in children born pretermActa Paediatr 2010 99658-64 [PMID 20105141]

Molecular Vision 2011 171436-1448 lthttpwwwmolvisorgmolvisv17a162gt copy 2011 Molecular Vision

Articles are provided courtesy of Emory University and the Zhongshan Ophthalmic Center Sun Yat-sen University PR ChinaThe print version of this article was created on 26 May 2011 This reflects all typographical corrections and errata to the articlethrough that date Details of any changes may be found in the online version of the article

1448