Inhibition on brown rot disease and induction of defence responsein harvested peach fruit by nitric oxide solution

Rongxin Gu & Shuhua Zhu & Jie Zhou & Na Liu &

Jingying Shi

Accepted: 3 February 2014# Koninklijke Nederlandse Planteziektenkundige Vereniging 2014

Abstract Nitric oxide (NO) is an important signal mol-ecule involved in numerous plant responses to bioticand abiotic stresses. The effect of nitric oxide (NO)solution on pathogen infection and defence responseof peach (Prunus persica (L.) Batsch) fruit againstbrown rot disease caused by Monilinia fructicola wasinvestigated. The results showed that 15 μmol l−1 NOsolution did not significantly inhibit spore germination,germ tube length or pathogenicity of M. fructicola, butsignificantly reduced disease incidence and lesion areasin the fruit. Although 100 μmol l−1 NO solution effec-tively inhibited the spore germination, germ tube elon-gation and pathogenicity ofM. fructicola, the high con-centration of NO solution caused damage to the fruit.Moreover, 15 μmol l−1 NO enhanced the activities ofchitinase (CHI) and β-1,3-glucanase (GNS) in the fruit.RT-PCR analysis showed that the expression of fourgenes, CHI, GNS, pathogenesis-related protein 1 and10 genes (PR-1, PR-10) all increased after NO treat-ment. Conversely, pretreatment with 100 μmol l−1 NO

s c a v e n g e r , 2 - 4 - c a r b o x y p h e n y l - 4 , 4 , 5 , 5 -tetramethylimidazoline-1-oxyl-3-oxide (cPTIO), ren-dered the fruit relatively susceptible to pathogen infec-tion and inhibited the defence response of the fruit.These results suggest that NO solution treatment canprotect peach fruit from pathogen infection by inducingthe activities of the defence enzymes and the expressionof PR genes.

Keywords Peach fruit . Nitric oxide .Moniliniafructicola . Postharvest disease . Defence response

Introduction

Peach (Prunus persica (L.) Batsch) fruit are very per-ishable and highly susceptible to postharvest diseases.Brown rot caused by Monilinia fructicola (G. Wint.)Honey is one of the major diseases in harvested peachfruit (Landgraf and Zehr 1982). Refrigeration has beenwidely used in long-term storage of fruit to limit storagedisease and maintain fruit quality, but low temperaturestorage can cause chilling injury or internal breakdownof peach fruit, resulting in a reduction or loss of diseaseresistance (Luza et al. 1992). Several synthetic chemicalfungicides have also been used to effectively control thisdisease. However, chemicals remain problematic, as faras contamination, pathogen resistance and environmen-tal pollution are concerned. So, it is necessary to seekother alternatives for postharvest disease control ofpeach fruit.

Eur J Plant PatholDOI 10.1007/s10658-014-0393-x

N. Liu : J. Shi (*)College of Food Science and Engineering, ShandongAgricultural University,Taian 271018, Shandong Province, Chinae-mail: jyshi2003@gmail.com

S. Zhu : J. ZhouCollege of Chemistry and Material Science, ShandongAgricultural University,Taian 271018, Shandong Province, China

R. GuJiangsu Academy of Agricultural Sciences,Nanjing 210014, Jiangsu Province, China

As an important endogenous signal molecule, nitricoxide (NO) has been proven to be a major component insignal transduction systems in plants, which can inducedisease resistance and particular enzymes catalyzingbiosynthetic reactions. It has been shown that NO playsprominent roles in the activation of defence-associatedresponses in several plants against various phytopatho-gen infections. Manjunatha et al. (2008) reported thatNO donors Nitroso-R-Salt, 2-Nitroso-1-Naphthol andSodium Nitro Prusside (SNP) could protect pearl millet[(Pennisetum glaucum L.) R. Br.] against downy mil-dew disease caused by Sclerospora graminicola [(Sacc).Schroet]. It was also reported that 1 mmol l−1 SNP couldincrease the resistance of tomato fruit to gray mold rotcaused by Botrytis cinerea (Lai et al. 2011). Diseaseresistance induced in plants has often been correlatedwith the accumulation of defence-related enzymes andthe induction of some defensive genes. Chitinase (CHI,EC 3.2.1.14) and β-1,3-glucanase (GNS, EC 3.2.1.6)are considered potentially important in host resistancemechanisms. It has been reported that these two en-zymes are the main enzymatic systems for protectingplants against pathogen-caused damage (Liu et al.2012a). In addition, synthesis of certain proteins hasbeen reported to be triggered in plant tissues after infec-tion with fungi, bacteria, and viruses, or under insectattack. These proteins, known as pathogenesis-relatedproteins (PRs), were classified into 17 families (PR-1 toPR-17) on the basis of their common biochemical andbiological properties (van Loon et al. 2006), and havebeen used as markers of plant defence responses(Mitsuhara et al. 2008). Some PRs that have acidiccharacteristics are located in the apoplast space and acton the invading pathogens before tissue penetration.Others, which are basic proteins located in the vacuole,can act after tissue damage (van Loon et al. 2006). ThePR proteins are thought to play important roles in in-duced and in some cases constitutive resistance. Thesystemic activation of certain PR protein genes has ledto their association with various forms of systemic in-duced resistance in a number of plants (van Loon andvan Strien 1999).

Previous studies also showed that NO, as a novelantibacterial agent in wound infection, could inhibit thegrowth of several bacteria such as Staphylococcus au-reus, Pseudomonas aeruginosa, Candida albicans andso on. However, little is known as to whether NO has aninhibitory effect on phytopathogens in fruits and vege-tables. Recently, several studies have revealed that

postharvest NO application can delay the ripening ofintact and fresh-cut produce (Singh et al. 2009) andinhibit ethylene biosynthesis (Gasic et al. 2004).However, only a few reports have focused on the effectof NO on postharvest disease resistance (Fan et al. 2008;Lai et al. 2011). Also, it is not clear whether NO caninduce disease resistance in harvested peach fruit.

The purpose of this study was to examine the effectof NO on: (i) in vitro growth of M. fructicola, (ii) thecontrol of brown rot caused by M. fructicola, (iii) theenzyme activities of chitinase (CHI) and β-1,3-glucanase (GNS), and (iv) the expression of defence-related genes in peach fruit. This work will providesome valuable information for the application of NOin controlling postharvest diseases of fruits andvegetables.

Materials and methods

Fruit materials

Peach fruit (Prunus persica (L.) Batsch, cv. ‘Feicheng’)were picked from trees grown in Feicheng, ShandongProvince, China, at a pre-climacteric but physiologicallymature stage, with an average firmness of 80 N cm−2.Fruit were further selected for uniformity of size andground colour, and free of defects and mechanicaldamage.

Pathogen inoculum

M. fructicola was isolated from infected peach fruit andmaintained on potato dextrose agar (PDA) medium at4 °C. In order to verify its ability to cause decay, thepathogen was inoculated into wounds of peach fruit andre-isolated onto PDA once an infection was established.Spores were obtained from seven-day-old cultures at25 °C by flooding the cultures with sterile water. Theconcentration of spores was adjusted to 1×106 sporesml−1 with a haemocytometer for the followingexperiments.

Assay of the effect of NO on spore germination rateand germ tube elongation and pathogenicityof M. fructicola

NO saturated solutions (2 mmol l−1) (provided by thelaboratory of College of Chemistry and Material

Eur J Plant Pathol

Science, ShandongAgricultural University, China) wereinjected into the deoxygenated water in container and 0,10, 30, 60 and 200 μmol l−1 NO solutions were pre-pared. Aliquots of a spore suspension of M. fructicolawere added to 90 ml PDB (1 l distilled water containing200 ml extract of boiled potatoes, 20 g dextrose, 3 gnutrient broth and 20 g agar) medium to obtain a finalconcentration of 1.0×105 spores ml−1. The effect of NOon spore germination rate and germ tube elongation ofM. fructicola was determined according to Jemric et al.(2011) with some modifications. One millilitre sporesuspensions were poured into a 25-ml airtight triangularflask with gas inlet and outlet ducts. The flask wassealed with a rubber cork, nitrogen (N2) was injectedfor 20 min and a gas analyzer (COMBO 280, Italy) wasused for detecting the oxygen content in the water. Afterthe oxygen was eliminated, the gas outlet duct wasclosed. Then, 1.0 ml deoxygenated water or 1 ml 10,30, 60 and 200 μmol l−1 NO solution were injected intothe deoxygenated water in container and 0, 5, 15, 30 or100 μmol l−1 NO solutions were prepared, respectively.The spores were incubated for 10min at 25 °C in the NOsolutions. Then the rubber corks were removed and theflasks were covered with tinfoil and incubated at 25 °Cfor 5 h on a rotary shaker at 200 min−1. Approximately200 spores ofM. fructicolawere measured for germina-tion rate and germ tube elongation per treatment withineach replicate under microscope. Each treatment wasreplicated three times and the experiment was repeatedthree times.

The pathogenicity of M. fructicola after NO treat-ment was measured, according to Gu et al. (2006). Onewound (4 mm deep) was made on the surface of eachfruit with a sterile nail. Then, peach fruit were inoculatedwith spore suspensions (1×105 sporesml−1) treated withNO solution of different concentrations describedabove. Twenty microlitre of M. fructicola spore sus-pension was administered into each wound. Aftereach treatment, the fruit were placed in a coveredplastic food tray, and each tray was enclosed in apolyethylene bag and stored at 25 °C. The fruitinoculated with 20 μl of M. fructicola spore suspen-sion (1×105 spores ml−1) without NO treatment wasset up as a control. Twenty fruits were inoculatedper treatment with three replicates. After 3 days, thepathogenicity of the pathogen was observed andrepresented as the lesion area of disease spots inthe fruit. The lesion area was calculated as 3.14×(le-sion diameter/2)2.

Measurement of the effect of NO on brown rot diseaseof peach fruit

The experiment was carried out at 25±1 °C. One hun-dred eighty fruits were divided into three equal groups:20 fruit for each replicate of each group. NO and cPTIOsolutions were prepared according to Shi et al. (2011)and diluted with deoxygenated and deionized water tofinal concentrations of 15 μmol l−1 and 100 μmol l−1,respectively. Peach fruit were treated as follows: Group1 was dipped for 10 min in deoxygenated and deionizedwater (Control); Group 2 was dipped for 10 min in15 μmol l−1 NO aqueous solutions (NO); Group 3 wasdipped for 10 min in 100 μmol l−1 cPTIO aqueoussolutions (cPTIO). All fruit in each treatment were driedin air. In order to investigate the action of NO oncontrolling brown rot caused by M. fructicola in peachfruit, the methods were applied as mentioned in ‘Assayof the effect of NO on spore germination rate and germtube elongation and pathogenicity ofM. fructicola’. Onewound (3 mm deep and 3 mm wide) was made with asterile nail on the equator of each fruit treated in Group1, 2 and 3. Ten microlitre ofM. fructicola spore suspen-sion (1×105 spores ml−1) was administered into eachwound. After each treatment, fruit were placed in aplastic food tray, and each tray was enclosed in a poly-ethylene bag and stored at 25 °C. Disease incidence andlesion size of the fruit caused by M. fructicola weredetermined. Each treatment contained three replicateswith 20 fruits per replicate, and the entire experimentwas repeated three times. Incidence represented thepercentage of fruit with lesion, while lesion size wasmeasured only on those wounds that were infected.

Assay of enzyme activities in peach fruit

Samples excluding infection sites were taken from 4fruit stored at 25 °C at 0, 12, 24, 48 and 72 h aftertreatment. Each treatment consisted of three replicatesand the experiment was repeated three times.

For chitinase (CHI) and β-1,3-glucanase (GNS), en-zymes were extracted according to Cao and Jiang(2006). Fruit tissue samples (5 g) were homogenizedin 20 ml of ice-cold sodium acetate buffer(100 mmol l−1, pH5.0) containing 5 m mol l−1 β-mercaptoethanol and 1 mmol l−1 ethylene diaminetetraacetic acid (EDTA) at 4 °C. The homogenate wascentrifuged at 12,000×g for 20 min at 4 °C, and theresulting supernatant was collected for the enzyme

Eur J Plant Pathol

assay. CHI activity was determined with chitin azure asthe substrate, according to the method of Boller et al.(1983). β-1,3-glucanase activity was assayed with lam-inarin as the substrate, following the method describedby Ippolito et al. (2000). Reaction products were mea-sured spectrophotometrically at 585 nm (for CHI) or500 nm (for GNS). The activities of CHI and GNS wereall expressed as U g−1 FW, where one unit was definedas 10−9 mol N-acetyl-D-glucosamine produced or theproduction of 1 mol of glucose equivalent per hour.

Measurement of CHI, GNS, PR-1 and PR-10 geneexpression level

Isolation of total RNA and cloning of PR-1 geneby RT-PCR

Peach pulp about 2 cm width and 1 cm thick were cutinto small pieces, frozen in liquid nitrogen and stored at−80 °C. Then, 5 g tissue was ground to a fine powderwith liquid nitrogen. Total RNA was extracted fromtissues at various time intervals (0, 12, 24, 48 and 72 hafter inoculation) using the method of Gasic et al.(2004). First-strand cDNA was synthesized withTaKaRa RNA LA PCR™ Kit (AMV) (TaKaRa,Shanghai, China) and PCR conditions were 94 °C for3 min; 34 cycles of 94 °C for 1 min, 55 °C for 50 s,72 °C for 2 min; and finally 72 °C for 10 min. Theprimers (F: 5′ - TGC CCA RRA CWC HCC VCA - 3′,R: 5′ - CTG YCC VAC ATA GTT GCC - 3′) of PR-1were designed based on its conserved amino acid se-quences and annealing temperature for PCR. The PCRproduct was cloned into pGEM-T Easy vector(Promega, Shanghai, China) and sequenced. The nucle-otide sequence of the cDNA was analyzed by blastsearch of the GenBank Database at NCBI. PR-1 partialcDNA sequence was deposited in GenBank (accessionNo. KC757351).

Real-time quantitative PCR analysis of defence geneexpression

Total RNA (100 ng) was extracted as mentioned aboveand reverse-transcribed into single strand cDNA usingPrimeScript RT reagent Kit with gDNA Eraser (PerfectReal Time) (TaKaRa, Shanghai, China). Real-time PCRwas performed with SYBR® Premix Ex TaqTM Kit(TaKaRa, Shanghai, China), by using SYBR Green Imethod on a multicolour real-time PCR detection

system (Bio-Rad IQ5, USA). TEF2 (TC3544) andTubulin-α (DY650410) were selected as the referencegenes from peach fruit (Liu et al. 2012b; Tong et al.2009). Cycling parameters for each gene amplificationwere 95 °C for 5 min; 25 cycles of 95 °C for 30 s,specific annealing temperature for 30 s, and 72 °C for30 s; and finally 72 °C for 10 min. The primers of thedefence genes CHI, GNS, PR-1 and PR-10, and anneal-ing temperatures are shown in Table 1. In the RT-qPCRsystem, no competition of amplification between primersets occurred, and the amplification efficiency wassuitable.

Statistical analysis

All statistical analysis was performed with SPSS version12.0 (SPSS Inc., Chicago, USA). Treatment means werecompared with a Least Significant Differences (LSD)test at P<0.05.

Results

Effect of NO at different concentrations on sporegermination, germ tube length and pathogenityof M. fructicola

The spore germination and germ tube length ofM. fructicola were inhibited significantly by100 μmol l−1 NO treatment (Table 2). No significanteffects of 5, 15 or 30 μmol l−1 NO were found on sporegermination and germ tube elongation of M. fructicola.After treated with NO, 1×105 spores ml−1 ofM. fructicolawas prepared and inoculated in peach fruit.At 72 h after inoculation, the lesion area of disease spotswas investigated. The results showed that 5, 15 and30 μmol l−1 NO treatment had no significant (P>0.05)effect on the pathogenicity of the pathogen, but thelesion area was significantly (P<0.05) lower in fruitpre-treated with 100 μmol l−1 NO solution.

Effect of NO on disease incidence and lesion areasof peach fruit inoculated with M. fructicola

NO treatment significantly (P<0.05) reduced diseaseincidence and lesion area in peach fruit inoculated withM. fructicola (Fig. 1). The disease incidence in NO-treated fruit was 0, 10 %, 88 %, and 100 % of that incontrol fruit on day 2, 3, 4 and 5 after incubation at

Eur J Plant Pathol

25 °C (Fig. 1a). Meanwhile, the lesion area on treatedfruit were only 0, 24 %, 50 %, and 63 % of those incontrol fruit on day 2, 3, 4, and 5 after incubation(Fig. 1b). Although all the inoculation wounds in bothNO-treated and control fruit developed decay symptomson day 5 after inoculation, the lesion area in NO-treatedfruit was still significantly (P<0.05) smaller than that incontrol fruit. Disease incidence reached 60 % after3 days in cPTIO-treated fruit when the incidence forcontrol and NO-treated fruit were 53 % and 15 %,respectively. These results showed that NO treatmentcould slow down the disease incidence and obviouslyreduce the lesion size. However, the NO scavengercPTIO could accelerate the disease progression, com-pared with the control.

Effect of NO on the activities of CHI and GNS in peachfruit

It was clear that the activities of CHI and GNS in NO-treated fruit were higher than that in the control andcPTIO-treated fruit after 12 h treatment (Fig. 2).During storage, NO-treated fruit showed significantly(P<0.05) higher activities of CHI than the control andcPTIO-treated fruit (Fig. 2a). The changes in CHI activ-ity showed a similar trend in three treatments. In com-parison with the control fruit, NO significantly (P<0.05)

enhanced GNS activity from 12 to 72 h. Meanwhile,cPTIO treatment obviously inhibited GNS activity in12, 24 and 72 h (Fig. 2a).

Effect of NO on the induction of defensive genesin peach fruit

To further elucidate the induction mode of exogenousNO on harvested peach fruit, real-time PCR was used toinvestigate the expression of several disease resistancegenes in fruit pre-treated with NO and cPTIO.Corresponding to the pattern of activities observed forthe two defence-related enzymes examined (CHI andGNS), NO also increased the expression level of CHI,GNS, PR-1 and PR-10 genes in peach fruit stored at25 °C (Fig. 3). A higher CHI expression level wasobserved in NO-treated fruit than in the control andcPTIO-treated fruit during storage. The patterns ofCHI expression in both control and cPTIO-treated fruitwere similar (Fig. 3a). GNS expression in all threetreatments substantially increased at 12 h and then de-clined (Fig. 3b). Similarly, the expression of GNS wasenhanced by NO treatment. During the experimentalperiod, the expression of GNS was lower in cPTIO-treated fruit than in the control. The expression of PR-1 and PR-10 were also affected by exogenous NO(Fig. 3c–d). The expression of PR-1 and PR-10 genes

Table 1 Primers for real-time qPCR analysis

Gene name NCBI accession no. Primer sequences Tm (°C) Product size (bp) Amplification efficiency

CHI AF206635 F: GTTGCTACAGACCCTGTTAT 56 130 1.01R:TGGAGCCGACAAGTCAGCAG

GNS U49454 F: CCCATCATCCGCTTCAT 56 149 0.98R: CCCAGGTTCCCATCTTGT

PR-1 KC757351 F: TCTAACACTTGTGCCGATGAC 58 126 0.95R: ATAGTTGCACCCGATGAAGG

PR-10 EU117120 F: CCCCGATGCCTACAACTAAA 57 139 1.04R: AGTAGCCATAGGGATGTTGG

Table 2 Effect of NO on sporegermination, germ tube length orpathogenicity ofM. fructicola

Mean values in the same columnfollowed by different letters aresignificantly different (P<0.05)

Treatment (μmol L−1) Germ tube length (μm) Spore germination (%) Lesion areas (cm2)

0 27.4±1.3a 33.8±2.8a 5.5±0.8 a

5 28.7±2.0a 34.0±3.3a 5.7±1.2a

15 27.2±2.3a 32.6±2.6a 5.2±0.7a

30 26.5±2.5ab 30.1±2.5ab 4.5±0.5ab

100 15.9±2.1b 14.1±1.9b 2.7±0.5b

Eur J Plant Pathol

in NO-treated fruit substantially increased at 12 h, whichwas more than twice the expression levels both in con-trol and cPTIO-treated fruit. PR-1 expression levelremained high thereafter in all treatments. The expres-sion pattern of PR-10 was similar to that of PR-1.

Discussion

At present, NO is known to play a key role in bioticstress in plants, acting as a signalling molecule in plant–pathogen interactions (Delledonne 2005; Wendehenneet al. 2004). It has been shown that NO plays a

prominent role in the activation of defence-associatedresponses in several plants against various phytopatho-gen infections (Manjunatha et al. 2008; Polverari et al.2003). Although it has been generally recognized thatfruit senescence can be effectively delayed by exoge-nous NO for some fruits such as peach, strawberry,kiwifruit and so on, only a few studies have been re-ported about its inhibition on postharvest disease offruits and vegetables. It was reported that 500 μl l-1 ofgaseous NO could effectively inhibit mycelia growth,spore germination and sporulation of M. fructicolain vitro (Lazar et al. 2008). The present results showedthat low concentrations of NO had little inhibitory effect

Storage time (h)

1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5

Dis

ease

inci

denc

e (%

)

0

20

40

60

80

100

120

Control

NO

cPTIO

a b

c

a

b

c

a a

b

a a a

Storage time (h)

1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5

Lesi

on a

rea

(mm

2 )

0

10

20

30

40

50

60

ab c

a

bc

aa

b

a

a

b

a b

Fig. 1 Effect of different treatment on disease incidence (a) andlesion areas (b) of peach fruit after inoculation with M. fructicolaspore suspension (1×105 spores ml−1) and then stored at 25±1 °C.

Data presented are the means of triplicates. Bars represent standarddeviations of the means. Different letters indicate significant dif-ferences among means according to LSD test (P<0.05)

Storage time (h)

0 12 48 72 96

CH

I act

ivity

(U

g-1

FW

)

0

2

4

6

8

10

12

Control

NO

cPTIO

a a a

a b

b

a

b b

a

b b

a

b

b

Storage time (h)

0 12 48 72 96

GN

S a

ctiv

ity (

U g

-1 F

W)

0

2

4

6

8

10

12

14

16

18

a a a

ab

c

a

b

c

a

b b

aa b

ba

Fig. 2 Effect of different treatments on enzyme activities ofchitinase (a) and β-1,3-glucanase (b) in peach fruit. Data present-ed are the means of three replicates. Each treatment containedthree replicates, and 20 fruit were used in each replicate. The entire

experiment was repeated three times. Vertical bars represent stan-dard error of means. Different letters indicate significant differ-ences among means according to LSD test (P<0.05)

Eur J Plant Pathol

on the spore germination, germ tube elongation or path-ogenicity of M. fructicola. However, it is unreasonableto expect that high concentrations of exogenous NO canhave high antimicrobial activity against postharvestpathogens, given that NO acts as a signalling molecularon a range of plant systems (Wendehenne et al. 2004). Inthis study, it was found that 15 μmol l−1 NO couldeffectively reduce disease incidence and lesion areas ofbrown rot in peach fruit, but could not significantlyinhibit the spore germination, germ tube length and thepathogenicity of M. fructicola. Although 100 μmol l−1

NO solution inhibited the mycelia growth and sporegermination effectively, this high concentration ofNO solution caused damage to the fruit. The resultssuggest that exogenous NO could inhibit postharvestdisease, mainly through enhancing disease resistanceof the fruit. As it is safe to the environment andpublic, induced disease resistance has been one ofthe most widely accepted approaches for manage-ment of plant diseases.

Chitinase (CHI) and β-1,3-glucanase (GNS) havebeen suggested to play crucial roles in defence againstfungal infection in plants (Ferreira et al. 2007; Stintziet al. 1993). CHI catalyses the hydrolysis of β-1-4-linkage of the N-acetylglucosamine polymer of chitin(Collinge et al. 1993), one of the main compounds offungal cell wall. β-1,3-glucans are the second majorcomponent of the fungal cell wall. Glucanases, whichhydrolyze different types of glucans, are important an-tifungal compounds produced in all organisms (Theisand Stahl 2004). GNS is one of the most fully charac-terized pathogenesis-related proteins that act directly bydegrading cell walls of pathogens or indirectly by re-leasing oligosaccharide and eliciting defence reactions(Lee et al. 2006). The present data showed that NOincreased activities of CHI and GNS within 12 h andthese increases continued until 72 h after treatment(Fig. 2a–b). Moreover, low disease incidence and lesionsize were found in NO-treated fruit. These results implythat the higher activities of CHI and GNS may play

CH

I exp

ress

ion

leve

l

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

Control

NO

cPTIO

a

a a a

a

b

b c

a

b

c

a

b b

a

a b

b

GN

S e

xpre

ssio

n le

vel

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

b a

b

c

a

b b

a

b b

a

a b

b

a a a

Storage time (h)0 12 24 48 96

PR

1 ex

pres

sion

leve

l

0

1

2

3

4

5

6

c

a a a

a

b b

a

b b

a

a a

a

a

a

Storage time (h)0 12 24 48 96

PR

10 e

xpre

ssio

n le

vel

0

1

2

3

4

5

6

d

a a a

a

b

c

a

b

b c

a

a

b

a a

a

Fig. 3 Effects of different treatments onCHI (a),GNS (b),PR-1 (c)and PR-10 (d) gene expression, determined by real-time qPCR. Allexperiments were run in triplicate with different cDNAs synthesized

from three biological replicates. Data represent means ± S.D., n=3.Different letters indicate significant differences among means ac-cording to LSD test (P<0.05)

Eur J Plant Pathol

important roles in weakening and decomposing thefungal cell wall ofM. fructicola, consequently inhibitingdisease development in peach fruit.

The PR-1 protein family has often been used as amarker for the induction of salicylic acid mediated re-sponse and systemic acquired resistance (SAR) (Lairdet al. 2004). The PR-10-type proteins are widespread inplants and the induction of PR-10 genes has been de-scribed in several plant species upon pathogen attack orpathogen-derived elicitor treatment (Breda et al. 1996;Lo et al. 1999; Park et al. 2004). In addition, the expres-sion of these genes can be induced by various abioticstimuli such as salicylic acid (Vidya et al. 1999),wounding (Poupard et al. 1998) or hormonal treatment(Poupard et al. 2001). Plant chitinases are includedamong PRs belonging to the PR-3, 4, 8 and 11 families,and β-1,3-glucanases are identified as members of thePR-2 family (van Loon et al. 2006). The results of thepresent study indicated that NO induced the expressionof CHI, GNS, PR-1 and PR-10. Moreover, the NOscavenger cPTIO showed a less inductive effect thanthe control, which corresponded to the NO effect onbrown rot of peach fruit. Similar inductive effects of NOhave been reported on Glorious oranges (Liu et al.2012b). The previous study (Zheng et al. 2011) haddemonstrated that an elicitor upregulated PR1 expres-sion in tomato fruit and induced disease resistance.However, treatment of inhibition with nitric oxide syn-thase (NOS) (N-nitro-l-arginine, L-NNA) reduced theexpression level of PR1 and increased disease incidenceand lesion area of fruit. The results in Fig. 3c–d showedthat NO markedly induced the expression of PR-1 andPR-10 in peach fruit at 12 h and these increases contin-ued until 24 h after treatment, implicating these genes askey regulators for systemic acquired resistance (SAR) infruit. The results suggest that NO may enhance diseaseresistance by inducing PRs expression in peach fruit,and the resistance induced by NOmight belong to SAR.Similar results have been obtained in Arabidopsis andsoybean and tomato fruit (A.-H.-Mackerness et al. 2001;Graham et al. 2003). The present research showed thatdisease resistance was enhanced in peach fruit after NOsolution treatment, indicating that NO is a possiblecandidate as a key signal in the establishment of sys-temic acquired resistance (Mur et al. 2006). In addition,after inoculation of M. fructicola, CHI, GNS, PR-1 andPR-10were also enhanced obviously in the control fruit.These findings are in accordance with previous reportthat these PR genes are commonly activated in response

to necrotrophic pathogens such as Elsinoe ampelina,Venturia inaequalis, Phytophthora nicotianae and soon (Chevalier et al. 2008; Kunkel and Brooks 2002;Shi et al. 2013; Wang et al. 2011).

Acknowledgments The research work was supported by theProject of National Natural Science Foundation of China(31101371), Shandong Natural Science Foundation(ZR2010CQ039), the Research Fund for the Doctoral Programof Higher Education of China (20113702120001) and China Post-doctoral Science Foundation (201104605).

References

A.-H.-Mackerness, S., John, C. F., Jordan, B., & Thomas, B.(2001). Early signaling components in ultraviolet-B re-sponses: distinct roles for different reactive oxygen speciesand nitric oxide. FEBS Letters, 489, 237–242.

Boller, T., Gehri, A., Mauch, F., & Vögeli, U. (1983). Chitinase inbean leaves: induction by ethylene, purification, properties,and possible function. Planta, 157, 22–31.

Breda, C., Sallaud, C., El-Turk, J., Buffard, D., De Kozak, I.,Esnault, R., et al. (1996). Defense reaction in Medicagosativa: a gene encoding a class 10 PR protein is expressedin vascular bundles.Molecular Plant - Microbe Interactions,9, 713–719.

Cao, J., & Jiang, W. (2006). Induction of resistance in Yali pear(Pyrus bretschneideri Rehd.) fruit against postharvest dis-eases by acibenzolar-S-methyl sprays on trees during fruitgrowth. Scientia Horticulturae, 110, 181–186.

Chevalier, M., Parisi, L., Gueye, B., Campion, C., Simoneau, P., &Poupard, P. (2008). Specific activation of PR-10pathogenesis-related genes in apple by an incompatible raceof Venturia inaequalis. Biologia Plantarum, 52, 718–722.

Collinge, D. B., Kragh, K. M., Mikkelsen, J. D., Nielsen, K. K.,Rasmussen, U., & Vad, K. (1993). Plant chitinases. The PlantJournal, 3, 31–40.

Delledonne, M. (2005). NO news is good news for plants.CurrentOpinion in Plant Biology, 8, 390–396.

Fan, B., Shen, L., Liu, K., Zhao, D., Yu, M., & Sheng, J. (2008).Interaction between nitric oxide and hydrogen peroxide inpostharvest tomato resistance response to Rhizopusnigricans. Journal of the Science of Food and Agriculture,88, 1238–1244.

Ferreira, R. B., Monteiro, S., Freitas, R., Santos, C. N., Chen, Z.,Batista, L.M., et al. (2007). The role of plant defence proteinsin fungal pathogenesis. Molecular Plant Pathology, 8, 677–700.

Gasic, K., Hernandez, A., &Korban, S. S. (2004). RNA extractionfrom different apple tissues rich in polyphenols and polysac-charides for cDNA library construction. Plant MolecularBiology Reporter, 22, 437a–437g.

Graham,M. Y., Weidner, J., Wheeler, K., Pelow,M. J., & Graham,T. L. (2003). Induced expression of pathogenesis-relatedprotein genes in soybean by wounding and the

Eur J Plant Pathol

Phytophthora sojae cell wall glucan elicitor. Physiologicaland Molecular Plant Pathology, 63, 141–149.

Gu, H., Liu, A., Chen,W., Feng, S., & Shi, J. (2006). Developmentand control of postharvest diseases of loquat fruit. In X. M.Huang & J. Janick (Eds.) Paper presented at the IIInternational Symposium on Loquat (pp. 750), Apr 01–06,Guangzhou, China.

Ippolito, A., El Ghaouth, A., Wilson, C. L., & Wisniewski, M.(2000). Control of postharvest decay of apple fruit byAureobasidium pullulans and induction of defense responses.Postharvest Biology and Technology, 19, 265–272.

Jemric, T., Ivic, D., Fruk, G., Matijas, H. S., Cvjetkovic, B., Bupic,M., et al. (2011). Reduction of postharvest decay of peachand nectarine caused by Monilinia laxa using hot waterdipping. Food and Bioprocess Technology, 4, 149–154.

Kunkel, B. N., & Brooks, D. M. (2002). Cross talk betweensignaling pathways in pathogen defense. Current Opinionin Plant Biology, 5, 325–331.

Lai, T., Wang, Y., Li, B., Qin, G., & Tian, S. (2011). Defenseresponses of tomato fruit to exogenous nitric oxide duringpostharvest storage. Postharvest Biology and Technology, 62,127–132.

Laird, J., Armengaud, P., Giuntini, P., Laval, V., & Milner, J. J.(2004). Inappropriate annotation of a key defence marker inArabidopsis: will the real PR-1 please stand up? Planta, 219,1089–1092.

Landgraf, F. A., & Zehr, E. (1982). Inoculum sources forMonilinia fructicola in South Carolina peach orchards.Phytopathology, 72, 185–190.

Lazar, E. E., Wills, R. B., Ho, B. T., Harris, A. M., & Spohr, L. J.(2008). Antifungal effect of gaseous nitric oxide on myceli-um growth, sporulation and spore germination of the post-harvest horticulture pathogens, Aspergillus niger, Moniliniafructicola and Penicillium italicum. Letters in AppliedMicrobiology, 46, 688–692.

Lee, J., Bricker, T. M., Lefevre, M., Pinson, S. R., & Oard, J. H.(2006). Proteomic and genetic approaches to identifyingdefence-related proteins in rice challenged with the fungalpathogen Rhizoctonia solani. Molecular Plant Pathology, 7,405–416.

Liu, J., Sui, Y., Wisniewski, M., Droby, S., Tian, S., Norelli, J.,et al. (2012a). Effect of heat treatment on inhibition ofMonilinia fructicola and induction of disease resistance inpeach fruit. Postharvest Biology and Technology, 65, 61–68.

Liu, L., Wang, J., Qu, L., Li, S., Wu, R., & Zeng, K. (2012b).Effect of nitric oxide treatment on storage quality of Gloriousoranges. Procedia Engineering, 37, 150–154.

Lo, S. C. C., Hipskind, J. D., & Nicholson, R. L. (1999). cDNAcloning of a sorghum pathogenesis-related protein (PR-10)and differential expression of defense-related genes follow-ing inoculation with Cochliobolus heterostrophus orColletotrichum sublineolum. Molecular Plant - MicrobeInteractions, 12, 479–489.

Luza, J., Van Gorsel, R., Polito, V., & Kader, A. (1992). Chillinginjury in peaches: a cytochemical and ultrastructural cell wallstudy. Journal of the American Society for HorticulturalScience, 117, 114–118.

Manjunatha, G., Raj, S. N., Shetty, N. P., & Shetty, H. S. (2008).Nitric oxide donor seed priming enhances defense responsesand induces resistance against pearl millet downy mildewdisease. Pesticide Biochemistry and Physiology, 91, 1–11.

Mitsuhara, I., Iwai, T., Seo, S., Yanagawa, Y., Kawahigasi, H.,Hirose, S., et al. (2008). Characteristic expression of twelverice PR1 family genes in response to pathogen infection,wounding, and defense-related signal compounds.Molecular Genetics & Genomics, 279, 415–427.

Mur, L. A. J., Carver, L. W., & Prats, E. (2006). NO way tolive; the various roles of nitric oxide in plant-pathogeninteractions. Journal of Experimental Botany, 57, 489–505.

Park, C. J., Kim, K. J., Shin, R., Park, J. M., Shin, Y. C., & Paek,K. H. (2004). Pathogenesis-related protein 10 isolated fromhot pepper functions as a ribonuclease in an antiviral path-way. The Plant Journal, 37, 186–198.

Polverari, A., Molesini, B., Pezzotti, M., Buonaurio, R., Marte,M., & Delledonne, M. (2003). Nitric oxide-mediated tran-scriptional changes in Arabidopsis thaliana. MolecularPlant-Microbe Interactions, 16, 1094–1105.

Poupard, P., Strullu, D.-G., & Simoneau, P. (1998). Two membersof the Bet v 1 gene family encoding birch pathogenesis-related proteins display different patterns of root expressionand wound-inducibility. Functional Plant Biology, 25, 459–464.

Poupard, P., Brunel, N., Leduc, N., Viémont, J. D., Strullu, D. G.,& Simoneau, P. (2001). Expression of a Bet v 1 homologuegene encoding a PR 10 protein in birch roots: induction byauxin and localization of the transcripts by in situ hybridiza-tion. Functional Plant Biology, 28, 57–63.

Shi, J., Li, J., Zhu, S., & Zhou, J. (2011). Browning inhibition onfresh-cut chestnut kernel by exogenous nitric oxide.International Journal of Food Science and Technology, 46,944–950.

Shi, J., Liu, A., Li, X., & Chen, W. (2013). Control ofPhytophthora nicotianae disease, induction of defense re-sponses and genes expression of papaya fruits treated withPseudomonas putidaMGP1. Journal of the Science of Foodand Agriculture, 93, 568–574.

Singh, S., Singh, Z., & Swinny, E. (2009). Postharvest nitricoxide fumigation delays fruit ripening and alleviates chillinginjury during cold storage of Japanese plums ( Prunussalicina Lindell). Postharvest Biology and Technology, 53,101–108.

Stintzi, A., Heitz, T., Prasad, V., Wiedemann-Merdinoglu, S.,Kauffmann, S., Geoffroy, P., et al. (1993). Plant ‘pathogene-sis-related’ proteins and their role in defense against patho-gens. Biochimie, 75, 687–706.

Theis, T., & Stahl, U. (2004). Antifungal proteins: targets, mech-anisms and prospective applications. Cellular and MolecularLife Sciences, 61, 437–455.

Tong, Z., Gao, Z., Wang, F., Zhou, J., & Zhang, Z. (2009).Selection of reliable reference genes for gene expressionstudies in peach using real-time PCR. BMC MolecularBiology, 10, 71.

van Loon, L. C., & van Strien, E. A. (1999). The families ofpathogenesis-related proteins, their activities, and compara-tive analysis of PR-1 type proteins. Physiological andMolecular Plant Pathology, 55, 85–97.

van Loon, L. C., Rep,M., & Pieterse, C.M. J. (2006). Significanceof inducible defense-related proteins in infected plants.Annual Review of Phytopathology, 44, 135–162.

Vidya, C. S. S., Manoharan, M., & Sita, G. L. (1999). Cloning andcharacterization of salicylic acid-induced, intracellular

Eur J Plant Pathol

pathogenesis-related gene from tomato (Lycopersiconesculentum). Journal of Biosciences, 24, 287–293.

Wang, Q., Zhang, Y., Gao, M., Jiao, C., & Wang, X. (2011).I d en t i f i c a t i o n a nd exp r e s s i o n an a l y s i s o f apathogenresponsive PR-1 gene from Chinese wild Vitisquinquangularis. African Journal of Biotechnology, 10,17062–17069.

Wendehenne, D., Durner, J., & Klessig, D. F. (2004). Nitric oxide:a new player in plant signalling and defence responses.Current Opinion in Plant Biology, 7, 449–455.

Zheng, Y., Shen, L., Yu, M. M., Fan, B., Zhao, D. Y., Liu, L. Y.,et al. (2011). Nitric oxide synthase as a postharvest responsein pathogen resistance of tomato fruit. Postharvest Biologyand Technology, 60, 38–46.

Eur J Plant Pathol