JOURNAL OF VIROLOGY, Mar. 1994, p. 1432-1437 Vol. 68, No. 30022-538X/94/$04.00+0Copyright © 1994, American Society for Microbiology

Influenza Virus NS1 Protein Stimulates Translation of the Ml ProteinKAZUE ENAMI,1 TAKESHI A. SATO,2 SUSUMU NAKADA,3 AND MASAYOSHI ENAMI1*

Department of Biochemistry, Kanazawa University School of Medicine, Takaramachi, Kanazawa, Ishikawa 920,1Department of Virus Diseases and Vaccine Control, National Institute of Health, Musashimurayama, Tokyo 208, 2and Department of Biological Science and Technology, Science University of Tokyo, Noda, Chiba 278, 3 Japan

Received 26 July 1993/Accepted 29 November 1993

The influenza virus NS1 protein was shown to stimulate translation of the Ml protein. M-CAT RNA, whichcontains the chloramphenicol acetyltransferase (CAT) reporter gene and the terminal noncoding sequence ofsegment 7 (coding for the Ml and M2 proteins), was ribonucleoprotein transfected into clone 76 cellsexpressing the influenza virus RNA polymerase and NP proteins required for the transcription and replicationof influenza virus ribonucleoproteins. When the cells were superinfected with a recombinant vaccinia viruswhich expresses the NS1 protein, CAT expression from the M-CAT RNA was significantly stimulated buttranscription was not altered. The expression of NS-CAT RNA, which contains noncoding sequences of segment8 (coding for the NS1 and NS2 proteins), was not altered by the NS1 protein. Site-directed mutagenesis showedthat the sequence GGUAGAUA upstream of the initiation codon on segment 7 was required for stimulation.

The influenza virus genome contains eight segments ofsingle-stranded negative-sense RNA. Via a splicing mecha-nism, segment 7 and segment 8 each code for two proteins, theMl and M2 proteins and the NS1 and NS2 proteins, respec-tively. Thus, 10 different gene products have been identified inthe virus-infected cells (reviewed in reference 20). In theinfected cells, viral protein expression is regulated (reviewed inreference 17). The NS1 protein is expressed predominantly inthe early phase, but its function is not well understood. On theother hand, the Ml protein is expressed late in the replicationcycle. The Ml protein is required for the nuclear-cytoplasmictransport of the ribonucleoproteins (RNPs) (5, 25) and ap-pears to play a role in virus maturation. It is also the mostabundant protein in the virion (reviewed in reference 20). Incells infected by temperature-sensitive (ts) mutants with adefect in the NS1 protein, the expression of the Ml protein wasremarkably reduced, whereas the ts mutation did not alter NS1protein expression (16, 38). Transcription was shown not to bealtered by the mutation in the NS1 gene (10, 16, 38). Theseobservations suggested that the NS1 protein had a stimulatoryeffect on translation of the Ml protein. However, anothermodel in which the expression of influenza virus proteins wasregulated at the level of RNA replication was also proposed(34). The present paper attempts to address the question ofwhether influenza virus protein expression is subject to trans-lational control.The terminal 12 and 13 nucleotides of influenza virus RNAs

are highly conserved among the eight segments and arebelieved to be part of the promoter responsible for transcrip-tion and replication (14, 22, 27, 28, 33, 41). A 7- to 33-nucleotide-long region between the conserved sequence andthe translational initiation site could contain segment-specificsequences. This region may contain the signals required forsegment-specific regulation (39, 40). However, the viral pro-teins and the RNA sequences required for the regulation havenot been identified.

Here, we focus on the regulatory effect of the NS1 protein

* Corresponding author. Mailing address: Department of Biochem-istry, Kanazawa University School of Medicine, Takaramachi, Ka-nazawa, Ishikawa 920, Japan. Phone: (81)762-62-8151, ext. 2250. Fax:(81)762-22-0460.

on the expression of the Ml protein, using clone 76 cells (15,26) and RNP transfection of synthetic model RNAs (7, 8, 24;reviewed in reference 23). This system allows us to study invivo the RNA sequences and the proteins affecting the expres-sion of influenza virus genes and their gene products.

MATERLILS AND METHODS

Viruses and cells. The vaccinia virus recombinants NS1-VAC and NS2-VAC, which express influenza virus NS1 andNS2 proteins, respectively, have been described previously (36)and were obtained from B. Moss (National Institutes ofHealth). The viruses were amplified on HeLa cells in Eagle'sminimal essential medium containing 2.5% fetal calf serum for3 days at 37°C as described previously (1). CV-1 cells were usedfor plaque titration with Dulbecco's modified Eagle's mediumcontaining 2.5% fetal calf serum and 0.6% agarose. The clone

pUC19 $ $ $

plVACAT-1 ~O T ' N -

- DIV

pUC118 f

pT3AM-CAT CAT 3-M

*-* DDI

I I

FIG. 1. Plasmids used for RNP transfection. The pUC19-derivedplasmid pIVACAT-1 contains the truncated bacteriophage T7 RNApolymerase promoter, the terminal noncoding sequences of the influ-enza PR8 virus segment 8, the CAT gene, and an HgaI restrictionenzyme site (24). Antisense NS-CAT RNA was obtained in vitrofollowing HgaI digestion and transcription by T7 RNA polymerase.The pUC118-derived plasmid pT3/M-CAT contains the truncatedbacteriophage T3 RNA polymerase promoter, the terminal noncodingsequences of influenza PR8 virus segment 7, the CAT gene, and anEarl restriction enzyme site. Antisense M-CAT RNA was obtained invitro following Earl digestion and transcription by the T3 RNApolymerase.

1432

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 01

Dec

embe

r 20

21 b

y 31

.170

.51.

194.

TRANSLATIONAL REGULATION OF INFLUENZA VIRUS 1433

A

VAC-

WT

NS1

NS2

VAC- NS1 NS2 NS1 NS2RNA M-CAT NS-CAT

FIG. 2. Effect of the NSI and NS2 proteins on CAT expression byM-CAT and NS-CAT RNAs. At 1.5 h prior to transfection, the cells(approximately 5 x 105) were infected with vaccinia virus recombinantNSI-VAC or NS2-VAC (MOI, 10). Infection with the vaccinia virusWR strain served as the control. After transfection of 25 ,ul of theNS-CAT or M-CAT RNPs, cells were incubated with medium for 18,24, 27, or 30 h at 37C. The cells were harvested, and CAT activity wasassayed with authentic CAT enzyme (Sigma) as the control. The meanratios for the effect of the NS1 and NS2 proteins on CAT activity wereobtained.

76 cells, in which expression of the RNA polymerase and NPgenes of influenza virus can be induced with dexamethasone,were maintained in Dulbecco's modified Eagle's mediumcontaining 10% fetal calf serum as described previously (26).Influenza A/PR/8/34 virus (PR8 virus) was grown in 10-dayembryonated chicken eggs for 2 days at 37°C (31).

Preparation of plasmids. Plasmid pIVACAT-1 was de-scribed previously (24). Plasmid pT3/M-CAT was constructedby PCR (32) using the primer pair 5'-GCGCGCTCTAGAATTAACCCTCACTAAAAGTAGAAACAAGGTAGTTTTTTATTACGCCCCGCCCTGCCACTCATC-3' and 5'-GCGCGCAAGC7TFCTC7TCGAGCGAAAGCAGGTAGATATTGAAAGATGGAGAAAAAAATCACTGGGTATA-3' andpIVACAT-1 DNA as the template (Fig. 1).

Plasmids pT3/M-CAT-2, pT3/M-CAT-3, pT7/NS-CAT-3,and pT7/NS-CAT-4 were constructed in the same way by usingprimers containing the sequences described in Fig. 4.

Plasmids pT7/PB1-CAT, pT3/NP-CAT, and pT7/NA-CATwere constructed in the same way by using primers containingterminal noncoding sequences of influenza PR8 virus segments2, 5, and 6, respectively.RNP transfection. Influenza virus polymerase and NP pro-

teins were purified from influenza PR8 virus as describedpreviously (12, 27). Briefly, the virus was first disrupted withTriton N-101 and lysolecithin, and the RNP fraction wasisolated by glycerol gradient centrifugation. The purified RNPwas then centrifuged through a CsCl-glycerol gradient. Frac-tions containing the polymerase and NP proteins were pooledand dialyzed. The aliquots were stored at - 70°C.

Plasmid pIVACAT-1 DNA was digested with HgaI (NewEngland BioLabs) and end filled with the Klenow enzyme(Takara Shuzo, Kyoto, Japan). DNAs for pT3/M-CAT, pT3/M-CAT-2, pT3/M-CAT-3, pT7/NS-CAT-3, and pT7/NS-CAT-4 were digested with Earl (New England BioLabs) andend filled with the Klenow enzyme. RNPs were reconstitutedin vitro with 0.5 pLg of DNAs, 50 U of phage T3 (Stratagene) orT7 (Takara Shuzo) RNA polymerase, and about 0.5 ptg (2 to 5,ul) of the influenza viral proteins in a 25-pl reaction volumefor 15 min at 37°C as described previously (8). DNAs werethen digested with 1 U of RQ1 DNase (Promega) for 5 min at

BVAC-

WT

NS1

NS2

M-CAT NS-CAT

N C N C

IC CAT-RNA

(pg)1

3

10

30

100

M-CAT-2 M-CAT-3 NS-CAT-3 NS-CAT-4 Mock Vac

4NM00

a*

FIG. 3. (Panel A) Effect of the NSI and NS2 proteins on thetranscription of M-CAT and NS-CAT RNAs. After infection of clone76 cells (approximately 2 x l0") with NSI-VAC, NS2-VAC. or theWR strain (MOI, 10), 100 >L of NS-CAT or M-CAT RNPs wastransfected into the cells. After a 19-h incubation, nuclear (N) andcytoplasmic (C) fractions were obtained (6). Poly(A)+ RNAs werepurified from each fraction by using oligo(dT) cellulose. The RNAswere blotted onto a membrane and hybridized with the antisenseprobe. The membrane was then washed and exposed to X-ray film.(Panel B) Effect of the NS1 and NS2 proteins on the transcription ofmutant RNAs. After infection of clone 76 cells (approximately 2 x106) with NSI-VAC, NS2-VAC, or the WR strain (MOI, 10), 100 kLI ofM-CAT-2, M-CAT-3, NS-CAT-3, or NS-CAT-4 RNPs was transfectedinto the cells. PBS was used for mock transfection (mock). After a 19-hincubation, poly(A)+ RNAs were purified from the cells by usingoligo(dT) cellulose. The RNAs were blotted onto a membrane andhybridized with the antisense probe. RNAs obtained by transfection ofNS-CAT-4 RNA were also hybridized with antisense vaccinia virusprobe as the internal marker (vac). (Panel C) Hybridization of controlRNA. The indicated amounts of NS-CAT RNA were blotted onto amembrane and hybridized with the sense probe.

37°C. RNPs were then diluted with 100 ,ul of phosphate-buffered saline (PBS) containing 0.1 mg of gelatin per ml andimmediately transfected into the clone 76 cells.

Clone 76 cells (approximately 5 x 105 cells) were incubatedin the presence of 1 ,uM dexamethasone for 24 h beforetransfection. One and one-half hours prior to transfection,cells were infected with the vaccinia virus recombinant NS1-VAC or NS2-VAC or strain WR at a multiplicity of infection(MOI) of 10 for I h at 37°C. Cells were then washed with PBS,treated with DEAE-dextran-dimethyl sulfoxide-gelatin (24)for 30 min and transfected with the RNPs for I h. Thereafter,the cells were incubated in medium containing 1 F.M dexa-methasone and 40 pLg of cytosine arabinoside per ml (4) at37°C. Chloramphenicol acetyltransferase (CAT) activity wasassayed by incubation for 18 h at 37°C as described previously(1).

Slot blot hybridization of mRNA. When indicated, nuclearand cytoplasmic fractions were separated before purification ofmRNA (6). Poly(A)+ RNAs were prepared from transfectedcells or nuclear and cytoplasmic fractions with a QuickPrepMicro mRNA purification kit (Pharmacia LKB). Briefly, cellswere disrupted in a solution containing guanidinium thiocya-nate and N-lauroyl sarcosine. Poly(A)+ RNAs were purified bybinding to oligo(dT) cellulose. Samples containing RNAs werediluted to 200 p.1 with 0.05 N NaOH and applied to aHybond-N+ membrane (Amersham) with a Bio-Dot SF mi-crofiltration instrument (Bio-Rad). The membranes were then

VOL. 68, 1994

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 01

Dec

embe

r 20

21 b

y 31

.170

.51.

194.

1434 ENAMI ET AL.

RNA 5-terminal sequence of mRNA

1 10 20

M-CAT 5' AGCGAAAGCAGGUAGAUAUUGAAAcGMI II

1 10 20

M-CAT-2 5' AGCGAAAGCAGGUGACAAUUGAAAGW4ns-I

M-CAT-3 5' AGCGAlo

NAAGCAGGUAGAUA

CAT (U) RatioVAC-

_VNS1

NS2

_VNS1

NS2

WV20

AAAACAUA9Q0 NS1ns-II

NS2I

1 10 20

NS-CAT 5' AGCAAAAGCAGGGUGACAAAAACAUA"Uns-I ns-II

1 10 20

NS-CAT-3 5' AGCAAAAGCAGGGUAGAUAAAACAUA@i3I

WV7

NS1

NS2

NS1

NS2

NS-CAT-4 5' AGCO

WV20

GAUAUUGAAAG9; NS1

I IINS2

FIG. 4. Identification of the sequence required for stimulation by the NS1 protein. The numbered sequences for the 5' noncoding regions ofthe sense M-CAT, M-CAT-2, M-CAT-3, NS-CAT, NS-CAT-3, and NS-CAT-4 RNAs are shown. Domains I and II of M-CAT RNA were replacedwith the corresponding regions (ns-I and ns-II) of NS-CAT RNA (M-CAT-2 and M-CAT-3) (underlined sequences). The sequences of domainI and those of both domains I and II were introduced into NS-CAT RNA (NS-CAT-3 and NS-CAT-4). Clone 76 cells (approximately 5 x 105)were infected with NS1-VAC or NS2-VAC (MOI, 10). Infection with vaccinia virus WR strain served as the control (WT). RNPs (25 pIl) were thentransfected into the cells. After a 24-h incubation, cells were harvested. Fifty percent (M-CAT, M-CAT-2, and M-CAT-3) or ten percent (NS-CAT,NS-CAT-3, and NS-CAT-4) cell extracts were used for the CAT assay. Authentic CAT enzyme was used as the control. Shaded AUG indicatestranslational start site.

neutralized with 20 x SSC (1 x SSC is 0.15 M NaCl plus 0.015M sodium citrate) for 5 min. The amount of RNA was

determined by hybridization using an antisense DNA probe.The probe was prepared by 60 cycles of Taq polymerase(Takara Shuzo) reaction with [ot-32P]dCTP (3,000 Ci/mmol)and pT3/M-CAT DNA as the template and either M13 primerRV (5'-CAGGAAACAGCTATGAC-3') for the antisenseprobe or M13 primer M4 (5'-GTTTfl7CCCAGTCACGAC-3')for the sense probe. Vaccinia virus-specific probe was obtainedin the same way with primer VAC19 (5'-TATCGGCTATCTCTACTCC-3') and cDNA coding for the vaccinia virus RNApolymerase 22-kDa subunit (29). The membrane was incu-bated in a hybridization mixture containing 50% formamide,5 x SSC, 1 x Denhardt's solution, 50 mM Na phosphate buffer(pH 7.0), and carrier DNA (1 mg/ml) for 1 h at 45°C and thenin a hybridization mixture containing the probe (1 x 106

cpm/ml/20 cm2) for 24 h at 45°C. Thereafter, the membranewas washed three times with 2 x SSC and 0.1% sodiumdodecyl sulfate (SDS) for 5 min and three times with 0.1 x SSCand 0.1% SDS for 15 min at 50°C. The dried membrane was

exposed to X-ray film.

RESULTS

Identification of viral regulatory proteins. Previous reportsof the use of influenza A virus temperature-sensitive (ts)mutants with a defect in the NS1 protein have suggested thatthe NS1 protein plays a role in the regulation of Ml proteinexpression. Therefore, we studied the effect of the NS1 proteinon the expression of model RNAs containing the CAT re-

porter gene and the noncoding sequences of segment 7 (T3/M-CAT) or segment 8 (IVACAT-1) (Fig. 1). RNPs were first

0.04

0.28

1

7

0.02 0.5

0.03 1

0.04 1.3

0.05 1.7

0.05 1

0.35

0.08

0.05

0.09

7

1.6

1

1.8

0.04 0.8

0.04

0.40 10

0.03 0.7

0.03 1

0.45 15

0.02 0.7

;AAAAUiL;AUiUiUAL'A A A Anr

J . VlIROL.

10nnf lA1^

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 01

Dec

embe

r 20

21 b

y 31

.170

.51.

194.

TRANSLATIONAL REGULATION OF INFLUENZA VIRUS 1435

ACUC G 30U-AC-GA-U

20C-G10n 20U-A 40NP-CAT 5' AGCAAAAGCAGGGUAGAUAA CAUCUAAAUCG0

1 10

NA-CAT 5' AGCGAAAGCAGGGGUtIUUAAAAM

1 10 20

PB1 -CAT 5' AGCGAAAGCAGGCAAACCAUUUGAF3

VAC-

wr

X W.7i*~* so

NS1 00:

wrsOSSNS1 *

LNS1 (4 @S.t

CAT (U) Ratic

0.08 1

0.30 4

0.03 1

0.40 13

0.10 1

0.10 1

FIG. 5. Effect of the NS1 and NS2 proteins on CAT expression from NP-CAT, NA-CAT, and PB1-CAT RNAs. At 1.5 h prior to transfection,the cells (approximately 5 x 105) were infected with vaccinia virus recombinant NSI-VAC (MOI, 10). Infection with the vaccinia virus WR strainserved as the control (WT). After transfection of 25 p.l of the NP-CAT, NA-CAT, or PB1-CAT RNPs, cells were incubated for 24 h at 37°C. Thecells were harvested, and 50% cell extracts were used for CAT assay. Authentic CAT enzyme was used as the control. The numbered sequencesfor the 5' noncoding regions of the RNAs are shown, with the putative regulatory sequence underlined and the possible stem-loop structureindicated in NP-CAT. Shaded AUG indicates translational start site.

reconstituted in vitro by using the RNAs and viral polymeraseand NP proteins and were then transfected into clone 76 cellsin which influenza virus polymerase and NP proteins wereexpressed (15). The cells were superinfected with either vac-cinia virus WR strain or vaccinia virus recombinant NS1-VACor NS2-VAC. CAT expression from the M-CAT RNA wasstimulated in the presence of the NSI protein, whereas theeffect of the NS2 protein on CAT expression was insignificant(Fig. 2). CAT activity with the NS-CAT RNA construct wasnot significantly changed in the presence of either the NS1 orthe NS2 protein (Fig. 2).

Analysis for transcription. In order to examine whether theNS1 protein stimulates the transcription of the M-CAT RNA,we analyzed the level of poly(A)+ mRNA in the nucleus and inthe cytoplasm (Fig. 3A). Clone 76 cells were transfected withNS-CAT or M-CAT RNAs. Poly(A)+ RNA was purified fromnuclear and cytoplasmic fractions, and the amount of specificRNA was determined by slot blot hybridization. The dataindicated that neither the NS1 nor the NS2 protein alteredtranscription or the nuclear-cytoplasmic transport of themRNAs (Fig. 3A). Thus, the stimulatory effect of CAT expres-sion by the NS1 protein appears to be a translational one.

Analysis for the RNA signal. We then analyzed the sequencein T3/M-CAT RNA which was associated with stimulation bythe NS1 protein. Mutations were introduced into the 5'-terminal noncoding regions of the sense M-CAT and NS-CATRNAs (Fig. 4). M-CAT-2 was constructed by replacing domainI of M-CAT RNA with the corresponding region (ns-I) ofNS-CAT RNA. The mutation in domain I led to reduction ofthe stimulatory effect of the NS1 protein. On the other hand,the enhancement of expression was not altered by a mutationin domain II (M-CAT-3). We then introduced the sequence ofdomain I or those of both domains I and II into NS-CAT RNA(NS-CAT-3 and NS-CAT-4, respectively). CAT expressionfrom both NS-CAT-3 and NS-CAT-4 RNAs was stimulated bythe NS1 protein (Fig. 4). In addition, transcription of theseRNAs was not altered by either the NS1 or the NS2 protein(Fig. 3B), indicating that the regulation by the NSI protein wastranslational. Thus, the minimal common sequence present inM-CAT and NS-CAT-3 RNAs, GGUAGAUA, may be re-quired for translational stimulation.

Effect of NS1 protein on other segments. In the late phase of

viral replication, the NP protein and the Ml protein are highlyexpressed. In addition, segment 5 encoding the NP proteincontains the sequence GGUAGAUA in the upstream regionof the initiation codon. Therefore, we characterized the effectof the NS1 protein on CAT expression by the fact thatNP-CAT RNA contained terminal noncoding sequences ofsegment 5. As expected, CAT expression was stimulated by theNS1 protein (Fig. 5).The NA protein is known as a late viral protein; however,

the expression of the protein is much lower than that of the NPprotein or MI protein. Segment 6 encoding the NA proteindoes not contain the putative regulatory sequence GGUAGAUA in the upstream region of the initiation codon. Tounderstand whether the expression of the NA protein isstimulated by the NSI protein, we analyzed the effect of theNS1 protein on CAT expression from the NA-CAT RNA. Inconsequence, CAT expression from the NA-CAT RNA wasshown to be stimulated by the NS1 protein (Fig. 5). Therefore,we consider that the putative regulatory sequence GGUAGAUA does not participate in the regulation of NA proteinexpression.We then analyzed the expression from segment 2 encoding

PBI protein (one of the viral polymerase proteins), since it hasbeen shown that the viral polymerase proteins are earlyproteins whose expression is not stimulated in the late phase.As shown in Fig. 5, CAT expression from PBI-CAT RNA wasnot stimulated by the NSI protein. This is consistent with thefact that segments encoding polymerase proteins do not con-tain the putative regulatory sequence.

DISCUSSION

In this paper, we describe the effect of the influenza A virusNS1 protein on the expression of a reporter gene containingthe noncoding sequences derived from RNA segment 7. TheNS1 protein stimulates CAT expression from the segment7-like construct by a translational activation mechanism. Thisfinding is consistent with previous observations that ts defectsin the NS1 protein abolished the stimulation of MI proteinexpression in the late phase (16, 38) and that the ts defect ofthe NS1 protein does not alter transcription (10, 16, 38). TheNSI protein accumulates in the nucleus (2, 18, 21, 37) and

VOL. 68, 1994

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 01

Dec

embe

r 20

21 b

y 31

.170

.51.

194.

1436 ENAMI ET AL.

associates with the nucleolus (19, 43). A mutation in the NS1protein was shown to reduce RNA replication (38). Thus, theNS1 protein may play a role in viral RNA replication in thenucleus. However, the NS1 protein is not essential for RNAreplication (13). In addition, the NS1 protein is found in thecytoplasm (3, 18, 30, 35, 42). It associates with the polysomefraction (3, 18, 30). It also forms cytoplasmic inclusionsassociated with viral and cellular RNAs during the late stage ofthe replication cycle (35, 42). The function of the protein in thecytoplasm is not yet understood. Our findings suggest thefunction of the polysome-associated NS1 protein. Knowledgeof the mechanism of protein synthesis in mammalian cells hasbeen accumulated, and the importance of translational controlduring the initiation phase is described for virus-infected aswell as uninfected cells (reviewed in references 9 and 11).Interaction of the NS1 protein with host factors is possible.We also established that the sequence GGUAGAUA par-

ticipates in the stimulatory effect of the NS1 protein on theexpression of MI and NP genes. The regulation of NP proteinexpression in the early phase is different from that of the Mlprotein. The upstream region of the initiation codon in the NPmRNA may contain a unique stem-loop structure (Fig. 5). ThisRNA sequence could be involved in the efficient expression ofthe NP protein in the infected cells. The noncoding region ofsegment 6 (coding for the NA protein) does not contain aputative regulatory sequence, but expression was shown to bestimulated by the NS1 protein. Since the expression of the NAprotein is much lower (>10-fold) than that of the Ml and NPproteins, the difference in the regulatory sequence may beconsistent with the unique regulation of the NA protein.Characterization of the interaction of the NS1 protein and theregulatory sequences is in progress.

ACKNOWLEDGMENTSWe thank B. Moss for the vaccinia virus recombinants and P. Palese

for comments on the manuscript.This work was supported by grants from the Uehara Memorial

Foundation, from the Ichiro Kanehara Foundation, and from theMinistry of Education, Science and Culture of Japan to M.E.

REFERENCES1. Ausubel, F. A., R. Brent, R. E. Kingston, D. D. Moore, J. G.

Seidman, J. A. Smith, and K. Struhl (ed.). 1992. Current protocolsin molecular biology. Wiley Interscience, New York.

2. Briedis, D. J., G. Conti, E. A. Munn, and B. W. J. Mahy. 1981.Migration of influenza virus-specific polypeptides from cytoplasmto nucleus of infected cells. Virology 111:154-164.

3. Compans, R. W. 1973. Influenza virus proteins. II. Associationwith components of the cytoplasm. Virology 51:56-70.

4. Cooper, J. A., and B. Moss. 1979. In vitro translation of immediate-early, early, and late classes of RNA from vaccinia virus-infectedcells. Virology 96:368-380.

5. Enami, K., Y. Qiao, R. Fukuda, and M. Enami. 1993. An influenzavirus temperature-sensitive mutant defective in the nuclear-cyto-plasmic transport of the negative-sense viral RNAs. Virology194:822-827.

6. Enami, M., R. Fukuda, and A. Ishihama. 1985. Transcription andreplication of eight RNA segments of influenza virus. Virology142:68-77.

7. Enami, M., W. Luytjes, M. Krystal, and P. Palese. 1990. Introduc-tion of site-specific mutations into the genome of influenza virus.Proc. Natl. Acad. Sci. USA 87:3802-3805.

8. Enami, M., and P. Palese. 1991. High-efficiency formation ofinfluenza virus transfectants. J. Virol. 65:2711-2713.

9. Garfinkel, M. S., and M. G. Katze. 1993. How does influenza virusregulate gene expression at the level of mRNA translation? Let uscount the ways. Gene Expression 3:109-118.

10. Hatada, E., M. Hasegawa, K. Shimizu, M. Hatanaka, and R.Fukuda. 1990. Analysis of influenza A virus temperature-sensitive

mutants with mutations in RNA segment 8. J. Gen. Virol. 71:1283-1292.

11. Hershey, J. W. B. 1991. Translational control in mammalian cells.Annu. Rev. Biochem. 60:717-755.

12. Honda, A., K. Ueda, K. Nagata, and A. Ishihama. 1988. RNApolymerase of influenza virus: role of NP on RNA chain elonga-tion. J. Biochem. 104:1021-1026.

13. Huang, T.-S., P. Palese, and M. Krystal. 1990. Determination ofinfluenza virus proteins required for genome replication. J. Virol.64:5669-5673.

14. Kimura, N., A. Fukushima, K. Oda, and S. Nakada. 1993. An invivo study of the replication origin in the influenza virus comple-mentary RNA. J. Biochem. 113:88-92.

15. Kimura, N., M. Nishida, K. Nagata, A. Ishihama, K. Oda, and S.Nakada. 1992. Transcription of a recombinant influenza viralRNA in cells that can express the RNA polymerase and NP genesof influenza virus. J. Gen. Virol. 73:1321-1328.

16. Koennecke, I., C. B. Boschek, and C. Scholtissek. 1981. Isolationand properties of a temperature-sensitive mutant (ts 412) of aninfluenza A virus recombinant with a ts lesion in the gene codingfor the nonstructural protein. Virology 110:16-25.

17. Krug, R. M., F. V. Alonso-Caplen, I. Julkunen, and M. G. Katze.1989. Expression and replication of the influenza virus genome, p.89-152. In R. M. Krug (ed.), The influenza viruses. Plenum Press,New York.

18. Krug, R. M., and P. R. Etkind. 1973. Cytoplasmic and nuclearspecific proteins in influenza virus-infected MDCK cells. Virology56:334-348.

19. Krug, R. M., and R. Soeiro. 1975. Studies on the intranuclearlocalization of influenza virus-specific proteins. Virology 64:378-387.

20. Lamb, R. A. 1989. Genes and proteins of the influenza viruses, p.1-87. In R. M. Krug (ed.), The influenza viruses. Plenum Press,New York.

21. Lazarowitz, S. G., R. W. Compans, and P. W. Choppin. 1971.Influenza virus structural and nonstructural proteins in infectedcells and their plasma membranes. Virology 46:830-843.

22. Li, X., and P. Palese. 1992. Mutational analysis of the promoterrequired for influenza virus virion RNA synthesis. J. Virol. 66:4331-4338.

23. Luo, G., and P. Palese. 1992. Genetic analysis of influenza virus.Curr. Opin. Genet. Dev. 2:77-81.

24. Luytjes, W., M. Krystal, M. Enami, J. D. Parvin, and P. Palese.1989. Amplification, expression, and packaging of a foreign geneby influenza virus. Cell 59:1107-1113.

25. Martin, K., and A. Helenius. 1991. Nuclear transport of influenzavirus ribonucleoproteins: the viral matrix protein (Ml) promotesexport and inhibits import. Cell 67:117-130.

26. Nakamura, Y., K. Oda, and S. Nakada. 1991. Growth complemen-tation of influenza virus temperature-sensitive mutants in mousecells which express the RNA polymerase and nucleoprotein genes.J. Biochem. 110:395-401.

27. Parvin, J. D., P. Palese, A. Honda, A. Ishihama, and M. Krystal.1989. Promoter analysis of the influenza viral RNA polymerase. J.Virol. 63:5142-5152.

28. Piccone, M. E., A. Fernandez-Sesma, and P. Palese. 1993. Muta-tional analysis of the influenza virus vRNA promoter. Virus Res.28:99-112.

29. Plucienniczak, A., E. Schroeder, G. Zettlmeissl, and R. E. Streeck.1985. Nucleotide sequence of a cluster of early and late genes in aconserved segment of the vaccinia virus genome. Nucleic AcidsRes. 13:985-998.

30. Pons, M. W. 1972. Studies on the replication of influenza virusRNA. Virology 47:823-832.

31. Ritchey, M. B., P. Palese, and E. D. Kilbourne. 1976. The RNAs ofinfluenza A, B, and C viruses. J. Virol. 18:736-744.

32. Saiki, R. K., D. H. Gelfand, S. StolFel, S. Scharf, R. H. Higuchi,G. T. Horn, K. B. Mullis, and H. A. Erlick. 1988. Primer-directedenzymatic amplification of DNA with a thermostable DNA poly-merase. Science 239:487-491.

33. Seong, B. L., and G. G. Brownlee. 1992. A new method forreconstituting influenza polymerase and RNA in vitro: a study ofthe promoter elements for cRNA and vRNA synthesis in vitro and

J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 01

Dec

embe

r 20

21 b

y 31

.170

.51.

194.

TRANSLATIONAL REGULATION OF INFLUENZA VIRUS 1437

viral rescue in viv'o. Virology 186:247-260.34. Shapiro, G. I., T. Gurney, Jr., and R. M. Krug. 1987. Influenza

virus gene expression: control mechanisms at early and late timesof infection and nuclear cytoplasmic transport of virus-specificRNAs. J. Virol. 61:764-773.

35. Shaw, M. W., and R. W. Compans. 1978. Isolation and character-ization of cytoplasmic inclusions from influenza A virus-infectedcells. J. Virol. 25:608-615.

36. Smith, G. L., J. Z. Levin, P. Palese, and B. Moss. 1987. Synthesisand cellular location of the ten influenza polypeptides individuallyexpressed by recombinant vaccinia viruses. Virology 160:336-345.

37. Taylor, J. M., A. W. Hampson, J. E. Layton, and D. 0. White. 1970.The polypeptides of influenza virus. IV. An analysis of nuclearaccumulation. Virology 42:744-752.

38. Wolstenholme, A. J., T. Barrett, S. T. Nichol, and B. W. J. Mahy.1980. Influenza virus-specific RNA and protein synthesis in cellsinfected with temperature-sensitive mutants defective in the ge-nome segment encoding nonstructural proteins. J. Virol. 35:1-7.

39. Yamanaka, K., A. Ishihama, and K. Nagata. 1988. Translationalregulation of influenza virus RNAs. Virus Genes 2:19-30.

40. Yamanaka, K., K. Nagata, and A. Ishihama. 1991. Temporalcontrol for translation of influenza virus mRNAs. Arch. Virol.120:33-42.

41. Yamanaka, K., N. Ogasawara, H. Yoshikawa, A. Ishihama, and K.Nagata. 1991. In vivo analysis of the promoter structure of theinfluenza virus RNA genome using a transfection system with an

engineered RNA. Proc. Natl. Acad. Sci. USA 88:5369-5373.42. Yoshida, T., M. W. Shaw, J. F. Young, and R. W. Compans. 1981.

Characterization of the RNA associated with influenza A cyto-plasmic inclusions and the interaction of NS] protein with RNA.Virology 110:87-97.

43. Young, J. F., U. Desselberger, P. Palese, B. Ferguson, A. R.Shatzman, and M. Rosenberg. 1983. Efficient expression of influ-enza virus NS] nonstructural protein in Esclherichia coli. Proc.Natl. Acad. Sci. USA 80:6105-6109.

VOL. 68, 1994

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 01

Dec

embe

r 20

21 b

y 31

.170

.51.

194.