Inflorescence Branching Effector of S. reilianum file2 23 SUPPRESSOR OF APICAL DOMINANCE 1 of Sporisorium reilianum Modulates 24 Inflorescence Branching Architecture in Maize and Arabidopsis1

1

1

2

Running head: Inflorescence Branching Effector of S. reilianum 3

4

5

6

Corresponding author: 7

Prof. Dr. Jan Schirawski 8

RWTH Aachen University 9

Microbial Genetics, Institute of Applied Microbiology 10

Aachen Biology and Biotechnology 11

Worringerweg 1 12

52074 Aachen 13

Germany 14

15

Tel.: +49-241-80-26616 16

e-mail: [email protected] 17

18

19

20

Research area: Genes, Development and Evolution 21

22

Plant Physiology Preview. Published on November 9, 2015, as DOI:10.1104/pp.15.01347

Copyright 2015 by the American Society of Plant Biologists

www.plantphysiol.orgon August 25, 2018 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

SUPPRESSOR OF APICAL DOMINANCE 1 of Sporisorium reilianum Modulates 23

Inflorescence Branching Architecture in Maize and Arabidopsis1 24

25

26

Hassan Ghareeb$,*, Frank Drechsler$, Christian Löfke**, Thomas Teichmann, 27

Jan Schirawski*** 28

29

Georg-August-Universität Göttingen, Molecular Biology of Plant-Microbe Interactions, 30

Albrecht-von-Haller Institute of Plant Sciences, Julia-Lermontowa-Weg 3, 37077 31

Göttingen, Germany (H.G., J.S.) 32

Max Planck Institute for Terrestrial Microbiology, Organismic Interactions, Karl-von-33

Frisch Straße 10, 35043 Marburg, Germany (H.G., J.S.) 34

Georg-August-Universität Göttingen, Plant Cell Biology, Albrecht-von-Haller Institute 35

of Plant Sciences, Julia-Lermontowa-Weg 3, 37077 Göttingen, Germany (C.L., T.T.) 36

RWTH Aachen University, Microbial Genetics, Institute of Applied Microbiology, 37

Aachen Biology and Biotechnology, Worringerweg 1, 52074 Aachen, Germany (F.D., 38

J.S.) 39

National Research Centre, Plant Biotechnology Department, Giza, Egypt (H.G.) 40

41 42

One-Sentence Summary 43

A fungal protein increases plant inflorescence branching both when delivered by the 44

fungus in maize and when stably expressed in Arabidopsis, suggesting a conserved 45

pathway for function. 46

47



3

1This work was supported by the Max Planck Society, the Georg-August-University 48

through the German Initiative of Excellence (DFG ZUK45/1) (J.S.), and the RWTH 49

Aachen University. Funding via the IMPRS for Environmental, Cellular and Molecular 50

Microbiology (H.G.) and the Göttingen Graduate School for Neurosciences, 51

Biophysics, and Molecular Biosciences (GGNB) (H.G.) is gratefully acknowledged. 52

53 $ These authors contributed equally to this work. 54

55

* Present Address: Georg-August-Universität Göttingen, Plant Cell Biology, Albrecht-56

von-Haller Institute of Plant Sciences, Julia-Lermontowa-Weg 3, 37077 Göttingen, 57

Germany 58

** Present Address: University of Natural Resources and Life Sciences Vienna, 59

Institute of Applied Genetics and Cell Biology, Muthgasse 18, 1190 Vienna 60

61

*** Corresponding author: Jan Schirawski e-mail: [email protected] 62

63

64



4

ABSTRACT 65

The biotrophic fungus Sporisorium reilianum causes head smut of maize following 66

systemic plant colonization. Symptoms include the formation of multiple female 67

inflorescences at subapical nodes of the stalk due to loss of apical dominance. By 68

deletion analysis of cluster 19-1, the largest genomic divergence cluster in S. 69

reilianum, we identified a secreted fungal effector responsible for S. reilianum-70

induced loss of apical dominance, which we named SUPPRESSOR OF APICAL 71

DOMINANCE1 (SAD1). SAD1 transcript levels were highly up-regulated during 72

biotrophic fungal growth in all infected plant tissues. SAD1-GFP fusion proteins 73

expressed by recombinant S. reilianum localized to the extracellular hyphal space. 74

Transgenic A. thaliana expressing GFP-SAD1 displayed an increased number of 75

secondary rosette-leaf branches. This suggests that SAD1 manipulates inflorescence 76

branching architecture in maize and A. thaliana via a conserved pathway. Using a 77

yeast two-hybrid library of S. reilianum-infected maize tissues, we identified potential 78

plant interaction partners that had a predicted function in ubiquitination, signaling and 79

nuclear processes. Presence of SAD1 led to an increase of the transcript levels of 80

the auxin transporter PIN1 in the root and a reduction of the branching regulator TB1 81

in the stalk. This indicates a role of SAD1 in regulation of apical dominance by 82

modulation of branching through increasing transcript levels of the auxin transporter 83

PIN1 and derepression of bud outgrowth. 84

85



5

INTRODUCTION 86

Plants are known to exhibit a broad range of different morphologies under different 87

environmental conditions. In addition to changing height or leaf area, they are also 88

able to alter their morphological appearance and develop leaves instead of floral 89

organs or change their bud outgrowth pattern. Pathological changes in the 90

developmental program are often caused by plant infection with biotrophic 91

pathogens. Sporisorium reilianum, a biotrophic fungal pathogen of maize and 92

sorghum, interferes with regular development of inflorescences of its host plants and 93

leads to phyllody (Matheussen et al., 1991) that is caused by changes in floral organ 94

identity, floral meristem identity, and floral meristem determinacy (Matheussen et al., 95

1991; Ghareeb et al., 2011). In addition, the fungus triggers suppression of apical 96

dominance, which leads to a higher number of female inflorescences (ears) of maize 97

(Ghareeb et al., 2011) and increased tillering of sorghum (Matheussen et al., 1991). 98

In fact, the inflorescence tillering symptom resembles the crazy top disease of maize 99

that is induced by the downey mildew fungus Sclerophthora macrospora (Malaguti et 100

al., 1977). Broom-like structures on its host plants are also induced by Moniliophthora 101

perniciosa that induces hyperplasia and hyperproliferation of axillary shoots, resulting 102

in witches’ broom disease of cacao (Meinhardt et al., 2008). Similarly, infection of a 103

whole range of dicotyledonous plants with biotrophic phytopathogenic bacteria of the 104

taxon Candidatus Phytoplasma asteris, leads to the reversion of floral organs into 105

leaves or the emergence of a dense cluster of branches resembling broom as a 106

consequence of lack of apical dominance (Hoshi et al., 2009). 107

Branching architecture is mainly regulated by auxin, strigolactone, and cytokinin, that 108

affect axillary meristem initiation and outgrowth (McSteen, 2009; Gallavotti, 2013). 109

Axillary meristem initiation is preceded by a depletion of auxin as shown for 110

Arabidopsis thaliana and Solanum lycopersicum (Wang et al., 2014). After meristem 111

initiation, the emerging axillary meristem is characterized by a local accumulation of 112

auxin, as shown in maize (Gallavotti et al., 2008a). Basipetal auxin transport from the 113

apex towards the root suppresses axillary meristem outgrowth leading to apical 114

dominance (Davies et al., 1966). Outgrowth of axillary buds is also inhibited by 115

strigolactones synthesized in the shoots directly, or long-distance transported from 116

the root to the shoot (Turnbull et al., 2002; Crawford et al., 2010). On the other hand, 117

bud outgrowth is promoted by cytokinins produced in the nodal stem (Nordström et 118



6

al., 2004; Tanaka et al., 2006). Cytokinins also modulate branching indirectly through 119

regulation of meristem size (Shani et al., 2006). Although many details about the 120

contribution of particular hormones to regulation of axillary meristem development 121

have been elucidated, the exact mode of hormone action is still ambiguous (Cheng et 122

al., 2013; Barazesh and McSteen, 2008). 123

Increasing knowledge about the mode of action of auxins, cytokinins and 124

strigolactones led to the proposal of two models, the “auxin transport canalization 125

model” and the “second messenger model”, that explain apical dominance 126

mechanistically (Domagalska and Leyser, 2011). In the auxin transport canalization 127

model, polar auxin transport (PAT) plays the central role in apical dominance, 128

regardless of the auxin concentration. During basipetal movement, auxin flux is 129

canalized gradually into a tight thread of cells, the auxin canal, resulting in high PAT 130

(Sachs, 1981). To be activated, the bud must also generate PAT, and export auxin to 131

the auxin canal in the stem (Domagalska and Leyser, 2011). Strigolactones also 132

impact on bud activity since they reduce PAT (Prusinkiewicz et al., 2009). In the 133

second messenger model, auxin regulates cytokinins and strigolactones (second 134

messengers), that migrate to the axillary bud and control its activity (Domagalska and 135

Leyser, 2011). Several studies have been conducted that support either of the two 136

models (Domagalska and Leyser, 2011). 137

Axillary meristem initiation and outgrowth are also under genetic control of 138

transcription factors and signaling components. In maize, determination of axillary 139

meristems is influenced by DELAYED FLOWERING1 (DLF1) and Zea 140

FLORICAULA/LEAFY1 (ZFL1)and FLORICAULA/LEAFY2 (ZFL2)transcription factors 141

(Coe et al., 1988; Muszynski et al., 2006; Sheridan, 1988; Bomblies et al. 2006). The 142

outgrowth of these axillary meristems is controlled by TEOSINTE BRANCHED1 143

(TB1), a suppressor of axillary branches (Hubbard et al., 2002). In addition, the 144

serine/threonine-protein kinase BARREN INFLORESCENCE2 (BIF2) is involved in 145

auxin signaling, and disruption leads to a defect in inflorescence branch meristem 146

initiation (McSteen and Hake, 2001; McSteen et al., 2007). The auxin efflux carrier 147

PIN1 also plays a regulating role in axillary meristem outgrowth (McSteen, 2009). 148

Both PIN1 and BIF2 act on polar auxin transport and thereby control bud outgrowth 149

(Bennetzen and Hake, 2009). 150



7

In rare cases, mechanisms have been proposed to explain pathogen-mediated 151

changes in plant branching architectures. Infection with S. reilianum decreased the 152

gibberellin content of sorghum, suggesting that low gibberellin concentration is the 153

reason for increased tillering of infected plants (Matheussen et al., 1991). A 154

misregulation of gibberellin biosynthesis genes was observed in S. reilianum-155

colonized maize inflorescences with early signs of floral reversion (Ghareeb et al., 156

2011). Additionally, misregulated genes were homologous to genes involved in auxin 157

and cytokinin mobilization in other plants (Ghareeb et al., 2011). On the other hand, 158

some examples exist where the architecture of the plant is altered by pathogen 159

effector proteins that are secreted during plant colonization. SAP54 was identified as 160

a secreted protein from Candidatus Phytoplasma asteris that induces leafy flower 161

development when expressed in A. thaliana (MacLean et al., 2011). Likewise, the 162

TENGU effector of Phytoplasma was shown to induce witches’ broom when 163

expressed in A. thaliana, and the TENGU-expressing transgenic plants showed 164

down-regulation of auxin-responsive genes. This suggests that TENGU inhibits 165

auxin-related pathways, which in turn influence plant development (Hoshi et al., 166

2009). 167

The maize smut fungus Ustilago maydis is capable of auxin biosynthesis, and fungal 168

auxin contributes to the total auxin content of colonized tumorous leaf tissues 169

(Reineke et al., 2008). Interestingly, the fungal capacity of auxin formation did not 170

affect the nature of the symptoms induced on its host plant maize (Reineke et al., 171

2008) suggesting that symptom formation may instead be influenced by fungal 172

effector proteins secreted into the colonized tissues. 173

Analysis of the U. maydis genome sequence revealed the existence of gene clusters 174

encoding secreted proteins with an effect on virulence (Kämper et al., 2006). After 175

sequence elucidation of the S. reilianum genome, a genomic comparison identified 176

divergence clusters encoding proteins weakly conserved between U. maydis and S. 177

reilianum (Schirawski et al., 2010). The largest divergence cluster (19-1; Schirawski 178

et al., 2010) corresponded to the U. maydis gene cluster 19A, whose deletion 179

resulted in the lack of U. maydis-specific tumor formation in seedling leaves (Kämper 180

et al., 2006) but not in inflorescences (Skibbe et al., 2010). 181

In this study, we identified one gene (sr10077, SUPPRESSOR OF APICAL 182

DOMINANCE1, SAD1) of cluster 19-1 of S. reilianum as responsible for the loss of 183



8

apical dominance phenotype induced by S. reilianum wild type strains. SAD1 is 184

highly up-regulated upon fungal colonization of maize and potentially interacts with a 185

large number of intracellular maize proteins. Lack of SAD1 in S. reilianum leads to 186

decreased transcript levels of the polar auxin transporter PIN1 in roots and increased 187

levels of the bud-outgrowth regulator TB1 in stalks of infected maize. When 188

expressed heterologously as a SAD1-GFP fusion protein in A. thaliana, SAD1 leads 189

to an increase in secondary inflorescence branches. This suggests that SAD1 affects 190

apical dominance via a conserved mechanism that includes regulation of gene 191

transcription and modulation of auxin transport. 192

193

194



9

RESULTS 195

Cluster 19-1 Harbors a Suppressor of Apical Dominance 196

The divergence cluster 19-1 was identified as the largest region of genomic 197

difference between S. reilianum and U. maydis (Schirawski et al., 2010). Since 198

deletion of the gene cluster in U. maydis resulted in the loss of the U. maydis-specific 199

symptom of tumor formation on seedling leaves (Kämper et al., 2006), we 200

investigated whether the corresponding region in S. reilianum also encoded symptom 201

specificity determinants. 202

Cluster 19-1 of S. reilianum covers about 55 kb and is split in two parts by the 203

presence of a highly conserved gene (sr10071, Figure 1) encoding a predicted 204

protein with strong sequence identity to tubulin beta chains of different fungi. 205

Replacement of the first part (A1) with the phleomycin resistance cassette and of the 206

second part (A2) with the hygromycin resistance cassette, resulted in strains with 207

reduced virulence on the maize cultivar 'Gaspe Flint' (Ghareeb, Zhao, Schirawski, 208

submitted). We used compatible mating-type combinations of deletion strains for 209

inoculation experiments of maize to analyze loss of the S. reilianum-specific symptom 210

formation. Each inoculation experiment was done in three biological replicates with 211

about 25 plants inoculated per experiment and strain combination. 212

In all experiments, wild type and deletion strains lacking either part A1 (ΔA1 strains) 213

or part A2 (ΔA2 strains) were able to cause smutted ears and ears showing phyllody 214

(Ghareeb, Zhao, Schirawski, submitted). In addition, we carefully dissected all ears 215

by removal of the surrounding husk leaves (Supporting Figure S1). Outgrowth at 216

subapical nodes of the shank was unwrapped and counted as additional ears if the 217

structures could be macroscopically identified as ears (Supporting Figure S1D). 218

Numbers of apical and subapical ears were added to calculate the number of ears 219

per plant. Outgrowth of ears at subapical nodes is controlled by apical 220

dominance.Suppression of apical dominance caused by S. reilianumoccurred only 221

with wild type and ΔA1 strains but not with ΔA2 strains (Figure 2A). Loss of apical 222

dominance occurred predominantly at subapical nodes of a branch carrying an 223

infected female inflorescence at the apex (Ghareeb et al., 2011) (Supporting Figure 224

S1B). At six weeks post inoculation (wpi), at which the phenotype can be clearly 225

observed, wild type-inoculated plants showed a significantly increased (3.3 ± 0.14; p-226

value < 0.05) number of ears per plant relative to mock-inoculated plants (2.6 ± 0.18). 227



10

Relative to wild type strains, infection with ΔA2 deletion strains led to a significant (p-228

value < 0.01) reduction in the number of ears per plant (Figure 2A). The produced 229

number of ears did not change significantly relative to mock-infected plants (Figure 230

2A). This indicates that the A2 part of S. reilianum cluster 19-1 encodes determinants 231

for suppression of apical dominance. 232

The part A2 contains four genes (sr10073, sr10075, sr10077, sr10079) encoding 233

putatively secreted proteins, of which the last three show weak (20% amino acid 234

identity) homology to each other (Figure 1). By real-time PCR analysis, we showed 235

that all four genes were highly up-regulated upon fungal plant colonization in leaves 236

at three days post inoculation (dpi), in nodes at two wpi and in ears at four wpi 237

(Figure 2B). To identify which gene of the part A2 of cluster 19-1 was responsible for 238

suppression of apical dominance by S. reilianum, we analyzed strains lacking one of 239

the four genes of part A2 (Ghareeb, Zhao, Schirawski, submitted). Compatible 240

mating-type combinations of verified strains were used to inoculate maize seedlings 241

in three independent experiments. At six wpi, we investigated the number of female 242

inflorescences produced by plants inoculated with the four individual gene deletion 243

mutants, lacking, respectively, sr10073 (Δ73), sr10075 (Δ75), sr10077 (Δ77), or 244

sr10079 (Δ79), in comparison to mock- and wild type-inoculated plants. Relative to 245

mock-inoculated plants, plants inoculated with Δ73 strains or with Δ79 strains showed 246

the same significantly increased number of ears per plant as wild type strains (Figure 247

2C). In contrast, plants inoculated with strains lacking either sr10075 or sr10077 248

exhibited a lower number of ears per plant than wild type inoculated plants (Figure 249

2C). 250



11

To ensure that loss of suppression of apical dominance is caused by gene deletion 251

and not by a different accidental mutation in the genome, we confirmed contribution 252

of sr10077 by re-introducing its open reading frame including promoter and 253



12

terminator regions in two compatible Δ77 deletion strains. Successful integration of 254

sr10077 at a known ectopic locus (the MIG1 locus, see Materials and Methods) was 255

verified by PCR and Southern blot. Southern blot analysis showed that all obtained 256

complementation strains contained multiple copies of sr10077. By quantitative RT-257

PCR we detected 11-19 copies of the introduced gene in each complementation 258

strain (not shown). The complementation strains were tested for their ability to 259

suppress apical dominance in maize. Since we noticed that the phenotype becomes 260

more severe with time, we changed the evaluation time point from six wpi to eight 261

wpi. Inoculation of maize with the complementation strains led to a significant 262

increase (p-value < 0.001) in the number of ears per plant in comparison to the 263

deletion strains and to the mock control (Figure 2D). In addition, maize inoculation 264

with the complementation strains containing multiple copies of sr10077 led to an 265

even higher number of ears per plant than inoculation with wild type strains (Figure 266

2D). These results indicate that suppression of apical dominance imposed by wild 267

type strains of S. reilianum is associated with sr10077. Therefore, we named the 268

gene SUPPRESSOR OF APICAL DOMINANCE1 (SAD1). 269

270

SAD1 Is Secreted from Fungal Hyphae in planta 271

Analysis of the SAD1 amino acid sequence with the program SignalP 4.1 predicted 272

the presence of a secretion signal peptide that is likely cleaved between amino acid 273

positions 24 and 25 of SAD1 (probability = 0.833; Petersen et al., 2011) (Supporting 274

Figure S2). Protein secretion of pathogen effectors is a prerequisite for an interaction 275

of the effector with plant proteins. To validate predicted SAD1 secretion, a construct 276

expressing a C-terminal fusion of SAD1 with GFP, SAD1-GFP, under the control of 277

SAD1 promoter was integrated at the MIG1 locus in two compatible S. reilianum 278

strains lacking SAD1 (∆SAD1 deletion strains) to generate the complementation 279

strains (∆SAD1+SAD1-GFP). Southern blot analysis showed that the strains had 280

integrated multiple copies of the SAD1-GFP construct at the MIG1 locus. 281



13

To test whether the SAD1-GFP fusion protein is secreted from plant tissue-colonizing 282

fungal hyphae, we collected female inflorescences from plants inoculated with the 283

∆SAD1+SAD1-GFP complementation strains and with control strains, expressing 284

GFP under control of the SAD1 promoter (PSAD1:GFP). Fluorescence microscopic 285



14

analysis of manually sectioned samples revealed fluorescence around fungal hyphae 286

expressing the SAD1-GFP fusion protein (Figure 3A). In order to quantify the finding, 287

we sorted visible hyphae as belonging to one of three types (Supporting Figure S3): 288



15

Hyphae of type 1 had a weak GFP signal with a low signal to noise ratio that was 289

associated to very slim hyphae (Supporting Figure S3A, left panel); hyphae of type 2 290

had a strong GFP signal around fungal hyphae and at hyphal tips (Supporting Figure 291

S3A, middle panel) that co-localized with the cell membrane staining dye FM 4-64 292

(Supporting Figure S4); and hyphae of type 3 had a strong signal within the 293

boundaries of the fungal hyphae (Supporting Figure S3A, right panel). A GFP signal 294

corresponding to very slim hyphae was present for nearly 50% of all hyphae detected 295

for both strain combinations expressing either GFP or SAD1-GFP (Figure 3B). A 296

strong GFP signal around fungal hyphae and at hyphal tips could be observed for a 297

small fraction of the strains expressing GFP (Figure 3B, GFP) and for about 50% of 298

the hyphae of ∆SAD1 deletion strains expressing the SAD1-GFP fusion protein 299

(Figure 3B, SAD1-GFP). In contrast, an intracellular GFP signal was present in about 300

60% of hyphae expressing GFP, while no such GFP signals were observed with 301

strains expressing the SAD1-GFP fusion protein (Figure 3B). The differential 302

localization pattern of GFP and SAD1-GFP fluorescence confirmed that the SAD1-303

GFP fusion protein does not localize to the fungal cytoplasm and is secreted by the 304

fungal hyphae during plant colonization. 305

Symptom evaluation at eight weeks post inoculation revealed that the ∆SAD1+SAD1-306

GFP complementation strains led to the same low number of ears per plant as mock- 307

and ∆SAD1-inoculated plants (Figure 3C), indicating that the SAD1-GFP fusion 308

protein expressed in S. reilianum is not functional. To test the hypothesis that the 309

protein is non-functional due to the increased size we also tested smaller tags. 310

Infection of maize plants with S. reilianum strains ∆SAD1+MYC-SAD1 and 311

∆SAD1+SAD1-HA showed no increased number of ears per plant and thus no 312

complementation of SAD1 (Supporting Figure S5). The inoperativeness of the fusion 313

protein precludes further functional analysis. 314

315

Heterologous expression of SAD1 in A. thaliana Changes Inflorescence 316

Branching Architecture 317

To examine whether the SAD1 protein had an impact on plant development that is 318

independent of the presence of S. reilianum, we generated homozygous transgenic 319

A. thaliana plants that expressed an intracellular GFP-SAD1 fusion protein, i.e. 320



16

without the predicted secretion signal peptide (see below) under control of the 35S 321

promoter (P35S:GFP-SAD1∆SP). The reason for expressing an N-terminal GFP-322

SAD1∆SP fusion was based on the observation that expression of a SAD1-GFP 323

fusion in S. reilianum leads to a non-functional SAD1 protein. Non-functionality could 324

be due to either GFP covering an active domain of SAD1 at the C-terminus, or the 325

interference of the tag with uptake of the fusion protein into the plant cells. 326

We verified production of SAD1 transcripts in the transgenic lines via real-time PCR 327

(Figure 4A). The plants grew without any obvious phenotype. However, at flowering 328

time, their inflorescences were more branched than those of the progenitor plants 329

(Figure 4B). To quantify the changes that might occur in the branching pattern of the 330

transgenic plants (Figure 4C), the primary and secondary cauline-leaf branches, and 331

the primary and secondary rosette-leaf branches were counted at the end of the 332

flowering period (eight weeks). A. thaliana lines expressing intracellular GFP-333

SAD1∆SP had the same number of primary and secondary cauline-leaf branches 334

and primary rosette-leaf branches but displayed a significant (p-value <0.05) increase 335

in the number of secondary rosette-leaf branches (Figure 4D). This shows that the 336

intracellularly expressed GFP-SAD1∆SP fusion protein affects the inflorescence 337

branching pattern of transgenic A. thaliana. 338

339

340



17

In Transgenic A. thaliana, GFP-SAD1∆SP Localizes to the Cytoplasm and 341

Accumulates in Nuclei in a Tissue-Specific Manner 342



18

To know the subcellular localization of the functional GFP-SAD1∆SP fusion protein 343

expressed in A. thaliana, we compared localization of GFP-SAD1∆SP and GFP, both 344

expressed under control of the cauliflower mosaic virus 35S promoter. GFP 345

fluorescence was observed inside the cytoplasm and the nucleus for both constructs 346



19

(Figure 5A). Since the fluorescence microscopic pictures do not allow separation of 347

cytoplasm and plasma membrane, there is the possibility that GFP-SAD1 additionally 348

associates with the plasmamembrane. Localization to the cell wall and the apoplast 349



20

was excluded by plasmolysis experiments (Supporting Figure S6). In some leaf cells 350

the signal for GFP-SAD1∆SP was barely visible in the cytoplasm but strong in the 351

nucleus (Figure 5A). To check whether GFP-SAD1∆SP accumulates inside the 352

nucleus, we quantified the fluorescence intensity of cytoplasm and nucleus for cells 353

expressing GFP-SAD1∆SP and GFP (Figure 5). Intensity profiles of single cells show 354

three peaks, two associated with the cytoplasm and one associated with the nucleus 355

of the cell (Figure 5A). In plants expressing GFP, we observed three peaks with the 356

same fluorescence intensity, confirming that the small GFP protein can freely diffuse 357

in-between the two cellular compartments. In cells expressing GFP-SAD1∆SP, we 358

observed a low signal intensity in the cytoplasm relative to a strong signal intensity in 359

the nucleus. The nucleus-to-cytoplasm intensity ratio for cells expressing GFP-360

SAD1∆SP was 3.2 ± 0.7 (SD; n=35) compared to 1.4 ± 0.2 (SD; n=40) for GFP 361

expressing cells (Figure 5B, p <0.001). This shows that fusion of SAD1∆SP to GFP 362

leads to nuclear accumulation of the protein in plant cells, possibly by active import of 363

the fusion protein into the nucleus or by inhibiting export from the nucleus. 364

Interestingly, intensity of signals of GFP-SAD1∆SP expressing plants differed 365

dramatically from plants expressing GFP alone. In 10-12 day-old transgenic A. 366

thaliana seedlings that had just produced the first pair of true leaves, GFP expressing 367

plants produced a prominent signal throughout the entire plant even at low exposure 368

times of 10 milliseconds (ms). Using the same exposure time revealed a very weak 369

GFP signal for plants of all three transgenic lines expressing GFP-SAD1∆SP 370

(Supporting Figure S7). A strong fluorescence signal from GFP-SAD1∆SP could only 371

be observed in guard cells of the cotyledons. When the exposure time was increased 372

to 200 ms, GFP-SAD1∆SP fluorescence became visible in leaves and roots but not in 373

hypocotyls (Figure 6A). In leaves, GFP-SAD1∆SP fluorescence was stronger in 374

guard cells than in pavement cells, whereas the signal intensity was equally strong in 375

different leaf cells expressing GFP alone. Additionally, the signal intensity of vascular 376

bundles in leaves and roots was weaker for GFP-SAD1∆SP than for GFP alone 377

(Figure 6A). In older plants (6 weeks), fluorescence of the GFP-SAD1∆SP fusion 378

protein could readily be detected in floral buds (Figure 6B) and in floral organs 379

(Figure 6C), as well as in leaves (Figure 6D) and in roots (Figure 6E), and the protein 380

localized both to the cytoplasm and the nucleus. Interestingly, fluorescence varied 381

from well-detectable to not detectable in individual inflorescences. The distribution of 382

the GFP-SAD1∆SP-derived fluorescence in different plant tissues that should 383



21

express the protein in every cell suggest that in A. thaliana expression or stability of 384

the fusion protein is translationally or post-translationally controlled. 385

386



22

SAD1 Can Activate Transcription of Reporter Genes in Yeast 387

To investigate whether SAD1 has the potential to activate gene transcription, we 388

expressed SAD1 lacking its signal peptide as a fusion to the GAL4 DNA-binding 389

domain (BD-SAD1∆SP) in the strain Y2HGold of the Matchmaker™ Gold Yeast Two-390

Hybrid System expressing the GAL4 activation domain (AD). In cell extracts of this 391

strain, presence of a 41 kDa fusion protein corresponding to BD-SAD1∆SP could 392

clearly be detected (Supporting Figure S8). In contrast to control strains that only 393

expressed AD and the Gal4 DNA-binding domain (BD) and in which no reporter 394

genes were activated, two of the four reporter genes were activated in the strains 395

expressing AD and BD-SAD1∆SP. Colonies grew on medium containing 396

Aureobasidin A resulting from activation of AUR1-C, and led to the formation of a 397

blue color on plates containing α-X-GAL resulting from activation of MEL1 398

(Supporting Figure S9A). In contrast, cells were unable to grow on media lacking 399

adenine or histidine, showing that ADE2 and HIS3 were not activated (Supporting 400

Figure S9B). Since expression of HIS3 and ADE2 is driven by the G1 and G2 401

promoter elements, respectively, whereas the expression of both AUR1-C and MEL1 402

is driven by the M1 promoter element, this indicates that BD-SAD1∆SP is able to 403

auto-activate the transcription of the M1 promoter but not that of the G1 and G2 404

promoters, showing that SAD1 has the potential to activate gene expression in yeast. 405

Control experiments where SAD1 lacking its signal peptide was fused to the GAL4 406

activation domain (AD-SAD1ΔSP) showed that AD-SAD1ΔSP is not able to auto 407

activate MEL1 expression (Supporting Figure S10). This likely indicates that SAD1 408

can influence nuclear processes including activation of gene transcription not by 409

direct binding to DNA but by interaction with nuclear proteins. 410

411

SAD1 Modulates Transcription of Plant Genes Involved in Auxin Transport and 412

Branching Control 413

To find out whether SAD1 regulates nuclear processes in maize by modulating plant 414

gene expression, we analyzed the transcript level pattern of TB1, a dosage-415

dependent inhibitor of axillary bud outgrowth in maize, and PIN1, encoding an auxin 416

efflux transporter (Hubbard et al., 2002; Gallavotti et al., 2008a). Transcript levels 417

were determined by quantitative RT-PCR in different tissues of maize plants 418

inoculated either with water (mock), S. reilianum wild type or ∆SAD1 deletion strains. 419



23

Tissues were sampled at seven wpi, a time point at which changes in the branching 420

architectures of wild type-infected maize plants are prominent. Transcript abundance 421

was quantified in three different tissues (roots, stalks and ears) relative to mock-422



24

inoculated plants. For quantification of PIN1 transcripts, a pair of primers was used 423

that amplified part of the first exon of ZmPIN1a, ZmPIN1b, and ZmPIN1c (Supporting 424

Figure S11; Carraro et al., 2006; Forestan et al., 2010). In roots of wild type-425

inoculated maize plants, PIN1 transcript levels were significantly increased (p-value 426

<0.05), which was not the case for plants inoculated with strains lacking SAD1 427

(Figure 7, top panel). In ears, no significant difference could be detected in 428

abundance of PIN1 or TB1 transcripts in wild type- or ∆SAD1-inoculated plants 429

(Figure 7, middle panel). In stalks, where an altered plant gene expression should 430

have the most imminent effect on plant morphology, the level of PIN1 transcripts was 431

significantly reduced (p-value <0.05) in both wild type- and ΔSAD1-inoculated plants, 432

indicating a SAD1-independent effect. In contrast, the transcript level of TB1 was 433

significantly (p-value <0.05) decreased in the stalks of wild type- but not for ΔSAD1- 434

or mock-inoculated plants (Figure 7, lower panel). These results show that presence 435

of SAD1 in S. reilianum influences expression of the maize auxin transporter in roots 436

and the main repressor of bud outgrowth in stalks of ears. 437

438

Interaction Partners of SAD1 Are Involved in Development, Transcription, 439

Ubiquitination and Signaling 440

To get a better insight into the role of SAD1 in planta, we aimed to identify the 441

protein's interaction partners. We generated a normalized yeast two-hybrid library 442

with cDNA generated from axenically-grown S. reilianum and different S. reilianum-443

colonized maize tissues that results in C-terminal fusions to the Gal4 AD domain. 444

Transformation of the library into the yeast strain Y187 resulted in 1.3 x 109 445

independent clones. The library-containing strains were mated to the pGBKT7-SAD1-446

containing Y2HGold strain of the Matchmaker™ Gold Yeast Two-Hybrid System 447

expressing BD-SAD1∆SP, which resulted in 5 x 105 independent diploid colonies 448

auxotrophic for tryptophan and leucine and thus containing bait and prey plasmids. 449

Of these, 434 diploids grew on medium also lacking adenine and histidine (see 450

Supporting Figure S12) indicating that they contained plasmids encoding proteins 451

that interacted with SAD1. The plasmid insert sequences of 384 clones were 452

determined and the sequences were compared among each other. This resulted in 453

179 non-redundant sequences encoding potential SAD1 interaction partners. We 454

verified 139 interactions by re-introduction of representative plasmids of each group 455



25

into Y187 followed by mating with the Y2HGold strain containing pBKT7-SAD1. Of 456

the 139 potential interaction partners, 74 were recovered more than once. Of these, 457

only one (found three times) was of fungal origin, excluding a possible general 458

stickiness of the bait protein. By comparison to nucleotide databases (BLASTN, 459

NCBI) (Altschul et al., 1990) we were able to assign a putative function to 45 of the 460

identified proteins. Interestingly, more than half of these annotated interaction 461

partners have a putative function in development, transcription, ubiquitination or 462

signaling (Table 1). These results suggest that SAD1 can interact with multiple 463

intracellular maize proteins with a putative cytoplasmic or nuclear localization. 464

465

466



26

DISCUSSION 467

Comparison of the S. reilianum and U. maydis smut fungal genomes revealed the 468

existence of divergence regions, often correlating to previously identified regions 469

encoding proteins with a predicted secretion signal and no known enzymatic function 470

(Kämper et al., 2006; Schirawski et al., 2010). Deletion of the largest virulence 471

effector-encoding region in U. maydis resulted in strains that were unable to induce 472

tumors on seedling leaves (Kämper et al., 2006) and had thus lost one prominent U. 473

maydis-specific symptom. This prompted us to investigate whether the corresponding 474

region in S. reilianum encoded determinants for S. reilianum-specific symptom 475

formation. In comparison to U. maydis, S. reilianum has an extended endophytic 476

phase in which it lives and spreads inside the plant without causing obvious damage 477

(Schirawski et al., 2010). Symptoms include the replacement of individual flowers or 478

complete inflorescences by spore-filled sori, the presence of floral reversion leading 479

to phyllody, and the occurrence of multiple female inflorescences at subapical nodes, 480

which is caused by suppression of apical dominance (Ghareeb et al., 2011). Gene 481

deletion strains lacking the left and larger (ΔA1) or the right and smaller part (ΔA2) of 482

cluster 19-1 were still able to induce spores and phyllody in inflorescences of maize 483

(Ghareeb, Zhao, Schirawski, submitted). However, the ΔA2 deletion strains did not 484

lead to suppression of apical dominance. Individual gene deletion of each of the four 485

genes present in the 19A2 region (Ghareeb, Zhao, Schirawski, submitted) followed 486

by symptom analysis showed that absence of SAD1 led to absence of the loss of 487

apical dominance phenotype in infected maize plants. Re-introduction of SAD1 in 488

multiple copies in the ΔSAD1 deletion strains resulted in a severe increase in the 489

number of female inflorescences per plant, suggesting that SAD1 functions as a 490

suppressor of apical dominance in maize. Thus, SAD1 is a fungal effector that affects 491

the branching architecture of maize and represents a molecular link between 492

pathogen proteins and symptom formation. 493

To affect development of host tissues, SAD1 should be expressed and secreted 494

during colonization of maize by S. reilianum. Both requirements are met, since SAD1 495

is highly expressed in leaves, nodes and ears of colonized plants (Figure 2B). In 496

addition, the functionality of the bioinformatically predicted secretion signal peptide 497

(Supporting Figure S2) was indicated by localization around fungal hyphae of a 498

SAD1-GFP fusion protein expressed in S. reilianum, and by co-localization with the 499



27

cell membrane in maize inflorescences (Figure 3, Supporting Figure S3and 500

Supporting Figure S4). Thus, SAD1 fulfills the requirements to influence plant 501

development by directly interacting with components of the plant cell. 502

Yeast two-hybrid analysis revealed intracellular plant proteins as potential interaction 503

partners. While some interaction partners likely occur in the plant cell cytoplasm (i.e. 504

those involved in signaling or ubiquitination; Table 1), others are likely located in the 505

plant cell nucleus (i.e. those involved in nuclear processes; Table 1). This strongly 506

suggests that SAD1 functions inside plant cells and might have a decisive role inside 507

plant cell nuclei. Experiments involving heterologous expression of SAD1 fusion 508

proteins in A. thaliana support this suggestion. A GFP-SAD1∆SP fusion protein 509

expressed without secretion signal peptide could be detected in the cytoplasm and 510

accumulated in plant cell nuclei when stably expressed in A. thaliana (Figure 4 and 511

Figure 5). In addition, expression in yeast of SAD1 as a fusion to the GAL4-BD led to 512

transcriptional activation of reporter genes (Supporting Figure S9), and interaction of 513

SAD1 with the DNA-directed RNA polymerase II subunit J of maize in a yeast two-514

hybrid screen indicated that the protein may act as a transcriptional activator. Since 515

SAD1 was not able to substitute for the GAL4 DNA binding domain (Supporting 516

Figure S11), promoter activation might be through protein-protein interaction. Since 517

we did not use a split-ubiquitin assay for protein-protein interaction detection we 518

cannot rule out that SAD1 interacts with membrane-bound plant proteins inside or 519

even outside the plant cell and functions by activating downstream signaling 520

pathways. 521

Heterologous expression of SAD1 as a GFP-SAD1∆SP fusion in stable transgenic A. 522

thaliana resulted in plants that formed an increased number of secondary rosette leaf 523

branches (Figure 4C). This is remarkable, because it shows that SAD1 alone without 524

the help of any other fungal proteins is able to modify inflorescence branching 525

architecture in A. thaliana. In addition, this indicates that the fusion protein is 526

functional when localized to plant intracellular compartments. The increased 527

secondary branching that occurs in both A. thaliana expressing SAD1 and in S. 528

reilianum-infected maize, indicates a function of SAD1 via a pathway conserved in 529

the monocot maize and the dicot plant A. thaliana. 530

Function of SAD1 may depend on its transfer to the plant cell nucleus since the 531

concentration of the GFP-SAD1∆SP fusion protein was much higher in nuclei than in 532



28

the cytoplasm (Figure 5). Reasons for the nuclear accumulation could be increased 533

cytoplasmic degradation, retention of the protein in nuclei, or specific translocation 534

from the cytoplasm to the nucleus in plant cells. Further experimentation is needed to 535

find out which scenario is valid for SAD1. Intracellular localization of SAD1 might be 536

dependent on posttranslational modification such as phosphorylation. Examples 537

include the proline-rich tyrosine kinase Pyk2 of neurons that localizes to the nucleus 538

of PC12 cells upon phosphorylation (Faure et al., 2013), and the extracellular signal-539

regulated kinase (ERK) where phosphorylation by a casein kinase 2 promotes 540

nuclear import (Plotnikov et al., 2011). Bioinformatic analysis predicted several 541

phosphorylation sites within SAD1, two phosphorylation sites for protein kinase C and 542

one for casein kinase 2 (Supporting Figure S2). In addition, three putative 543

serine/threonine-protein kinases, one putative casein kinase II, and one putative 544

phosphatase of maize were found to interact with SAD1 in the yeast two-hybrid assay 545

(Table 1). At this point it remains speculative whether phosphorylation is involved in 546

regulation of activity, stability or localization of SAD1. 547

Although it is unclear, if and how the SAD1 protein secreted from fungal hyphae 548

enters plant cells, the fact that we find intracellular plant proteins as interaction 549

partners and that an inflorescence branching phenotype is observed when the protein 550

is expressed in A. thaliana strongly hint at an intracellular function of SAD1 in maize. 551

Once inside the plant cell, SAD1 accumulates in the nucleus and could affect apical 552

dominance by altering transcription of genes involved in biosynthesis, signaling or 553

transport of auxin, cytokinin, strigolactones or gibberellins. Measurement of auxin 554

concentrations in emerging inflorescences at 4 wpi, a time point at which the 555

appearance of multiple ears per branch is initiated (F. Drechsler and J. Schirawski, 556

unpublished), showed a 30% increase in auxin concentration of infected 557

inflorescences (Ghareeb et al., 2011). Since auxin transport rather than absolute 558

auxin concentration is the main contributor to apical dominance, we investigated 559

transcript levels of the auxin efflux transporter PIN1. In ears, PIN1 transcripts were 560

slightly but not significantly increased by the presence of SAD1. PIN1 transcript 561

levels in the stalk were down-regulated regardless of the presence of SAD1 (Figure 562

7). This shows that reduction of PIN1 transcripts in the aerial parts of the plant is 563

SAD1 independent. In contrast, presence of SAD1 during infection with S. reilianum 564

leads to increased PIN1 transcript abundance in roots (Figure 7). Increased PIN1 565

transcript abundance in the root may increase auxin sink strength in the stalk and 566



29

thus enable axillary buds to establish a polar auxin transport stream and continue 567

bud outgrowth as predicted by the auxin canalization model (Domagalska and 568

Leyser, 2011). To determine whether SAD1 has an effect on polar auxin transport, 569

PIN1 protein distribution in roots of infected plants needs to be verified. 570

In addition to PIN1, we measured transcript levels of the bud outgrowth inhibitor TB1. 571

TB1 has been identified as a maize domestication gene that contributes to the 572

increased apical dominance in maize in comparison to its highly branched ancestor, 573

teosinte (Studer et al., 2011). TB1 suppresses axillary bud outgrowth in maize, and 574

TB1 deletion mutants show excessive side branching (Doebley et al., 1997). In our 575

experiments, TB1 transcripts were reduced in stalks of wild type-inoculated plants in 576

comparison to mock- or ∆SAD1-inoculated plants (Figure 7). Down-regulation of TB1 577

in the presence of SAD1 explains the observed increase in subapical inflorescence 578

bud outgrowth in infected maize. In A. thaliana, a homologue of TB1 was identified as 579

BRANCHED1 (BRC1) that is a central regulator of branching (Aguilar-Martínez et al., 580

2007). Expression of BRC1 was shown to be enhanced by overproduction of auxin in 581

A. thaliana 35S:YUCCA plants leading to a lower amount of branches compared to 582

wild type plants (Finlayson 2007). In contrast, it was shown in maize that mutation of 583

the auxin biosynthetic genes SPI1 encoding a flavin monooxygenase or VT2 584

encoding a tryptophan aminotransferase leads to reduced auxin levels (Phillips et al., 585

2011), and fewer tillers are produced in spi1 and spi1/tb1 mutant plants (Gallavotti et 586

al., 2008b). This indicates that inactivation of auxin biosynthesis genes leads to 587

opposite effects in A. thaliana and maize, i. e. increased branching in Arabidopsis 588

and decreased tillering in maize (Galavotti, 2013), while in both maize and 589

Arabidopsis, branching is dependent on TB1/BRC1 (Finlayson, 2007; Doebley et al., 590

1997). Since expression of SAD1 results in an increase in bud outgrowth in both 591

maize and Arabidopsis, SAD1 likely plays a role in bud outgrowth that is independent 592

of auxin. 593

Other factors could also contribute to SAD1-dependent bud outgrowth, such as the 594

timing of the local accumulation of auxin, strigolactone and cytokinin (Müller and 595

Leyser, 2011). Reduction of strigolactone or increase in cytokinin concentrations 596

would activate bud outgrowth (Cheng et al., 2013) and lead to the observed increase 597

in the number of ears per plant. In A. thaliana it was shown that strigolactone 598

decreases PIN1 levels by two to six fold, which is sufficient to alter apical dominance 599



30

(Shinohara et al., 2013). Recently, effector proteins of a plant pathogenic 600

phytoplasma bacterium were identified that influence different phases of meristem 601

development in tomato (Wei et al., 2013). Additionally to the tested transcription 602

factor TB1 there are multiple other transcription factors that are involved in 603

inflorescence architecture. One very interesting example is DELAYED FLOWERING1 604

(DLF1; Muszynski et al., 2006) a basic leucine zipper protein. Maize B73 with a DLF1 605

deletion exhibit the same branching phenotype in ears as we observed for Gaspe 606

Flint infected with S. reilianum. We could not detect DLF1 in the yeast two hybrid 607

screen and it is unknown whether SAD1 has an effect on transcription of DLF1. It will 608

be challenging to unravel the exact target and mechanism of how the SAD1 effector 609

influences plant branching architecture. 610

CONCLUSION 611

Apical dominance in maize is broken by infection with S. reilianum. We have 612

identified a fungal protein responsible for this disease symptom that we named 613

SUPPRESSOR OF APICAL DOMINANCE 1 (SAD1). SAD1 was found to be 614

secreted from fungal hyphae. SAD1 transcripts were not detectable when the fungus 615

was growing as a saprotroph but were heavily abundant as soon as the fungus 616

entered the maize plant and spread through leaves, nodes and inflorescences. 617

Several factors indicate that SAD1 mediates suppression of apical dominance. 618

Firstly, S. reilianum strains lacking SAD1 no longer lead to suppression of apical 619

dominance although virulence is unaffected. Secondly, re-introduction of SAD1 in the 620

S. reilianum ΔSAD1 deletion strain in multiple copies restored and even increased 621

the suppression of apical dominance phenotype. Thirdly, stable heterologous 622

expression of the SAD1 protein as a fusion to GFP and lacking its secretion signal 623

peptide in A. thaliana resulted in increased inflorescence branching. 624

The mechanism of how SAD1 affects apical dominance in maize and A. thaliana is 625

less clear. It seems likely, that the factor functions within plant cells. It is secreted 626

from fungal hyphae, it has an effect when expressed within A. thaliana cells, it 627

localizes to the cytoplasm and the nucleus in A. thaliana and it can interact with 628

maize cytoplasmic and nuclear proteins. If and how the factor – once secreted from 629

fungal hyphae – ends up in maize cells is an open question, as well as what exactly 630

its effect is, once it has entered. However, we could detect a positive influence of the 631

presence of SAD1 on the PIN1 transcript level in roots of infected maize plants, 632



31

which suggests increased auxin flow to the root as mechanism supporting bud 633

outgrowth. In addition, we observed SAD1-dependent down-regulation of the 634

branching inhibitor TB1, which is well in line with the observed phenotype of 635

increased branching induced by SAD1. Circumstantial evidence points to a role of 636

SAD1 in bud outgrowth that is independent of auxin: While SAD1 has the same effect 637

in maize and A. thaliana, disruption of auxin biosynthesis has an opposite effect on 638

branching in maize and A. thaliana. Elucidating the exact mechanism of how this 639

interesting protein mediates suppression of apical dominance is one of the 640

challenges that lie ahead. 641

642

MATERIALS AND METHODS 643

Plant Lines, Growth Conditions and Inoculation Experiments 644

The maize cultivar ‘Gaspe Flint’, an early-flowering dwarf maize line, was cultivated 645

and used for inoculation with S. reilianum as previously described (Ghareeb et al., 646

2011). Sterilized A. thaliana Col-0 seeds were kept at 4°C for 1-3 days prior to 647

sowing. Plants were grown in soil (Fruhstofer, Type T25) under long day conditions at 648

22°C, 160 µmol, 65% humidity in a phytochamber (Johnson Controls). Sterilized A. 649

thaliana seeds were kept for 2 days prior to plating. Plants were grown on 0.5 x MS 650

medium including vitamins (Duchefa-biochemie) supplemented with 1% sucrose. The 651

Col-0 lines expressing GFP-SAD1∆SP were 970.1 (1), 975.2 (2) and 979.4 (3). 652

S. reilianum strains were prepared as stocks for storage in 25% glycerol at - 80°C, 653

strains were freshly streaked on PD plates, and single colonies were used for 654

inoculation of precultures in YEPSlight (yeast extract, 10 g/l, peptone, 10 g/l, sucrose, 655

10 g/l). For plant inoculation experiments, precultures of the compatible S. reilianum 656

wild type strains SRZ1_5-2 and SRZ2_5-1 (Schirawski et al., 2005; Zuther et al., 657

2012) and their deletion derivatives were used to inoculate potato dextrose broth 658

(Difco, Heidelberg, Germany), and were grown at 28°C under constant shaking to an 659

OD600 of 0.5 to 0.8. Cell pellets were resuspended in water to reach an OD600 of 2.0. 660

Cultures of compatible strains carrying the same deletion were mixed in a 1:1 ratio, 661

and the mixture was used to inoculate seven-day old maize seedlings via syringe-662

assisted leaf whorl apposition (Gillissen et al., 1992). 663



32

664

Generation of Plasmids, Knockout, Complementation and Localization 665

Constructs 666

For generating the expression vectors for p35S:GFP-SAD1∆SP to be expressed in A. 667

thaliana, the primers forA and revA were used to amplify a 0.5 kb fragment containing 668

the SAD1 ORF lacking the signal peptide (SAD1∆SP). The fragment was fused to 669

GFP by cloning into a binary vector containing GFP using NotI and EcoRI. The fusion 670

construct was moved as an AscI and EcoRI-fragment to the binary plant expression 671

vector pAMPAT-MCS (accession: AY436765). For yeast two-hybrid analysis, 672

SAD1∆SP was amplified with oHG210 and oHG211. The 0.5 kb PCR amplicon was 673

digested with EcoRI and BamHI and cloned into the bait vector pGBKT7 (Clontech). 674

For complementation studies, a strategy to integrate the genes of interest at the mig1 675

locus (intergenic region between the genes sr14222 and sr14223) was established. 676

For generation of the SAD1 complementation construct, right and left flanks of the 677

MIG1 locus and the SAD1 gene including promoter and terminator regions were 678

amplified using primers listed in Table 2. The MIG1 flanks, SAD1 and the carboxin 679

resistance cassette from the plasmid pMF1-c (Brachmann et al., 2004) were digested 680

with SfiI and ligated. The ligation product was excised from gel and used to amplify 681

the complementation construct using oligonucleotides listed in Table 2. 682

683

Transformation of S. reilianum and Generation of Recombinant Strains 684

The complementation and localization constructs were used to transform S. reilianum 685

via protoplast transformation. Protoplast preparation and transformation of 686

S. reilianum was performed according to the protocols used for U. maydis (Schulz et 687

al., 1990; Gillissen et al., 1992) with some modifications. A single fungal colony was 688

used to inoculate 2 ml YEPS-light liquid medium and incubated at 28°C for 8 – 12 h. 689

This culture was used to inoculate 100 ml of YEPS-light, which was incubated at 690

28°C with constant shaking at 200 rpm. Cells were grown to an OD600nm of 0.6–0.8 691

and subsequently pelleted by centrifugation at 3500 g (Beckmann Biofuge) for 5 min. 692

The supernatant was discarded and the pellet resuspended in 50 ml SCS buffer (20 693

mM Na-citrate, pH 5.8,1 M sorbitol and sterile filtered). Cells were centrifuged at 3500 694



33

g for 10 min and the supernatant was discarded. Protoplasts were produced by 695

resuspending the cells in 2 ml of Novozyme (2.5 mg/ml) solution (Novo Nordisc, 696

Copenhagen, Denmark) and incubating at room temperature for 5-10 min until ~50% 697

of the cells produced protoplasts. The formation of protoplasts was confirmed by 698

microscopy. Protoplasting was stopped by adding 20 ml SCS buffer and centrifuging 699

the solution at 2300 g for 15 min. The supernatant was discarded and the pellet was 700

washed twice with SCS and once with STC buffer (10 mM Tris-HCl, pH 7.5, 100 mM 701

CaCl2, 1 M sorbitol and sterile filtered), respectively, by carefully resuspending the 702

pellet in 20 ml of either buffers and centrifuging at 2300 g for 15 min. Finally, 703

protoplasts were resuspended in 500 μl ice-cold STC buffer and dispensed into 70 μl 704

aliquots and either used directly for transformation or stored at -80°C. 705

For transformation of the protoplasts, a 70 μl aliquot of protoplasts was mixed with ~5 706

μg DNA and 1.5 μl heparin sodium sulfate (50 mg/ml) and kept on ice for 10 min. 707

Protoplasts were carefully mixed with 500 μl of cold STC containing 40% PEG4000 708

solution and incubated on ice for a further 15 min on ice. The entire mixture was 709

plated onto regeneration medium (10 g/l tryptone, 10 g/l yeast extract, 10 g/l sucrose, 710

182.2 g/l sorbitol and 20 g/l agar) supplemented with the appropriate antibiotic 711

(phleomycin 1 µg/ml, carboxin 5 µg/ml or hygromycin 150 µg/ml). Plates were 712

incubated at 28°C for 4-6 days or until distinct colonies appeared. Single colonies 713

were picked using sterile toothpicks and streaked onto PD or regeneration medium-714

plates supplemented with the appropriate antibiotic to obtain single colonies. Putative 715

transformants were selected and verified by PCR using primers listed in Table 2, and 716

by Southern blot using the deletion construct as probe. 717

For each mutant, 1-3 different strains in each SRZ1_5-2 and SRZ2_5-1 background 718

were used to inoculate maize plants. Strains used in this study for ∆19A1 mutants 719

were (1, JS747 and JS751; 2, JS748 and JS752), for ∆19A2 mutants were (1, HG125 720

and HG127; 2, HG126 and HG128), for ∆sr10073 mutants were HG109 and HG113, 721

for ∆sr10075 mutants were HG80 and HG84, for ∆sr10077 mutants were HG95 and 722

HG99, for ∆sr10079 mutants were HG89 and HG92 (Ghareeb, Zhao, Schirawski, 723

submitted), for ∆SAD1+SAD1 mutants were (1, HG163 and HG167; 2, HG164 and 724

HG168), for PSAD1:GFP containing mutants were (YF2 5-1#1 and YF2 5-2#1), and for 725

∆SAD1+SAD1-GFP mutants were (1, HG183 and HG186; 2, HG185 and HG187). 726



34

For generation of S. reilianum strains expressing cytoplasmic GFP, protoplasts of the 727

compatible S. reilianum wild type strains SRZ2_5-1 and SRZ1_5-2 were transformed 728

with pHSP70-SG (Spellig et al., 1996). 729

730

Arabidopsis Transformation 731

Seeds of A. thaliana ecotype Col-0 were grown on soil in growth chambers (York) at 732

22-25°C under a long day regime of 16 h exposure to light and 8 h darkness and at 733

approximately 60% humidity. Recombinant DNA constructs were introduced into A. 734

thaliana plants by Agrobacterium tumefaciens-mediated transformation, using A. 735

tumefaciens strain EHA105 (Hood et al., 1993) and the floral-dip method (Clough and 736

Bent, 1998). Independent transformants were selected according to resistance 737

against aerosolic glufosinate ammonium (Bayer). 738

739

RNA Isolation and qRT-PCR Analysis 740

Transcript levels of cluster 19A2 genes (as indicated in Figure 2B) were measured by 741

isolating RNA from sporidia grown in liquid culture to an OD600nm of 0.5, as well as by 742

isolating RNA from infected plant samples. Plant samples were collected from a 2-cm 743

piece below the injection hole of the third leaf at three dpi (10 days after sowing 744

(das)), developing nodes of the main stem at 15 dpi (21 das), and ears including 745

stalks with a length of 1-3 cm at 7 wpi (56 das) from mock- or S. reilianum-inoculated 746

plants. The samples were collected from at least 20 plants for each experiment and 747

sampling time point and the experiment was done three independent times. 748

For qRT-PCR analysis of the ZmPIN1 and TB1 genes (indicated in Figure 7), three 749

plant tissues were analyzed: roots, ears of a size of 1-3 cm excluding stalks, and 750

stalks after removal of the ears or axillary buds. For each biological replicate, 751

samples were collected from five different S. reilianum- or water-inoculated plants at 752

7 wpi (56 das). RNA was extracted with Trizol (Invitrogen, Karlsruhe, Germany), 753

DNase treatment was performed using RNase-Free DNase Set (Qiagen; Hilden; 754

Germany), and RNA was purified with RNeasy Plant Mini Kit (Qiagen; Hilden; 755

Germany). Gene transcript levels were determined relative to the 756

peptidylprolylisomerase (ppi, sr11196) transcript level from S. reilianum for analysis 757



35

of cluster 19A2 genes, and relative to the ACT1 gene from maize for analysis of 758

maize gene transcription. Since the family members of ZmPIN1 share high 759

conservation of amino acid sequences and exon/intron structure (Carraro et al., 760

2006; Forestan et al., 2010; Forestan et al., 2012), we designed oligonucleotide 761

primers that targeted exon1 of the three family members ZmPIN1a, ZmPIN1b and 762

ZmPIN1c (Supporting Figure S11). Primers are listed in Table 2. 763

764

Statistical Data Analysis 765

For statistical analysis, all data was tested for normal distribution. The statistical 766

differences between different treatments were analyzed by one way ANOVA and 767

Tukey test using the R software. 768

769

Yeast cDNA Library Construction 770

RNA for normalized cDNA library construction was obtained from an axenically grown 771

mixture of the two compatible S. reilianum wild type strains SRZ1_5-2 and SRZ2_5-1 772

and from three different maize tissues infected with S. reilianum; inoculated leaves (2 773

cm below injection hole) at three dpi, infected nodes at 15 dpi and infected ears at 4 774

wpi (smaller than 2 cm). The tissues were collected from three independent 775

experiments, which each included 20 plants. The quality and purity of RNA from each 776

individual experiment and tissue was checked by Bioanalyzer 2100 (Agilent) and 777

NanoDrop ND-1000 (Thermo Fisher Scientific). Equal RNA amounts from the pooled 778

RNA of each tissue were mixed to make the RNA sample for cDNA library 779

construction. A normalized cDNA library was constructed by Bio S&T, Lachine, QC, 780

Canada. Briefly, 100 µg of total RNA were used for mRNA extraction and cDNA 781

synthesis followed by cDNA normalization using a modified SMART cDNA synthesis 782

method (Clontech). The cDNA was amplified, purified, digested with SfiI for 783

directional cloning into the pGADT7 (modified to include a SfiI site at the multiple 784

cloning site), ligated and transformed into E. coli. Cells were plated into LB solid 785

medium plates with ampicillin and incubated at 37°C overnight. Colonies were 786

collected from plates with 10% glycerol and help of glass beads. The E. coli cells 787

were kept at -80°C in 1-ml aliquots. A portion of the E. coli-containing cDNA library 788

was grown overnight in LB liquid medium with ampicillin. The pGADT7 containing the 789



36

cDNA library was isolated and used for transformation of yeast to construct the yeast 790

two-hybrid library. 791

792

Yeast Two-Hybrid Library Generation 793

The yeast two-hybrid library was constructed according to Make Your Own Mate and 794

Plate Yeast Two-Hybrid Library System and Yeastmaker™ Yeast Transformation 795

System 2 (Clontech, Saint-Germain-en-Laye, France) with some modifications. A 2-3 796

mm single colony of the yeast strain Y187 was inoculated in 3 ml YPDA liquid 797

medium and incubated at 30°C with 250 rpm constant shaking for 8-12 h. From this 798

culture 5 µl were used to inoculate 50 ml YPDA liquid medium and incubated as 799

previously indicated for 16-20 h until OD600nm = 0.15-0.3 is reached. The culture was 800

centrifuged at 700 g for 5 min. The cell pellet was resuspended in 100 ml YPDA liquid 801

medium and left to grow at 30°C with 250 rpm constant shaking for 3-5 h until 802

OD600nm = 0.4-0.5 is reached. The culture was centrifuged at 700 g for 5 min. The cell 803

pellet was resuspended in 30 ml water and centrifuged once again. The cell pellet 804

was resuspended in 1.2 ml TE buffer. The cells were used immediately for 805

transformation of cDNA library. 806

For transformation, the 600 µl cell suspension was mixed with 15 µg cDNA library, 20 807

µl denatured DNA carrier (10 mg/ml; Clontech, Saint-Germain-en-Laye, France) and 808

2.5 ml PEG/LiAc solution. The transformation mixture was incubated at 30°C for 45 809

min with gentle mixing every 15 min. Thereafter 160 µl DMSO was added to the 810

mixture and then incubated in a water bath at 42°C for 20 min with mixing every 10 811

min. The cells were centrifuged at 700 g for 5 min, resuspended in 3 ml YPD Plus 812

Medium (Clontech, Saint-Germain-en-Laye, France) and incubated at 30°C with 250 813

rpm shaking for 90 min. The transformed culture was centrifuged once again. This 814

transformation was performed 10 times individually and the cell pellets were pooled 815

and resuspended in 30 ml 0.9% NaCl. The cell suspensions (150 µl per plate) were 816

plated on 200 SD/-Leucine solid medium. Plates were incubated at 30°C for 4 days, 817

and then chilled at 4°C for 1 day. The colonies in each plate were collected using 5 818

ml freezing medium (YPDA with 25% glycerol and 50 µg/ml kanamycin) and glass 819

rod. Cell suspensions were collected in one container, well mixed and distributed in 820

1-ml aliquots for direct use or 50-ml aliquots for long term storage. Aliquots were 821

stored at -80°C until used. Cell density of the library was calculated using a 822



37

hemocytometer and titering 10-4, 10-5, 10-6 and 10-7 dilutions of the library on SD/-823

Leucine (SD/-Leu) solid plates. 824

825

Autoactivation Test and Yeast Two-Hybrid Screening 826

The yeast two-hybrid screening was performed according to Matchmaker™ Gold 827

Yeast Two-Hybrid System (Clontech, Saint-Germain-en-Laye, France). To prepare 828

for the yeast two-hybrid screening with SAD1 the SAD1 gene without the signal 829

peptide was cloned into pGBKT7 (pGBKT7–SAD1) so that it fuses with the GAL4 830

DNA binding domain. The plasmid was transformed into the yeast strain Y2HGold. 831

As controls, the empty plasmid pGBKT7 and pGBKT7-53 (containing p53 coding 832

sequence), and pGADT7 (empty prey plasmid), pGADT7-T (containing T antigen 833

coding sequence) and pGADT7-Lam (containing the Lam coding sequence) were 834

transformed into the Y2HGold and Y187 strains, respectively. The Y2HGold and 835

Y187 strains can mate. 836

To test whether SAD1 has an auto-activation effect on the selectable markers of the 837

yeast strain, the strain Y2HGold containing pGBKT7-SAD1 was mated with the strain 838

Y187 containing pGADT7 and as controls the strain Y2HGold containing pGBKT7-53 839

was mated with the stain Y187 containing either pGADT7-T (resulting in positive 840

interaction) pGADT7-Lam (resulting in negative interaction). The mating was 841

performed by mixing one 2-3 mm single colony from each strain in 2X YPDA liquid 842

medium. The mixture was incubated at 30°C with 50 rpm shaking for 20-24 h. The 843

mating events were selected on SD/-Leu/-Tryptophan (Trp) double dropout (DDO). 844

The auto-activation of the selectable markers was analyzed by growing the zygotes 845

on DDO with 125-300 ng Aureobasidin A and X-α-Gal (DDO/A/X) or DDO additionally 846

lacking adenine and histidine (quadruple dropout, QDO) solid medium. 847

To screen for the interaction partners of SAD1, a single colony of the Y2HGold strain 848

containing pGBKT7-SAD1 was inoculated in 70 ml SD/-Trp liquid medium and 849

incubated at 30°C with 250 rpm shaking until an OD600nm of 0.8 was reached. The 850

culture was centrifuged at 1000 g for 5 min, then the cell pellet was resuspended in 4 851

ml SD/-Trp liquid medium and combined with 200 µl of Y187 containing the cDNA 852

library (see above) in a sterile 2-L flask. To allow mating, 45 ml of 2X YPDA liquid 853

medium supplemented with 50 μg/ml kanamycin was added, and the culture was 854



38

incubated at 30°C with 50 rpm shaking for 24 h. The mated culture was centrifuged 855

at 1000 g for 10 min and then resuspended in 10 ml 0.5X YPDA (with 50 μg/ml 856

kanamycin). Each 200-µl aliquot of mating suspension was spread on high stringency 857

medium (QDO). Additionally, dilution serials 10-3, 10-5 and 10-6 were prepared and 858

100 µl of each dilution was spread on SD/-Leu, SD/-Trp and DDO plates to estimate 859

the mating efficiency and to calculate the total number of screened clones. The plates 860

were incubated at 30°C for 5 days. 861

The growing colonies were re-purified twice on QDO with 300 ng/ml Aureobasidin 862

(QDO/A). Colonies that survived were used to isolate plasmids, which were 863

individually used to transform E. coli, and then plasmids were isolated from E. coli 864

and sequenced. The sequences were grouped and a representative plasmid 865

(pGADT7-PREY) for each group was retransformed in the Y187 strain to generate 866

Y187+pGADT7-PREY. The Y187+pGADT7-PREY strains were grown in 150 µl liquid 867

SD/-Leu medium in 96 well microtiter plates at 30°C and shaking at 280 rpm for two 868

days. Meanwhile, the Y2HGold strains containing either pGBKT7-SAD1 or pGBKT7 869

were grown in 20 ml SD/-Trp medium at 30°C and 250 rpm until an OD600nm of 5-6 870

was reached. To verify the interaction, 75 µl of Y187+pGADT7-PREY were mixed 871

with 75 µl Y2HGold strains containing either pGBKT7-SAD1 or pGBKT7 in 96 well 872

microtiter plates and incubated overnight at 30°C with shaking at 50 rpm. The cell 873

mixtures were printed on DDO and QDO plates using 96-prong replicator and 874

incubated at 30°C for 3-4 days. 875

876

Staining and Confocal Microscopy 877

Samples for microscopy were freshly collected and prepared by mounting ~1 cm-878

pieces of infected leaves or thin sections of infected ears on a glass slide and 879

immediately fixing the material on the slide with the help of a drop of water and a 880

cover slip. The samples were immediately observed using a TCS-SP5 confocal 881

microscope (Leica, Germany), Zeiss Axioplan II or Axio Observer.Z1 microscopes 882

(Zeiss, Jena, Germany), or a AF 6000LX fluorescence microscope (Leica, Germany). 883

For fluorescence microscopy of GFP the FITC filter (excitation at 450-490 nm and 884

emission at 515-565 nm) was used. Image processing was performed using the 885

imaging software MetaMorph v6.2 (Universal Imaging, Downing Town, PA, USA) or 886



39

AxioVision v4.3 (Zeiss, Jena, Germany), or Leica Application Suite Advanced 887

Fluorescence v4.0 (Leica, Germany). For confocal microscopy of SAD1-GFP fusion 888

proteins in planta, the samples were laser-excited at 488 nm and the emission signal 889

detected at 500–530 nm. For staining plant and fungal cell membranes, FM4-64 890

(Molecular Probes, Invitrogen, Karlsruhe) was used. The infected ears were manually 891

thin-sectioned and dipped in FM4-64 staining solution (17 µM FM4-64 in water) and 892

incubated in the dark and on ice for 30 min. The FM4-64 was excited at 561 nm and 893

signal was detected at 640-750 nm. Images were processed using LAS AF v1.8 and 894

v 4.0 (Leica, Bensheim, Germany). Deconvolution of Z-stacks was performed using 895

the LAS AF v4.0 (Leica, Germany) using 10 iterations with a refractive index of 1.33 896

for the HCX PL APO 40x/1.10 WATER objective, and the “blind” mode. 897

898

ACKNOWLEDGEMENTS 899

We thank Regine Kahmann and Thomas Brefort for stimulating discussions. We are 900

grateful to Jennifer Krüger for technical assistance and help with identification of 901

homozygous A. thaliana lines expressing GFP-SAD1ΔSP, Elmar Meyer for help with 902

generation of cytoplasmic GFP expressing S. reilianum strains, and Yufei Wang for 903

generation of the PSAD1:GFP construct. We thank Ivo Feussner (Göttingen) and 904

Regine Kahmann (Marburg) for greenhouse space and Volker Lipka (Göttingen) for 905

use of the confocal microscope. 906

907

AUTHOR CONTRIBUTIONS 908

H.G., F.D., J.S. designed experiments, H.G., F.D., C.L. performed experiments, C. L., 909

T.T. helped in generation of recombinant Arabidopsis lines, H.G., F.D., J.S. created 910

digital artwork, H.G., F.D., J.S. wrote the paper, H.G., F.D., C.L., T.T., J.S. discussed 911

results and proofread the paper. 912

913



40

Table 1. List of SAD1 interaction partners putatively involved in development, 914

transcription, ubiquitination or signaling. 915

Name IP Frequencya Accession Annotation

Development SAD1-IP4 5 NM_0011118 Zea mays AGAMOUS 1 (ZAG1) SAD1-IP1 4 AF467541 Putative aldehydedehydrogenase MIS1 (MIS1) SAD1-IP2 3 AY883559 Teosinte glume architecture 1 (TGA1) SAD1-IP3 2 NM_0011771 Fimbriata-like protein Nuclear processes SAD1-IP17 5 NM_0011750 Nucleolar complex protein 2 homolog SAD1-IP5 4 NM_0011123 Helicase RH2 protein-like SAD1-IP6 4 NM_0011582 Polypyrimidine tract-binding protein SAD1-IP7 3 NM_0011552 Arginine/serine-rich splicing factor 10 SAD1-IP8 3 EU955917 RNA-binding protein-like SAD1-IP9 3 EU962463 Zinc finger protein-like 1 mRNA SAD1-IP10 2 NM_0011544 Zinc finger, C3HC4 type family protein SAD1-IP11 2 NM_0011751 Transcription factor PIF3 SAD1-IP12 2 EU964022 DNA-directed RNA polymerase II subunit J Ubiquitination SAD1-IP22 7 EU965267 Similar to SAM domain of Anks family protein SAD1-IP23 4 NM_0011478 Probable E3 ubiquitin-protein ligase SAD1-IP24 2 NM_0011555 Probable E3 ubiquitin-protein ligase SAD1-IP25 2 U29161 MubG7 ubiquitinfusionproteingene SAD1-IP26 2 BT066423 Ubiquitin-associated protein SAD1-IP27 2 NM_0011527 E3 ubiquitin-protein ligase RGLG2 SAD1-IP28 2 EU940814.1 E3 ubiquitin-protein ligase KEG SAD1-IP29 2 BT067186 S-phase kinase-associated protein 1-interacting Signaling SAD1-IP33 6 NM_0011533 Probable phosphatase 2C SAD1-IP34 2 NM_0011114 Pyruvatedehydrogenase (lipoamide) kinase1 (pdlk1) SAD1-IP35 2 EU954821 Casein kinase II subunit beta-4 SAD1-IP36 2 NM_0011587 Kinase APK1B

aThe frequency of recovered sequences.

916

917

918



41

Table 2. List of oligonucleotides used in this study. 919

Name Sequence Use to amplify

oHG149 TCGCAACGAGGAAACGAGAC Left flank of mig1 locus

oHG183 CAACCTCGAGCGGCCTACCCAATCTTCAACG Left flank of mig1 locus

oHG151 ATCTAGGCCTGAGTGGCCCTGACGGTAACGGCCGAAAC

Right flank of mig1 locus

oHG152 CGCTTTTGCCACTGCTTCC Right flank of mig1 locus

oHG153 CCGTGGTATCTGAAGCAATC Complementation and localization constructs

oHG154 CCGCCTTGTTGTTCATGG Complementation and localization constructs

oHG194 TGCGCCGCTCAGCATGACATAC Integrated constructs at mig1locus

oHG195 ACGTCGCTGACTGGAGGCTTTG Integrated constructs at mig1locus

oHG202 ATCACGGCCTCTAAGGCCAATACGCAAACCGCCTCTC

egfp-nos terminator

oHG205 GATCACGGAGTGGCAGGTGCAGTGAGCAAGGGCGAGGAG

egfp-nos terminator

oHG186 GTGGAGGAGCCCTACATACC sr10073 in qRT-PCR

oHG187 CAGCGGGCTTATCAATGTGG sr10073 in qRT-PCR

oHG188 ATGCGCCTTCTACTCCAACG sr10075 in qRT-PCR

oHG189 CCGCTCTTTGCAACTCTTCG) sr10075 in qRT-PCR

oHG190 CATGAGAATGCCATGCTTCC sr10077 in qRT-PCR

oHG191 TTCATGGTGCATCACGATCC sr10077 in qRT-PCR

oHG192 ATTGGAGCCCATGCCTCACC sr10079 in qRT-PCR

oHG193 TGGCGTACACGGCGTATTCG sr10079 in qRT-PCR

oHG143 CCGCCAGAATCATGTCCAAC ppi in qRT-PCR

oHG144 CATGAACTGCGGGATGACAC ppi in qRT-PCR

oBH73 CCGCCAGAATCATGTCCAAC ACT1 in qRT-PCR

oBH74 CATGAACTGCGGGATGACAC ACT1 in qRT-PCR

oHG252 ACTTCATCTCCACCAACAACCC PIN1 in qRT-PCR

oHG253 AGAAGTCGCCGTACATGCCC PIN1 in qRT-PCR

oHG264 AGCCACCACTCATCGTTGTC TB1 in qRT-PCR

oHG265 CGTATCCTCCGTTGCCAAAG TB1 in qRT-PCR



42

Name Sequence Use to amplify

oHG210 ATCTAGAATTCAGTGGCTCTCAGAGCGGCGG SAD1ΔSP for yeast two hybrid

oHG211 ATCTAGGATCCCTATACTGATAAATGGAGAGCAGG

SAD1ΔSP for yeast two hybrid

forA AGCGGCCGCTAGTGGCTCTCAGAGCGG SAD1∆SP for A. thaliana expression

revA TGAATTCCTATACTGATAAATGGAGAG SAD1∆SP for A. thaliana expression

920

921



43

Figure Legends: 922

923

Figure 1. Overview of S. reilianum cluster 19-1 gene organization. 924

Diagram showing the gene organization of cluster 19-1 of S. reilianum. The gene 925

cluster comprises 30 genes (filled colored and grey arrows, oriented in their direction 926

of transcription and with gene numbers indicated on top). Homologous genes within 927

this cluster are highlighted with identical coloring. The code below the genes 928

indicates prediction for secretion (s; Target P, reliability class 1-3; Emanuelsson et al. 929

2007). The delineation of gene sub-cluster deletions (A1 and A2) as well as the used 930

individual gene deletions within part A2 are indicated by brackets below the scheme. 931

932

Figure 2. Part A2 of divergence cluster 19-1 of S. reilianum contains 933

determinants for suppression of apical dominance. 934

(A, C) Influence of A1 and A2 deletion strains on development of female 935

inflorescences. Plants were grown in a greenhouse and ear numbers per plant were 936

assessed at six weeks post inoculation (wpi) using water (H2O), compatible wild type 937

strains (WT), or strains lacking part A1 (ΔA1), or A2 (ΔA2) of cluster 19-1 (A), or 938

strains lacking the single genes of part A2: sr10073 (Δ73), sr10075 (Δ 75), 939

sr10077/SAD1 (Δ77), sr10079 (Δ79) (C). The identity of used strains is given in the 940

Materials and Methods section. Values represent averages (± SEM) of three 941

independent experiments using 20 to 25 plants for each replicate and each strain 942

combination. 943

(B) Quantitative real-time PCR analysis of gene transcript levels of the four genes of 944

part A2 of divergence cluster 19-1 of S. reilianum at different stages. In liquid culture, 945

transcripts of sr10075 (75) and sr10077 (SAD1; 77) could not be detected, while 946

transcripts levels of sr10073 (73) and sr10079 (79) were low. RNA was extracted 947

from leaves collected at 3 days, nodes at two weeks, and ears at four weeks after 948

inoculation with compatible wild type strains. Values are averages ± SEM of three 949

independent experiments using pools of ten plants for each experiment relative to the 950

S. reilianum peptidylprolylisomerase gene sr11196. 951



44

(D) Re-introduction of SAD1 (sr10077) into the S. reilianum ΔSAD1 deletion strains 952

restores S. reilianum-induced suppression of apical dominance. Maize cultivar 953

‘Gaspe Flint’ seedlings were inoculated with water (H2O), or compatible wild type 954

(WT), Δsr10077 deletion (ΔSAD1), and Δsr10077+sr10077 complementation 955

(ΔSAD1+SAD1) strains, and symptoms were evaluated at eight wpi, where the plants 956

show a higher number of inflorescences than at six wpi. Plants were grown in a 957

phytochamber. Values are averages of three experiments of 25 plants ± SEM. Letters 958

above the data indicate statistically significant differences (p ≤ 0.05). 959

960

Figure 3. SAD1-GFP is secreted by S. reilianum during growth in planta. 961

(A) Fluorescence microscopy of ears infected with S. reilianum ∆SAD1+SAD1-GFP 962

strains. GFP fluorescence surrounds the fungal hyphae. Picture is a Z-stack of 963

confocal images. 964

(B) Quantification and comparison of GFP signals from hyphae expressing 965

intracellular GFP (upper right picture) or secreted SAD1-GFP (lower right picture). 966

Left diagrams show quantification of hyphae showing intracellular or secreted GFP 967

signals. Hyphae were counted in two experiments of 5 different plants. In total, 148 968

hyphae were counted for GFP and 128 for SAD1-GFP. Error bars indicate the SEM. 969

Bars = 10 µm. 970

(C) Ear number per plant infected with compatible ∆SAD1 deletion or ∆SAD1+SAD1-971

GFP complementation strains in comparison to wild type- (WT) and water- (mock) 972

inoculated plants at 7 wpi. The values are means of two independent experiments 973

(n/experiment = 25 ± 2). Asterisks indicate statistically significant differences to the 974

control (p ≤0.0001). 975

976

Figure 4. Expression of GFP-SAD1DSP in A. thaliana leads to altered 977

inflorescence branching. 978

(A) Analysis of GFP-SAD1DSP gene transcript levels in three independently 979

generated transgenic A. thaliana GFP-SAD1DSP expression lines (1, 2, and 3) 980

relative to transcript abundance of the A. thaliana ACT1 gene as determined by 981

quantitative real-time PCR. Error bars give SEM of three independent experiments. 982



45

(B) Phenotype of transgenic A. thaliana expressing GFP-SAD1DSP. A. thaliana Col-0 983

(left panel, Col-0) and transgenic A. thaliana lines (middle and right panels; 1, 2, 3) 984

expressing GFP-SAD1DSP under control of the 35S-promoter eight weeks after 985

sowing. The transgenic lines display more highly branched inflorescences. 986

(C) Schematic model of an A. thaliana plant with illustrated primary (1°) and 987

secondary (2°) cauline- and rosette-leaf branches. 988

(D) Quantification of primary (1°) and secondary (2°) cauline-leaf and rosette-leaf 989

branches of wild type (Col-0) and the three independent GFP-SAD1DSP-expressing 990

A. thaliana lines used in B. Data are averages with error bars indicating the SEM of 991

three experiments of 10 plants each. Asterisks above the error bars indicate 992

statistically significant differences to the control (p < 0.05). 993

994

995

Figure 5. Heterologously expressed GFP-SAD1ΔSP fusion protein accumulates 996

in the nuclei of A. thaliana cells. 997

(A) (Top) Fluorescence signals of plants expressing GFP-SAD1∆SP (top left) or GFP 998

(top right). Red and blue colored lines indicate two examples for regions of 999

fluorescence intensity measurements. Intensity measurements (middle and bottom 1000

panels) show GFP signal accumulation in the nucleus (middle peak) of plants 1001

expressing GFP-SAD1∆SP (bottom left) or GFP (bottom right) along the red (middle) 1002

or the blue (bottom) region of interest indicated in the pictures on top. 1003

(B) Quantification of GFP intensity ratios between nucleus and cytoplasm of leaf cells 1004

from A. thaliana plants expressing GFP-SAD1∆SP or GFP. Cells expressing the 1005

GFP-SAD1∆SP fusion protein show an average signal intensity ratio of nucleus to 1006

cytoplasm of about 3:1. Cells expressing GFP show a ratio of 1:1. N = 35 cells for 1007

GFP-SAD1∆SP; N = 40 cells for GFP. Five different plants were analyzed for each 1008

construct. Error bars show standard deviation. Letters above the data indicate 1009

statistically significant differences (p ≤0.001). Bars = 50 µm. 1010

1011

Figure 6. Microscopic overview of GFP-SAD1ΔSP distribution in transgenic A. 1012

thaliana plants. 1013



46

(A) 12-day old A. thaliana plants expressing GFP (left) or GFP-SAD1∆SP (right). 1014

Pictures were taken with an exposure time of 10 ms (left) or 200 ms (right). Plants 1015

expressing GFP show a fluorescence signal in every part of the plant. GFP-1016

SAD1∆SP was not detected in hypocotyls. 1017

(B) Fluorescence microscopic picture of three floral buds (arrows) of A. thaliana 1018

expressing GFP-SAD1∆SP. 1019

(C-E) GFP fluorescence of GFP-SAD1DSP expressed in petal cells of the flower (C), 1020

leaves (D), and root cells (E) of six week-old plants. Fluorescence is observed in the 1021

nucleus and in the cytoplasm. Bars, 100 µm (A,B) and 25 µm (C-E). 1022

1023

Figure 7. Real-time PCR analysis of PIN1 and TB1 transcript abundance. 1024

Gene expression was measured in roots (top panel), ears (middle panel) and stalks 1025

(bottom panel) of maize inoculated with water (Mock) wild-type (WT) and ∆SAD1 1026

(ΔSAD1) deletion strains of S. reilianum. Values given are expression values relative 1027

to mock-inoculated plants and are means of three biological replicates with pools of 1028

three plants per replicate and tissue ± SEM. Asterisk indicates statistical difference to 1029

both mock and ΔSAD1 inoculations within the same tissue (p-value < 0.05). 1030

1031

1032



Parsed CitationsAguilar-Martínez JA, Poza-Carrión C, Cubas P (2007) Arabidopsis BRANCHED1 acts as an integrator of branching signals withinaxillary buds. Plant Cell 19: 458-472

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J MolBiol 215: 403-410Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Barazesh S, McSteen P (2008) Hormonal control of grass inflorescence development. Trends Plant Sci 13: 656-662Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bennetzen JL, Hake SC (2009) Handbook of maize: its biology. Springer, New YorkPubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bomblies K, Doebley JF (2006) Pleiotropic effects of the duplicate maize FLORICAULA/LEAFY genes zfl1 and zfl2 on traits underselection during maize domestication. Genetics 172: 519-531


Bos JIB, Armstrong MR, Gilroy EM, Boevink PC, Hein I, Taylor RM, Zhendong T, Engelhardt S, Vetukuri RR, Harrower B (2010)Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligaseCMPG1. Proc Natl Acad Sci USA 107: 9909-9914


Brachmann A, König J, Julius C, Feldbrügge M (2004) A reverse genetic approach for generating gene replacement mutants inUstilago maydis. Mol Genet Genom 272: 216-226


Brunoud G, Wells DM, Oliva M, Larrieu A, Mirabet V, Burrow AH, Beeckman T, Kepinski S, Traas J, Bennett MJ, Vernoux T (2012) Anovel sensor to map auxin response and distribution at high spatio-temporal resolution. Nature 482: 103-106


Carraro N, Forestan C, Canova S, Traas J, Varotto S (2006) ZmPIN1a and ZmPIN1b encode two novel putative candidates for polarauxin transport and plant architecture determination of maize. Plant Physiology 142: 254-264


Chen Z, Agnew JL, Cohen JD, He P, Shan L, Sheen J, Kunkel BN (2007) Pseudomonas syringae type III effector AvrRpt2 altersArabidopsis thaliana auxin physiology. Proc Natl Acad Sci USA 104: 20131-20136


Cheng X, Ruyter-Spira C, Bouwmeester H (2013) The interaction between strigolactones and other plant hormones in theregulation of plant development. Front Plant Sci. 4: 199.


Choi J, Huh SU, Kojima M, Sakakibara H, Paek KH, Hwang I (2010) The cytokinin-activated transcription factor ARR2 promotesplant immunity via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis. Dev Cell 19: 284-295


Cline M, Wesse T, Iwamura H (1997) Cytokinin/auxin control of apical dominance in Ipomoea nil. Plant Cell Physiol 38: 659-667Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. PlantJ 16: 735-743

Pubmed: Author and Title www.plantphysiol.orgon August 25, 2018 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 19%5BVolume%5D AND 458%5BPagination%5D AND Aguilar%2DMart�nez JA%2C Poza%2DCarri�n C%2C Cubas P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Aguilar-Mart�nez JA, Poza-Carri�n C, Cubas P (2007) Arabidopsis BRANCHED1 acts as an integrator of branching signals within axillary buds. Plant Cell 19: 458-472

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Aguilar-Mart�nez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis BRANCHED1 acts as an integrator of branching signals within axillary buds&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis BRANCHED1 acts as an integrator of branching signals within axillary buds&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Aguilar-Mart�nez&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J MolBiol%5BTitle%5D%29 AND 215%5BVolume%5D AND 403%5BPagination%5D AND Altschul SF%2C Gish W%2C Miller W%2C Myers EW%2C Lipman DJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J MolBiol 215: 403-410

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Altschul&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Basic local alignment search tool&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Basic local alignment search tool&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Altschul&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Trends Plant Sci%5BTitle%5D%29 AND 13%5BVolume%5D AND 656%5BPagination%5D AND Barazesh S%2C McSteen P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Barazesh S, McSteen P (2008) Hormonal control of grass inflorescence development. Trends Plant Sci 13: 656-662

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Barazesh&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Hormonal control of grass inflorescence development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Hormonal control of grass inflorescence development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Barazesh&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Handbook of maize%3A its biology%2E%5BTitle%5D%29 AND Bennetzen JL%2C Hake SC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bennetzen JL, Hake SC (2009) Handbook of maize: its biology. Springer, New York

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bennetzen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Handbook of maize: its biology.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Handbook of maize: its biology.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bennetzen&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genetics%5BTitle%5D%29 AND 172%5BVolume%5D AND 519%5BPagination%5D AND Bomblies K%2C Doebley JF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bomblies K, Doebley JF (2006) Pleiotropic effects of the duplicate maize FLORICAULA/LEAFY genes zfl1 and zfl2 on traits under selection during maize domestication. Genetics 172: 519-531

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bomblies&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pleiotropic effects of the duplicate maize FLORICAULA/LEAFY genes zfl1 and zfl2 on traits under selection during maize domestication&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pleiotropic effects of the duplicate maize FLORICAULA/LEAFY genes zfl1 and zfl2 on traits under selection during maize domestication&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bomblies&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 107%5BVolume%5D AND 9909%5BPagination%5D AND Bos JIB%2C Armstrong MR%2C Gilroy EM%2C Boevink PC%2C Hein I%2C Taylor RM%2C Zhendong T%2C Engelhardt S%2C Vetukuri RR%2C Harrower B%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bos JIB, Armstrong MR, Gilroy EM, Boevink PC, Hein I, Taylor RM, Zhendong T, Engelhardt S, Vetukuri RR, Harrower B (2010) Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligase CMPG1. Proc Natl Acad Sci USA 107: 9909-9914

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bos&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligase CMPG1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligase CMPG1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bos&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Genet Genom%5BTitle%5D%29 AND 272%5BVolume%5D AND 216%5BPagination%5D AND Brachmann A%2C K�nig J%2C Julius C%2C Feldbr�gge M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Brachmann A, K�nig J, Julius C, Feldbr�gge M (2004) A reverse genetic approach for generating gene replacement mutants in Ustilago maydis. Mol Genet Genom 272: 216-226

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Brachmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A reverse genetic approach for generating gene replacement mutants in Ustilago maydis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A reverse genetic approach for generating gene replacement mutants in Ustilago maydis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Brachmann&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 482%5BVolume%5D AND 103%5BPagination%5D AND Brunoud G%2C Wells DM%2C Oliva M%2C Larrieu A%2C Mirabet V%2C Burrow AH%2C Beeckman T%2C Kepinski S%2C Traas J%2C Bennett MJ%2C Vernoux T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Brunoud G, Wells DM, Oliva M, Larrieu A, Mirabet V, Burrow AH, Beeckman T, Kepinski S, Traas J, Bennett MJ, Vernoux T (2012) A novel sensor to map auxin response and distribution at high spatio-temporal resolution. Nature 482: 103-106

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Brunoud&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A novel sensor to map auxin response and distribution at high spatio-temporal resolution&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A novel sensor to map auxin response and distribution at high spatio-temporal resolution&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Brunoud&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiology%5BTitle%5D%29 AND 142%5BVolume%5D AND 254%5BPagination%5D AND Carraro N%2C Forestan C%2C Canova S%2C Traas J%2C Varotto S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Carraro N, Forestan C, Canova S, Traas J, Varotto S (2006) ZmPIN1a and ZmPIN1b encode two novel putative candidates for polar auxin transport and plant architecture determination of maize. Plant Physiology 142: 254-264

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Carraro&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ZmPIN1a and ZmPIN1b encode two novel putative candidates for polar auxin transport and plant architecture determination of maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ZmPIN1a and ZmPIN1b encode two novel putative candidates for polar auxin transport and plant architecture determination of maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Carraro&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 104%5BVolume%5D AND 20131%5BPagination%5D AND Chen Z%2C Agnew JL%2C Cohen JD%2C He P%2C Shan L%2C Sheen J%2C Kunkel BN%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chen Z, Agnew JL, Cohen JD, He P, Shan L, Sheen J, Kunkel BN (2007) Pseudomonas syringae type III effector AvrRpt2 alters Arabidopsis thaliana auxin physiology. Proc Natl Acad Sci USA 104: 20131-20136

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pseudomonas syringae type III effector AvrRpt2 alters Arabidopsis thaliana auxin physiology&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pseudomonas syringae type III effector AvrRpt2 alters Arabidopsis thaliana auxin physiology&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Front Plant Sci%5BTitle%5D%29 AND 4%5BVolume%5D AND 199%5BPagination%5D AND Cheng X%2C Ruyter%2DSpira C%2C Bouwmeester H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cheng X, Ruyter-Spira C, Bouwmeester H (2013) The interaction between strigolactones and other plant hormones in the regulation of plant development. Front Plant Sci. 4: 199.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cheng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The interaction between strigolactones and other plant hormones in the regulation of plant development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The interaction between strigolactones and other plant hormones in the regulation of plant development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cheng&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Dev Cell%5BTitle%5D%29 AND 19%5BVolume%5D AND 284%5BPagination%5D AND Choi J%2C Huh SU%2C Kojima M%2C Sakakibara H%2C Paek KH%2C Hwang I%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Choi J, Huh SU, Kojima M, Sakakibara H, Paek KH, Hwang I (2010) The cytokinin-activated transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis. Dev Cell 19: 284-295

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Choi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The cytokinin-activated transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The cytokinin-activated transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Choi&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 38%5BVolume%5D AND 659%5BPagination%5D AND Cline M%2C Wesse T%2C Iwamura H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cline M, Wesse T, Iwamura H (1997) Cytokinin/auxin control of apical dominance in Ipomoea nil. Plant Cell Physiol 38: 659-667

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cline&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cytokinin/auxin control of apical dominance in Ipomoea nil&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cytokinin/auxin control of apical dominance in Ipomoea nil&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cline&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 16%5BVolume%5D AND 735%5BPagination%5D AND Clough SJ%2C Bent AF%5BAuthor%5D&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Coe EH, Neuffer MG, Hoisington DA (1988) The genetics of corn. American Society of Agronomy, MadisonPubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Crawford S, Shinohara N, Sieberer T, Williamson L, George G, Hepworth J, Müller D, Domagalska MA, Leyser O (2010)Strigolactones enhance competition between shoot branches by dampening auxin transport. Development 137: 2905-2913


Davies CR, Seth AK, Wareing PF (1966) Auxin and kinetin interaction in apical dominance. Science 151: 468-469Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Doebley J, Stec A, Hubbard L (1997) The evolution of apical dominance in maize. Nature 386: 485-488Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Domagalska MA, Leyser O (2011) Signal integration in the control of shoot branching. Nature Reviews: Mol Cell Biol 12: 211-221Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Emanuelsson O, Brunak S, Heijne G, Nielsen H (2007) Locating proteins in the cell using TargetP, SignalP, and related toolsNature Protocols 2: 953-971


Faure C, Ramos M, Girault JA (2013) Pyk2 cytonuclear localization: mechanisms and regulation by serine dephosphorylation. CellMol Life Sci 70: 137-152


Finlayson A, (2007) Arabidopsis TEOSINTE BRANCHED1-LIKE 1 regulates axillary bud outgrowth and is homologous to monocotTEOSINTE BRANCHED1. Plant Cell Physiol 48: 667-677


Forestan C, Farinati S, Varotto S (2012) The maize PIN gene family of auxin transporters. Front. Plant Sci. 3Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Forestan C, Meda S, Varotto S (2010) ZmPIN1-mediated auxin transport is related to cellular differentiation during maizeembryogenesis and endosperm development. Plant Physiology 152: 1373-1390


Gallavotti A (2013) The role of auxin in shaping shoot architecture. J Exp Bot 64: 2593-2608Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gallavotti A, Yang Y, Schmidt RJ, Jackson D (2008a) The relationship between auxin transport and maize branching. Plant Physiol147: 1913-1923


Gallavotti A, Barazesh S, Malcomber S, Hall D, Jackson D, Schmidt RJ, McSteen P. (2008b) Sparse inflorescence1 encodes amonocot-specific YUCCA-like gene required for vegetative and reproductive development in maize. Proc Natl Acad Sci U S A105:15196-15201


Ghareeb H, Becker A, Iven T, Feussner I, Schirawski J (2011) Sporisorium reilianum infection changes inflorescence andbranching architectures of maize. Plant Physiol 156: 2037-2052

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon August 25, 2018 - Published by Downloaded from

Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://search.crossref.org/?page=1&rows=2&q=Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Clough&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Clough&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The genetics of corn%2E%5BTitle%5D%29 AND Coe EH%2C Neuffer MG%2C Hoisington DA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Coe EH, Neuffer MG, Hoisington DA (1988) The genetics of corn. American Society of Agronomy, Madison

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Coe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The genetics of corn.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The genetics of corn.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Coe&as_ylo=1988&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Development%5BTitle%5D%29 AND 137%5BVolume%5D AND 2905%5BPagination%5D AND Crawford S%2C Shinohara N%2C Sieberer T%2C Williamson L%2C George G%2C Hepworth J%2C M�ller D%2C Domagalska MA%2C Leyser O%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Crawford S, Shinohara N, Sieberer T, Williamson L, George G, Hepworth J, M�ller D, Domagalska MA, Leyser O (2010) Strigolactones enhance competition between shoot branches by dampening auxin transport. Development 137: 2905-2913

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Crawford&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Strigolactones enhance competition between shoot branches by dampening auxin transport&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Strigolactones enhance competition between shoot branches by dampening auxin transport&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Crawford&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 151%5BVolume%5D AND 468%5BPagination%5D AND Davies CR%2C Seth AK%2C Wareing PF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Davies CR, Seth AK, Wareing PF (1966) Auxin and kinetin interaction in apical dominance. Science 151: 468-469

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Davies&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin and kinetin interaction in apical dominance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin and kinetin interaction in apical dominance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Davies&as_ylo=1966&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 386%5BVolume%5D AND 485%5BPagination%5D AND Doebley J%2C Stec A%2C Hubbard L%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Doebley J, Stec A, Hubbard L (1997) The evolution of apical dominance in maize. Nature 386: 485-488

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Doebley&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The evolution of apical dominance in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The evolution of apical dominance in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Doebley&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature Reviews%3A Mol Cell Biol%5BTitle%5D%29 AND 12%5BVolume%5D AND 211%5BPagination%5D AND Domagalska MA%2C Leyser O%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Domagalska MA, Leyser O (2011) Signal integration in the control of shoot branching. Nature Reviews: Mol Cell Biol 12: 211-221

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Domagalska&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Signal integration in the control of shoot branching&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Signal integration in the control of shoot branching&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Domagalska&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Locating%5BTitle%5D%29 AND 2%5BVolume%5D AND 953%5BPagination%5D AND Emanuelsson O%2C Brunak S%2C Heijne G%2C Nielsen H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Emanuelsson O, Brunak S, Heijne G, Nielsen H (2007) Locating proteins in the cell using TargetP, SignalP, and related tools Nature Protocols 2: 953-971

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Emanuelsson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Emanuelsson&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell Mol Life Sci%5BTitle%5D%29 AND 70%5BVolume%5D AND 137%5BPagination%5D AND Faure C%2C Ramos M%2C Girault JA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Faure C, Ramos M, Girault JA (2013) Pyk2 cytonuclear localization: mechanisms and regulation by serine dephosphorylation. Cell Mol Life Sci 70: 137-152

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Faure&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pyk2 cytonuclear localization: mechanisms and regulation by serine dephosphorylation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pyk2 cytonuclear localization: mechanisms and regulation by serine dephosphorylation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Faure&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 48%5BVolume%5D AND 667%5BPagination%5D AND Finlayson A%2C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Finlayson A, (2007) Arabidopsis TEOSINTE BRANCHED1-LIKE 1 regulates axillary bud outgrowth and is homologous to monocot TEOSINTE BRANCHED1. Plant Cell Physiol 48: 667-677

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Finlayson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis TEOSINTE BRANCHED1-LIKE 1 regulates axillary bud outgrowth and is homologous to monocot TEOSINTE BRANCHED1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis TEOSINTE BRANCHED1-LIKE 1 regulates axillary bud outgrowth and is homologous to monocot TEOSINTE BRANCHED1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Finlayson&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The maize PIN gene family of auxin transporters%2E%5BTitle%5D%29 AND Forestan C%2C Farinati S%2C Varotto S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Forestan C, Farinati S, Varotto S (2012) The maize PIN gene family of auxin transporters. Front. Plant Sci. 3

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Forestan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The maize PIN gene family of auxin transporters.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The maize PIN gene family of auxin transporters.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Forestan&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiology%5BTitle%5D%29 AND 152%5BVolume%5D AND 1373%5BPagination%5D AND Forestan C%2C Meda S%2C Varotto S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Forestan C, Meda S, Varotto S (2010) ZmPIN1-mediated auxin transport is related to cellular differentiation during maize embryogenesis and endosperm development. Plant Physiology 152: 1373-1390

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Forestan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ZmPIN1-mediated auxin transport is related to cellular differentiation during maize embryogenesis and endosperm development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ZmPIN1-mediated auxin transport is related to cellular differentiation during maize embryogenesis and endosperm development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Forestan&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Exp Bot%5BTitle%5D%29 AND 64%5BVolume%5D AND 2593%5BPagination%5D AND Gallavotti A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gallavotti A (2013) The role of auxin in shaping shoot architecture. J Exp Bot 64: 2593-2608

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gallavotti&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of auxin in shaping shoot architecture&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of auxin in shaping shoot architecture&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gallavotti&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 147%5BVolume%5D AND 1913%5BPagination%5D AND Gallavotti A%2C Yang Y%2C Schmidt RJ%2C Jackson D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gallavotti A, Yang Y, Schmidt RJ, Jackson D (2008a) The relationship between auxin transport and maize branching. Plant Physiol 147: 1913-1923


http://scholar.google.com/scholar?as_q=The relationship between auxin transport and maize branching&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The relationship between auxin transport and maize branching&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gallavotti&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 105%5BVolume%5D AND 15196%5BPagination%5D AND Gallavotti A%2C Barazesh S%2C Malcomber S%2C Hall D%2C Jackson D%2C Schmidt RJ%2C McSteen P%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gallavotti A, Barazesh S, Malcomber S, Hall D, Jackson D, Schmidt RJ, McSteen P. (2008b) Sparse inflorescence1 encodes a monocot-specific YUCCA-like gene required for vegetative and reproductive development in maize. Proc Natl Acad Sci U S A 105:15196-15201


http://scholar.google.com/scholar?as_q=Sparse inflorescence1 encodes a monocot-specific YUCCA-like gene required for vegetative and reproductive development in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Sparse inflorescence1 encodes a monocot-specific YUCCA-like gene required for vegetative and reproductive development in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gallavotti&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 156%5BVolume%5D AND 2037%5BPagination%5D AND Ghareeb H%2C Becker A%2C Iven T%2C Feussner I%2C Schirawski J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ghareeb H, Becker A, Iven T, Feussner I, Schirawski J (2011) Sporisorium reilianum infection changes inflorescence and branching architectures of maize. Plant Physiol 156: 2037-2052

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ghareeb&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Sporisorium reilianum infection changes inflorescence and branching architectures of maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Sporisorium reilianum infection changes inflorescence and branching architectures of maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ghareeb&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


Gillissen B, Bergemann J, Sandmann C, Schroeer B, Bölker M, Kahmann R (1992) A two-component regulatory system for self/non-self recognition in Ustilago maydis. Cell 68: 647-657


Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. TransgenicRes 2: 208-218


Hoshi A, Oshima K, Kakizawa S, Ishii Y, Ozeki J, Hashimoto M, Komatsu K, Kagiwada S, Yamaji Y, Namba S (2009) A uniquevirulence factor for proliferation and dwarfism in plants identified from a phytopathogenic bacterium. Proc Natl Acad Sci USA 106:6416-6421


Hubbard L, McSteen P, Doebley J, Hake S (2002) Expression patterns and mutant phenotype of teosinte branched1 correlate withgrowth suppression in maize and teosinte. Genetics 162: 1927-1935


Kämper J (2004) A PCR-based system for highly efficient generation of gene replacement mutants in Ustilago maydis. Mol GenetGenom 271: 103-110


Kämper J, Kahmann R, Bölker M, Ma LJ, Brefort T, Saville BJ, Banuett F, Kronstad JW, Gold SE, Müller O, Perlin MH, Wösten HAB,de Vries R, Ruiz-Herrera J, Reynaga-Pena CG, Snetselaar K, McCann M, Perez-Martin J, Feldbrugge M, Basse CW, Steinberg G,Ibeas JI, Holloman W, Guzman P, Farman M, Stajich JE, Sentandreu R, Gonzalez-Prieto JM, Kennell JC, Molina L, Schirawski J,Mendoza-Mendoza A, Greilinger D, Munch K, Rossel N, Scherer M, Vranes M, Ladendorf O, Vincon V, Fuchs U, Sandrock B, MengS, Ho ECH, Cahill MJ, Boyce KJ, Klose J, Klosterman SJ, Deelstra HJ, Ortiz-Castellanos L, Li WX, Sanchez-Alonso P, Schreier PH,Hauser-Hahn I, Vaupel M, Koopmann E, Friedrich G, Voss H, Schluter T, Margolis J, Platt D, Swimmer C, Gnirke A, Chen F,Vysotskaia V, Mannhaupt G, Guldener U, Munsterkotter M, Haase D, Oesterheld M, Mewes HW, Mauceli EW, DeCaprio D, WadeCM, Butler J, Young S, Jaffe DB, Calvo S, Nusbaum C, Galagan J, Birren BW (2006) Insights from the genome of the biotrophicfungal plant pathogen Ustilago maydis. Nature 444: 97-101


MacLean AM, Sugio A, Makarova OV, Findlay KC, Grieve VM, Tóth R, Nicolaisen M, Hogenhout SA (2011) Phytoplasma effectorSAP54 induces indeterminate leaf-like flower development in Arabidopsis plants. Plant Physiol 157: 831-841


Malaguti G, Fernandez B, Nass H (1977) Downy mildew or crazy top of maize in Venezuela. Agronomia Tropical 27: 103-129Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Matheussen AM, Morgan PW, Frederiksen RA (1991) Implication of gibberellins in head smut (Sporisorium reilianum) of Sorghumbicolor. Plant Physiol 96: 537-544


McSteen P (2009) Hormonal regulation of branching in grasses. Plant Physiol 149: 46-55Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

McSteen P, Hake S (2001) barren inflorescence2 regulates axillary meristem development in the maize inflorescence.Development 128: 2881-2891


McSteen P, Malcomber S, Skirpan A, Lunde C, Wu X, Kellogg E, Hake S (2007) barren inflorescence2 encodes a co-ortholog of thePINOID serine/threonine kinase and is required for organogenesis during inflorescence and vegetative development in maize.Plant Physiol 144: 1000-1011


Meinhardt LW, Rincones J, Bailey BA, Aime MC, Griffith GW, Zhang D, Pereira GAG (2008) Moniliophthora perniciosa, the causal www.plantphysiol.orgon August 25, 2018 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell%5BTitle%5D%29 AND 68%5BVolume%5D AND 647%5BPagination%5D AND Gillissen B%2C Bergemann J%2C Sandmann C%2C Schroeer B%2C B�lker M%2C Kahmann R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gillissen B, Bergemann J, Sandmann C, Schroeer B, B�lker M, Kahmann R (1992) A two-component regulatory system for self/non-self recognition in Ustilago maydis. Cell 68: 647-657

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gillissen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A two-component regulatory system for self/non-self recognition in Ustilago maydis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A two-component regulatory system for self/non-self recognition in Ustilago maydis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gillissen&as_ylo=1992&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Transgenic Res%5BTitle%5D%29 AND 2%5BVolume%5D AND 208%5BPagination%5D AND Hood EE%2C Gelvin SB%2C Melchers LS%2C Hoekema A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2: 208-218

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hood&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=New Agrobacterium helper plasmids for gene transfer to plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=New Agrobacterium helper plasmids for gene transfer to plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hood&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 106%5BVolume%5D AND 6416%5BPagination%5D AND Hoshi A%2C Oshima K%2C Kakizawa S%2C Ishii Y%2C Ozeki J%2C Hashimoto M%2C Komatsu K%2C Kagiwada S%2C Yamaji Y%2C Namba S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hoshi A, Oshima K, Kakizawa S, Ishii Y, Ozeki J, Hashimoto M, Komatsu K, Kagiwada S, Yamaji Y, Namba S (2009) A unique virulence factor for proliferation and dwarfism in plants identified from a phytopathogenic bacterium. Proc Natl Acad Sci USA 106: 6416-6421

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hoshi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A unique virulence factor for proliferation and dwarfism in plants identified from a phytopathogenic bacterium&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A unique virulence factor for proliferation and dwarfism in plants identified from a phytopathogenic bacterium&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hoshi&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genetics%5BTitle%5D%29 AND 162%5BVolume%5D AND 1927%5BPagination%5D AND Hubbard L%2C McSteen P%2C Doebley J%2C Hake S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hubbard L, McSteen P, Doebley J, Hake S (2002) Expression patterns and mutant phenotype of teosinte branched1 correlate with growth suppression in maize and teosinte. Genetics 162: 1927-1935

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hubbard&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Expression patterns and mutant phenotype of teosinte branched1 correlate with growth suppression in maize and teosinte&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Expression patterns and mutant phenotype of teosinte branched1 correlate with growth suppression in maize and teosinte&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hubbard&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Genet Genom%5BTitle%5D%29 AND 271%5BVolume%5D AND 103%5BPagination%5D AND K�mper J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=K�mper J (2004) A PCR-based system for highly efficient generation of gene replacement mutants in Ustilago maydis. Mol Genet Genom 271: 103-110

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=K�mper&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A PCR-based system for highly efficient generation of gene replacement mutants in Ustilago maydis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A PCR-based system for highly efficient generation of gene replacement mutants in Ustilago maydis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=K�mper&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 444%5BVolume%5D AND 97%5BPagination%5D AND K�mper J%2C Kahmann R%2C B�lker M%2C Ma LJ%2C Brefort T%2C Saville BJ%2C Banuett F%2C Kronstad JW%2C Gold SE%2C M�ller O%2C Perlin MH%2C W�sten HAB%2C de Vries R%2C Ruiz%2DHerrera J%2C Reynaga%2DPena CG%2C Snetselaar K%2C McCann M%2C Perez%2DMartin J%2C Feldbrugge M%2C Basse CW%2C Steinberg G%2C Ibeas JI%2C Holloman W%2C Guzman P%2C Farman M%2C Stajich JE%2C Sentandreu R%2C Gonzalez%2DPrieto JM%2C Kennell JC%2C Molina L%2C Schirawski J%2C Mendoza%2DMendoza A%2C Greilinger D%2C Munch K%2C Rossel N%2C Scherer M%2C Vranes M%2C Ladendorf O%2C Vincon V%2C Fuchs U%2C Sandrock B%2C Meng S%2C Ho ECH%2C Cahill MJ%2C Boyce KJ%2C Klose J%2C Klosterman SJ%2C Deelstra HJ%2C Ortiz%2DCastellanos L%2C Li WX%2C Sanchez%2DAlonso P%2C Schreier PH%2C Hauser%2DHahn I%2C Vaupel M%2C Koopmann E%2C Friedrich G%2C Voss H%2C Schluter T%2C Margolis J%2C Platt D%2C Swimmer C%2C Gnirke A%2C Chen F%2C Vysotskaia V%2C Mannhaupt G%2C Guldener U%2C Munsterkotter M%2C Haase D%2C Oesterheld M%2C Mewes HW%2C Mauceli EW%2C DeCaprio D%2C Wade CM%2C Butler J%2C Young S%2C Jaffe DB%2C Calvo S%2C Nusbaum C%2C Galagan J%2C Birren BW%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=K�mper J, Kahmann R, B�lker M, Ma LJ, Brefort T, Saville BJ, Banuett F, Kronstad JW, Gold SE, M�ller O, Perlin MH, W�sten HAB, de Vries R, Ruiz-Herrera J, Reynaga-Pena CG, Snetselaar K, McCann M, Perez-Martin J, Feldbrugge M, Basse CW, Steinberg G, Ibeas JI, Holloman W, Guzman P, Farman M, Stajich JE, Sentandreu R, Gonzalez-Prieto JM, Kennell JC, Molina L, Schirawski J, Mendoza-Mendoza A, Greilinger D, Munch K, Rossel N, Scherer M, Vranes M, Ladendorf O, Vincon V, Fuchs U, Sandrock B, Meng S, Ho ECH, Cahill MJ, Boyce KJ, Klose J, Klosterman SJ, Deelstra HJ, Ortiz-Castellanos L, Li WX, Sanchez-Alonso P, Schreier PH, Hauser-Hahn I, Vaupel M, Koopmann E, Friedrich G, Voss H, Schluter T, Margolis J, Platt D, Swimmer C, Gnirke A, Chen F, Vysotskaia V, Mannhaupt G, Guldener U, Munsterkotter M, Haase D, Oesterheld M, Mewes HW, Mauceli EW, DeCaprio D, Wade CM, Butler J, Young S, Jaffe DB, Calvo S, Nusbaum C, Galagan J, Birren BW (2006) Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis. Nature 444: 97-101

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=K�mper&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=K�mper&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 157%5BVolume%5D AND 831%5BPagination%5D AND MacLean AM%2C Sugio A%2C Makarova OV%2C Findlay KC%2C Grieve VM%2C T�th R%2C Nicolaisen M%2C Hogenhout SA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=MacLean AM, Sugio A, Makarova OV, Findlay KC, Grieve VM, T�th R, Nicolaisen M, Hogenhout SA (2011) Phytoplasma effector SAP54 induces indeterminate leaf-like flower development in Arabidopsis plants. Plant Physiol 157: 831-841

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=MacLean&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma effector SAP54 induces indeterminate leaf-like flower development in Arabidopsis plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma effector SAP54 induces indeterminate leaf-like flower development in Arabidopsis plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=MacLean&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Agronomia Tropical%5BTitle%5D%29 AND 27%5BVolume%5D AND 103%5BPagination%5D AND Malaguti G%2C Fernandez B%2C Nass H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Malaguti G, Fernandez B, Nass H (1977) Downy mildew or crazy top of maize in Venezuela. Agronomia Tropical 27: 103-129

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Malaguti&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Downy mildew or crazy top of maize in Venezuela&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Downy mildew or crazy top of maize in Venezuela&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Malaguti&as_ylo=1977&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 96%5BVolume%5D AND 537%5BPagination%5D AND Matheussen AM%2C Morgan PW%2C Frederiksen RA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Matheussen AM, Morgan PW, Frederiksen RA (1991) Implication of gibberellins in head smut (Sporisorium reilianum) of Sorghum bicolor. Plant Physiol 96: 537-544

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Matheussen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Implication of gibberellins in head smut (Sporisorium reilianum) of Sorghum bicolor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Implication of gibberellins in head smut (Sporisorium reilianum) of Sorghum bicolor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Matheussen&as_ylo=1991&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 149%5BVolume%5D AND 46%5BPagination%5D AND McSteen P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=McSteen P (2009) Hormonal regulation of branching in grasses. Plant Physiol 149: 46-55

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=McSteen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Hormonal regulation of branching in grasses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Hormonal regulation of branching in grasses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=McSteen&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Development%5BTitle%5D%29 AND 128%5BVolume%5D AND 2881%5BPagination%5D AND McSteen P%2C Hake S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=McSteen P, Hake S (2001) barren inflorescence2 regulates axillary meristem development in the maize inflorescence. Development 128: 2881-2891


http://scholar.google.com/scholar?as_q=barren inflorescence2 regulates axillary meristem development in the maize inflorescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=barren inflorescence2 regulates axillary meristem development in the maize inflorescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=McSteen&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 144%5BVolume%5D AND 1000%5BPagination%5D AND McSteen P%2C Malcomber S%2C Skirpan A%2C Lunde C%2C Wu X%2C Kellogg E%2C Hake S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=McSteen P, Malcomber S, Skirpan A, Lunde C, Wu X, Kellogg E, Hake S (2007) barren inflorescence2 encodes a co-ortholog of the PINOID serine/threonine kinase and is required for organogenesis during inflorescence and vegetative development in maize. Plant Physiol 144: 1000-1011


http://scholar.google.com/scholar?as_q=barren inflorescence2 encodes a co-ortholog of the PINOID serine/threonine kinase and is required for organogenesis during inflorescence and vegetative development in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=barren inflorescence2 encodes a co-ortholog of the PINOID serine/threonine kinase and is required for organogenesis during inflorescence and vegetative development in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=McSteen&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1


agent of witches' broom disease of cacao: what's new from this old foe? Mol Plant Pathol 9: 577-588Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Mukhtar MS, Carvunis AR, Dreze M, Epple P, Steinbrenner J, Moore J, Tasan M, Galli M, Hao T, Nishimura MT, Pevzner SJ,Donovan SE, Ghamsari L, Santhanam B, Romero V, Poulin MM, Gebreab F, Gutierrez BJ, Tam S, Monachello D, Boxem M, HarbortCJ, McDonald N, Gai L, Chen H, He Y, European Union Effectoromics C, Vandenhaute J, Roth FP, Hill DE, Ecker JR, Vidal M,Beynon J, Braun P, Dangl JL (2011) Independently evolved virulence effectors converge onto hubs in a plant immune systemnetwork. Science 333: 596-601


Muszynski MG, Dam T, Li B, Shirbroun DM, Hou Z, Bruggemann E, Archibald R, Ananiev EV, Danilevskaya ON (2006) delayedflowering1 Encodes a basic leucine zipper protein that mediates floral inductive signals at the shoot apex in maize. Plant Physiol142:1523-1536


Müller D, Leyser O (2011) Auxin, cytokinin and the control of shoot branching. Ann Bot 107: 1203-1212Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nordström A, Tarkowski P, Tarkowska D, Norbaek R, Astot C, Dolezal K, Sandberg G. (2004) Auxin regulation of cytokininbiosynthesis in Arabidopsis thaliana: a factor of potential importance for auxin-cytokinin-regulated development. Proc Natl AcadSci U S A 101: 8039-8044


Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones JDG (2006) A plant miRNA contributes toantibacterial resistance by repressing auxin signaling. Science 312: 436-439


Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions.Nature Methods 8: 785-786


Phillips KA, Skirpan AL, Liu X, Christensen A, Slewinski TL, Hudson C, Barazesh S, Cohen JD, Malcomber S, McSteen P (2011)Vanishing tassel2 encodes a grass-specific tryptophan aminotransferase required for vegetative and reproductive developmentin maize. Plant Cell 23: 550-566


Plotnikov A, Chuderland D, Karamansha Y, Livnah O, Seger R (2011) Nuclear extracellular signal-regulated kinase 1 and 2translocation is mediated by casein kinase 2 and accelerated by autophosphorylation. Mol Cell Biol 31: 3515-3530


Prusinkiewicz P, Crawford S, Smith RS, Ljung K, Bennett T, Ongaro V, Leyser O (2009) Control of bud activation by an auxintransport switch. Proc Natl Acad Sci USA 106: 17431-17436


Reineke G, Heinze B, Schirawski J, Buettner H, Kahmann R, Basse CW (2008) Indole-3-acetic acid (IAA) biosynthesis in the smutfungus Ustilago maydis and its relevance for increased IAA levels in infected tissue and host tumour formation. Mol Plant Pathol 9:339-355


Robert-Seilaniantz A, Grant M, Jones JDG (2011) Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Ann Rev Phytopathol 49: 317-343


Sachs T (1981) The control of the patterned differentiation of vascular tissues. Adv Bot Res 9: 151-262Pubmed: Author and TitleCrossRef: Author and Title www.plantphysiol.orgon August 25, 2018 - Published by Downloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Pathol%5BTitle%5D%29 AND 9%5BVolume%5D AND 577%5BPagination%5D AND Meinhardt LW%2C Rincones J%2C Bailey BA%2C Aime MC%2C Griffith GW%2C Zhang D%2C Pereira GAG%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Meinhardt LW, Rincones J, Bailey BA, Aime MC, Griffith GW, Zhang D, Pereira GAG (2008) Moniliophthora perniciosa, the causal agent of witches' broom disease of cacao: what's new from this old foe? Mol Plant Pathol 9: 577-588

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Meinhardt&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Moniliophthora perniciosa, the causal agent of witches' broom disease of cacao: what's new from this old foe&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Moniliophthora perniciosa, the causal agent of witches' broom disease of cacao: what's new from this old foe&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Meinhardt&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 333%5BVolume%5D AND 596%5BPagination%5D AND Mukhtar MS%2C Carvunis AR%2C Dreze M%2C Epple P%2C Steinbrenner J%2C Moore J%2C Tasan M%2C Galli M%2C Hao T%2C Nishimura MT%2C Pevzner SJ%2C Donovan SE%2C Ghamsari L%2C Santhanam B%2C Romero V%2C Poulin MM%2C Gebreab F%2C Gutierrez BJ%2C Tam S%2C Monachello D%2C Boxem M%2C Harbort CJ%2C McDonald N%2C Gai L%2C Chen H%2C He Y%2C European Union Effectoromics C%2C Vandenhaute J%2C Roth FP%2C Hill DE%2C Ecker JR%2C Vidal M%2C Beynon J%2C Braun P%2C Dangl JL%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mukhtar MS, Carvunis AR, Dreze M, Epple P, Steinbrenner J, Moore J, Tasan M, Galli M, Hao T, Nishimura MT, Pevzner SJ, Donovan SE, Ghamsari L, Santhanam B, Romero V, Poulin MM, Gebreab F, Gutierrez BJ, Tam S, Monachello D, Boxem M, Harbort CJ, McDonald N, Gai L, Chen H, He Y, European Union Effectoromics C, Vandenhaute J, Roth FP, Hill DE, Ecker JR, Vidal M, Beynon J, Braun P, Dangl JL (2011) Independently evolved virulence effectors converge onto hubs in a plant immune system network. Science 333: 596-601

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mukhtar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Independently evolved virulence effectors converge onto hubs in a plant immune system network&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Independently evolved virulence effectors converge onto hubs in a plant immune system network&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mukhtar&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 142%5BVolume%5D AND 1523%5BPagination%5D AND Muszynski MG%2C Dam T%2C Li B%2C Shirbroun DM%2C Hou Z%2C Bruggemann E%2C Archibald R%2C Ananiev EV%2C Danilevskaya ON%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Muszynski MG, Dam T, Li B, Shirbroun DM, Hou Z, Bruggemann E, Archibald R, Ananiev EV, Danilevskaya ON (2006) delayed flowering1 Encodes a basic leucine zipper protein that mediates floral inductive signals at the shoot apex in maize. Plant Physiol 142:1523-1536

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Muszynski&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=delayed flowering1 Encodes a basic leucine zipper protein that mediates floral inductive signals at the shoot apex in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=delayed flowering1 Encodes a basic leucine zipper protein that mediates floral inductive signals at the shoot apex in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Muszynski&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ann Bot%5BTitle%5D%29 AND 107%5BVolume%5D AND 1203%5BPagination%5D AND M�ller D%2C Leyser O%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=M�ller D, Leyser O (2011) Auxin, cytokinin and the control of shoot branching. Ann Bot 107: 1203-1212

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=M�ller&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin, cytokinin and the control of shoot branching&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin, cytokinin and the control of shoot branching&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=M�ller&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci U S A%5BTitle%5D%29 AND 101%5BVolume%5D AND 8039%5BPagination%5D AND Nordstr�m A%2C Tarkowski P%2C Tarkowska D%2C Norbaek R%2C Astot C%2C Dolezal K%2C Sandberg G%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nordstr�m A, Tarkowski P, Tarkowska D, Norbaek R, Astot C, Dolezal K, Sandberg G. (2004) Auxin regulation of cytokinin biosynthesis in Arabidopsis thaliana: a factor of potential importance for auxin-cytokinin-regulated development. Proc Natl Acad Sci U S A 101: 8039-8044

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nordstr�m&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin regulation of cytokinin biosynthesis in Arabidopsis thaliana: a factor of potential importance for auxin-cytokinin-regulated development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin regulation of cytokinin biosynthesis in Arabidopsis thaliana: a factor of potential importance for auxin-cytokinin-regulated development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nordstr�m&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 312%5BVolume%5D AND 436%5BPagination%5D AND Navarro L%2C Dunoyer P%2C Jay F%2C Arnold B%2C Dharmasiri N%2C Estelle M%2C Voinnet O%2C Jones JDG%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones JDG (2006) A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312: 436-439

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Navarro&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A plant miRNA contributes to antibacterial resistance by repressing auxin signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A plant miRNA contributes to antibacterial resistance by repressing auxin signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Navarro&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28SignalP 4%5BTitle%5D%29 AND 0%5BVolume%5D AND discriminating signal peptides from transmembrane regions%2E Nature Methods 8%3A 785%5BPagination%5D AND Petersen TN%2C Brunak S%2C von Heijne G%2C Nielsen H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature Methods 8: 785-786

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Petersen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SignalP 4&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SignalP 4&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Petersen&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 23%5BVolume%5D AND 550%5BPagination%5D AND Phillips KA%2C Skirpan AL%2C Liu X%2C Christensen A%2C Slewinski TL%2C Hudson C%2C Barazesh S%2C Cohen JD%2C Malcomber S%2C McSteen P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Phillips KA, Skirpan AL, Liu X, Christensen A, Slewinski TL, Hudson C, Barazesh S, Cohen JD, Malcomber S, McSteen P (2011) Vanishing tassel2 encodes a grass-specific tryptophan aminotransferase required for vegetative and reproductive development in maize. Plant Cell 23: 550-566

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Phillips&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Vanishing tassel2 encodes a grass-specific tryptophan aminotransferase required for vegetative and reproductive development in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Vanishing tassel2 encodes a grass-specific tryptophan aminotransferase required for vegetative and reproductive development in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Phillips&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Cell Biol%5BTitle%5D%29 AND 31%5BVolume%5D AND 3515%5BPagination%5D AND Plotnikov A%2C Chuderland D%2C Karamansha Y%2C Livnah O%2C Seger R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Plotnikov A, Chuderland D, Karamansha Y, Livnah O, Seger R (2011) Nuclear extracellular signal-regulated kinase 1 and 2 translocation is mediated by casein kinase 2 and accelerated by autophosphorylation. Mol Cell Biol 31: 3515-3530

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Plotnikov&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear extracellular signal-regulated kinase 1 and 2 translocation is mediated by casein kinase 2 and accelerated by autophosphorylation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear extracellular signal-regulated kinase 1 and 2 translocation is mediated by casein kinase 2 and accelerated by autophosphorylation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Plotnikov&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 106%5BVolume%5D AND 17431%5BPagination%5D AND Prusinkiewicz P%2C Crawford S%2C Smith RS%2C Ljung K%2C Bennett T%2C Ongaro V%2C Leyser O%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Prusinkiewicz P, Crawford S, Smith RS, Ljung K, Bennett T, Ongaro V, Leyser O (2009) Control of bud activation by an auxin transport switch. Proc Natl Acad Sci USA 106: 17431-17436

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Prusinkiewicz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Control of bud activation by an auxin transport switch&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Control of bud activation by an auxin transport switch&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Prusinkiewicz&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant Pathol%5BTitle%5D%29 AND 9%5BVolume%5D AND 339%5BPagination%5D AND Reineke G%2C Heinze B%2C Schirawski J%2C Buettner H%2C Kahmann R%2C Basse CW%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Reineke G, Heinze B, Schirawski J, Buettner H, Kahmann R, Basse CW (2008) Indole-3-acetic acid (IAA) biosynthesis in the smut fungus Ustilago maydis and its relevance for increased IAA levels in infected tissue and host tumour formation. Mol Plant Pathol 9: 339-355

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Reineke&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Indole-3-acetic acid (IAA) biosynthesis in the smut fungus Ustilago maydis and its relevance for increased IAA levels in infected tissue and host tumour formation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Indole-3-acetic acid (IAA) biosynthesis in the smut fungus Ustilago maydis and its relevance for increased IAA levels in infected tissue and host tumour formation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Reineke&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ann Rev Phytopathol%5BTitle%5D%29 AND 49%5BVolume%5D AND 317%5BPagination%5D AND Robert%2DSeilaniantz A%2C Grant M%2C Jones JDG%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Robert-Seilaniantz A, Grant M, Jones JDG (2011) Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Ann Rev Phytopathol 49: 317-343

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Robert-Seilaniantz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Robert-Seilaniantz&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Adv Bot Res%5BTitle%5D%29 AND 9%5BVolume%5D AND 151%5BPagination%5D AND Sachs T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sachs T (1981) The control of the patterned differentiation of vascular tissues. Adv Bot Res 9: 151-262


Google Scholar: Author Only Title Only Author and Title

Sachs T, Thimann KV (1967) The role of auxins and cytokinins in the release of buds from dominance. Am J Bot 54: 136-144Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Schirawski J, Heinze B, Wagenknecht M, Kahmann R (2005) Mating type loci of Sporisorium reilianum: novel pattern with three aand multiple b specificities. Eukaryotic Cell 4: 1317-1327


Schirawski J, Mannhaupt G, Münch K, Brefort T, Schipper K, Doehlemann G, Di Stasio M, Rössel N, Mendoza-Mendoza A, PesterD, Müller O, Winterberg B, Meyer E, Ghareeb H, Wollenberg T, Münsterkötter M, Wong P, Walter M, Stukenbrock E, Güldener U,Kahmann R (2010) Pathogenicity determinants in smut fungi revealed by genome comparison. Science 330: 1546-1548


Schulz B, Banuett F, Dahl M, Schlesinger R, Schäfer W, Martin T, Herskowitz I, Kahmann R (1990) The b alleles of U. maydis,whose combinations program pathogenic development, code for polypeptides containing a homeodomain-related motif. Cell 60:295-306


Shani E, Yanai O, Ori N (2006) The role of hormones in shoot apical meristem function. Curr Opin Plant Biol 9: 484-489Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sheridan WF (1988) Maize developmental genetics: genes of morphogenesis. Ann Rev Genet 22: 353-385Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Shinohara N, Taylor C, Leyser O (2013) Strigolactone can promote or inhibit shoot branching by triggering rapid depletion of theauxin efflux protein PIN1 from the plasma membrane. PLoS Biology 11: e1001474


Skibbe DS, Doehlemann G, Fernandes J, Walbot V (2010) Maize tumors caused by Ustilago maydis require organ-specific genes inhost and pathogen. Science 328: 89-92


Spellig T, Bottin A, Kahmann R (1996) Green fluorescent protein (GFP) as a new vital marker in the phytopathogenic fungusUstilago maydis. Mol Gen Genet 252: 503-509


Studer A, Zhao Q, Ross-Ibarra J, Doebley J (2011) Identification of a functional transposon insertion in the maize domesticationgene tb1. Nature Genetics 43: 1160-1163


Tanaka M, Takei K, Kojima M, Sakakibara H, Mori H (2006) Auxin controls local cytokinin biosynthesis in the nodal stem in apicaldominance. Plant J. 45: 1028-1036


Turnbull CG, Booker JP, Leyser HM (2002) Micrografting techniques for testing long-distance signalling in Arabidopsis. Plant J. 32:255-262


Wang Q, Kohlen W, Rossmann S, Vernoux T, Theres K (2014) Auxin Depletion from the Leaf Axil Conditions Competence forAxillary Meristem Formation in Arabidopsis and Tomato. Plant Cell 26: 2068-2079


Wei W, Davis RE, Nuss DL, Zhao Y (2013) Phytoplasmal infection derails genetically preprogrammed meristem fate and alters plantarchitecture. Proc Natl Acad Sci USA 111: 19149-19154 www.plantphysiol.orgon August 25, 2018 - Published by Downloaded from


http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sachs&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The control of the patterned differentiation of vascular tissues&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The control of the patterned differentiation of vascular tissues&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sachs&as_ylo=1981&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Am J Bot%5BTitle%5D%29 AND 54%5BVolume%5D AND 136%5BPagination%5D AND Sachs T%2C Thimann KV%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sachs T, Thimann KV (1967) The role of auxins and cytokinins in the release of buds from dominance. Am J Bot 54: 136-144

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sachs&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of auxins and cytokinins in the release of buds from dominance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of auxins and cytokinins in the release of buds from dominance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sachs&as_ylo=1967&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Eukaryotic Cell%5BTitle%5D%29 AND 4%5BVolume%5D AND 1317%5BPagination%5D AND Schirawski J%2C Heinze B%2C Wagenknecht M%2C Kahmann R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schirawski J, Heinze B, Wagenknecht M, Kahmann R (2005) Mating type loci of Sporisorium reilianum: novel pattern with three a and multiple b specificities. Eukaryotic Cell 4: 1317-1327

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schirawski&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mating type loci of Sporisorium reilianum: novel pattern with three a and multiple b specificities&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mating type loci of Sporisorium reilianum: novel pattern with three a and multiple b specificities&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schirawski&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 330%5BVolume%5D AND 1546%5BPagination%5D AND Schirawski J%2C Mannhaupt G%2C M�nch K%2C Brefort T%2C Schipper K%2C Doehlemann G%2C Di Stasio M%2C R�ssel N%2C Mendoza%2DMendoza A%2C Pester D%2C M�ller O%2C Winterberg B%2C Meyer E%2C Ghareeb H%2C Wollenberg T%2C M�nsterk�tter M%2C Wong P%2C Walter M%2C Stukenbrock E%2C G�ldener U%2C Kahmann R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schirawski J, Mannhaupt G, M�nch K, Brefort T, Schipper K, Doehlemann G, Di Stasio M, R�ssel N, Mendoza-Mendoza A, Pester D, M�ller O, Winterberg B, Meyer E, Ghareeb H, Wollenberg T, M�nsterk�tter M, Wong P, Walter M, Stukenbrock E, G�ldener U, Kahmann R (2010) Pathogenicity determinants in smut fungi revealed by genome comparison. Science 330: 1546-1548

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schirawski&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pathogenicity determinants in smut fungi revealed by genome comparison&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pathogenicity determinants in smut fungi revealed by genome comparison&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schirawski&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28maydis%2C whose combinations program pathogenic development%2C code for polypeptides containing a homeodomain%2Drelated motif%2E Cell%5BTitle%5D%29 AND 60%5BVolume%5D AND 295%5BPagination%5D AND Schulz B%2C Banuett F%2C Dahl M%2C Schlesinger R%2C Sch�fer W%2C Martin T%2C Herskowitz I%2C Kahmann R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schulz B, Banuett F, Dahl M, Schlesinger R, Sch�fer W, Martin T, Herskowitz I, Kahmann R (1990) The b alleles of U. maydis, whose combinations program pathogenic development, code for polypeptides containing a homeodomain-related motif. Cell 60: 295-306

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schulz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The b alleles of U&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The b alleles of U&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schulz&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr Opin Plant Biol%5BTitle%5D%29 AND 9%5BVolume%5D AND 484%5BPagination%5D AND Shani E%2C Yanai O%2C Ori N%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shani E, Yanai O, Ori N (2006) The role of hormones in shoot apical meristem function. Curr Opin Plant Biol 9: 484-489

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shani&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of hormones in shoot apical meristem function&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of hormones in shoot apical meristem function&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shani&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ann Rev Genet%5BTitle%5D%29 AND 22%5BVolume%5D AND 353%5BPagination%5D AND Sheridan WF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sheridan WF (1988) Maize developmental genetics: genes of morphogenesis. Ann Rev Genet 22: 353-385

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sheridan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Maize developmental genetics: genes of morphogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Maize developmental genetics: genes of morphogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sheridan&as_ylo=1988&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Strigolactone can promote or inhibit shoot branching by triggering rapid depletion of the auxin efflux protein PIN1 from the plasma membrane%2E%5BTitle%5D%29 AND Shinohara N%2C Taylor C%2C Leyser O%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shinohara N, Taylor C, Leyser O (2013) Strigolactone can promote or inhibit shoot branching by triggering rapid depletion of the auxin efflux protein PIN1 from the plasma membrane. PLoS Biology 11: e1001474

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shinohara&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Strigolactone can promote or inhibit shoot branching by triggering rapid depletion of the auxin efflux protein PIN1 from the plasma membrane.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Strigolactone can promote or inhibit shoot branching by triggering rapid depletion of the auxin efflux protein PIN1 from the plasma membrane.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shinohara&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 328%5BVolume%5D AND 89%5BPagination%5D AND Skibbe DS%2C Doehlemann G%2C Fernandes J%2C Walbot V%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Skibbe DS, Doehlemann G, Fernandes J, Walbot V (2010) Maize tumors caused by Ustilago maydis require organ-specific genes in host and pathogen. Science 328: 89-92

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Skibbe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Maize tumors caused by Ustilago maydis require organ-specific genes in host and pathogen&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Maize tumors caused by Ustilago maydis require organ-specific genes in host and pathogen&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Skibbe&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Gen Genet%5BTitle%5D%29 AND 252%5BVolume%5D AND 503%5BPagination%5D AND Spellig T%2C Bottin A%2C Kahmann R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Spellig T, Bottin A, Kahmann R (1996) Green fluorescent protein (GFP) as a new vital marker in the phytopathogenic fungus Ustilago maydis. Mol Gen Genet 252: 503-509

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Spellig&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Green fluorescent protein (GFP) as a new vital marker in the phytopathogenic fungus Ustilago maydis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Green fluorescent protein (GFP) as a new vital marker in the phytopathogenic fungus Ustilago maydis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Spellig&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature Genetics%5BTitle%5D%29 AND 43%5BVolume%5D AND 1160%5BPagination%5D AND Studer A%2C Zhao Q%2C Ross%2DIbarra J%2C Doebley J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Studer A, Zhao Q, Ross-Ibarra J, Doebley J (2011) Identification of a functional transposon insertion in the maize domestication gene tb1. Nature Genetics 43: 1160-1163

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Studer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of a functional transposon insertion in the maize domestication gene tb1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of a functional transposon insertion in the maize domestication gene tb1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Studer&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 45%5BVolume%5D AND 1028%5BPagination%5D AND Tanaka M%2C Takei K%2C Kojima M%2C Sakakibara H%2C Mori H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tanaka M, Takei K, Kojima M, Sakakibara H, Mori H (2006) Auxin controls local cytokinin biosynthesis in the nodal stem in apical dominance. Plant J. 45: 1028-1036

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tanaka&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin controls local cytokinin biosynthesis in the nodal stem in apical dominance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin controls local cytokinin biosynthesis in the nodal stem in apical dominance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tanaka&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 32%5BVolume%5D AND 255%5BPagination%5D AND Turnbull CG%2C Booker JP%2C Leyser HM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Turnbull CG, Booker JP, Leyser HM (2002) Micrografting techniques for testing long-distance signalling in Arabidopsis. Plant J. 32: 255-262

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Turnbull&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Micrografting techniques for testing long-distance signalling in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Micrografting techniques for testing long-distance signalling in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Turnbull&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 26%5BVolume%5D AND 2068%5BPagination%5D AND Wang Q%2C Kohlen W%2C Rossmann S%2C Vernoux T%2C Theres K%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang Q, Kohlen W, Rossmann S, Vernoux T, Theres K (2014) Auxin Depletion from the Leaf Axil Conditions Competence for Axillary Meristem Formation in Arabidopsis and Tomato. Plant Cell 26: 2068-2079

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin Depletion from the Leaf Axil Conditions Competence for Axillary Meristem Formation in Arabidopsis and Tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin Depletion from the Leaf Axil Conditions Competence for Axillary Meristem Formation in Arabidopsis and Tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1



Yan Y, Christensen S, Isakeit T, Engelberth J, Meeley R, Hayward A, Emery RJN, Kolomiets MV (2012) Disruption of OPR7 andOPR8 reveals the versatile functions of jasmonic acid in maize development and defense. Plant Cell 24: 1420-1436


Yao C, Wu Y, Nie H, Tang D (2012) RPN1a, a 26S proteasome subunit, is required for innate immunity in Arabidopsis. Plant J 71:1015-1028


Zuther K, Kahnt J, Utermark J, Imkampe J, Uhse S, Schirawski J (2012) Host specificity of Sporisorium reilianum is tightly linked togeneration of the phytoalexin luteolinidin by Sorghum bicolor. Mol Plant-Microbe Interact 25: 1230-1237



http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 111%5BVolume%5D AND 19149%5BPagination%5D AND Wei W%2C Davis RE%2C Nuss DL%2C Zhao Y%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wei W, Davis RE, Nuss DL, Zhao Y (2013) Phytoplasmal infection derails genetically preprogrammed meristem fate and alters plant architecture. Proc Natl Acad Sci USA 111: 19149-19154

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wei&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasmal infection derails genetically preprogrammed meristem fate and alters plant architecture&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasmal infection derails genetically preprogrammed meristem fate and alters plant architecture&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wei&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 24%5BVolume%5D AND 1420%5BPagination%5D AND Yan Y%2C Christensen S%2C Isakeit T%2C Engelberth J%2C Meeley R%2C Hayward A%2C Emery RJN%2C Kolomiets MV%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yan Y, Christensen S, Isakeit T, Engelberth J, Meeley R, Hayward A, Emery RJN, Kolomiets MV (2012) Disruption of OPR7 and OPR8 reveals the versatile functions of jasmonic acid in maize development and defense. Plant Cell 24: 1420-1436

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Disruption of OPR7 and OPR8 reveals the versatile functions of jasmonic acid in maize development and defense&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Disruption of OPR7 and OPR8 reveals the versatile functions of jasmonic acid in maize development and defense&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yan&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 71%5BVolume%5D AND 1015%5BPagination%5D AND Yao C%2C Wu Y%2C Nie H%2C Tang D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yao C, Wu Y, Nie H, Tang D (2012) RPN1a, a 26S proteasome subunit, is required for innate immunity in Arabidopsis. Plant J 71: 1015-1028

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=RPN1a, a 26S proteasome subunit, is required for innate immunity in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=RPN1a, a 26S proteasome subunit, is required for innate immunity in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yao&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant%2DMicrobe Interact%5BTitle%5D%29 AND 25%5BVolume%5D AND 1230%5BPagination%5D AND Zuther K%2C Kahnt J%2C Utermark J%2C Imkampe J%2C Uhse S%2C Schirawski J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zuther K, Kahnt J, Utermark J, Imkampe J, Uhse S, Schirawski J (2012) Host specificity of Sporisorium reilianum is tightly linked to generation of the phytoalexin luteolinidin by Sorghum bicolor. Mol Plant-Microbe Interact 25: 1230-1237

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zuther&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Host specificity of Sporisorium reilianum is tightly linked to generation of the phytoalexin luteolinidin by Sorghum bicolor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Host specificity of Sporisorium reilianum is tightly linked to generation of the phytoalexin luteolinidin by Sorghum bicolor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zuther&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


Documents

Inflorescence Branching Effector of S. reilianum file2 23 SUPPRESSOR OF APICAL DOMINANCE 1 of Sporisorium reilianum Modulates 24 Inflorescence Branching Architecture in Maize and Arabidopsis1